Team:IISER-Pune-India/Constructs

<!DOCTYPE html> Title





Constructs

Overview


We designed two types of constructs: for genetic modification and for parts characterizations. In order to enable S. elongatus to export intracellular sucrose that it accumulates under salt stress, the cscB, sucrose permease transporter has to be heterologously expressed. We planned to do this through a genome modification using a CRISPR-Cas12a plasmid for which we designed constructs. We also planned to characterize the strength of various promoters in S. elongatus and their effects on sucrose export capacity.

We also planned to characterize the activity of the native bidirectional promoter of the csc operon in E. coli.

All constructs and primers were made using Geneious Prime and Benchling. PCR primers were analyzed using the IDT Oligo Analyzer tool.


S. elongatus constructs


The S. elongatus constructs were designed to be integrated into the genome using the pSL2680 plasmid[1]. This plasmid expresses, cpf1 (also known as Cas12a) which is an RNA-guided endonuclease[2] under a lac promoter. It also has an endogenous Francisella novicida CRISPR array from a J23119 promoter[3]. The array has three repeat sequences with spacers between them, and the first repeat has been replaced by a lacZ site flanked by AarI restriction sites, which allows one to replace the lacZ with oligos that form the new targeting sequence of a crRNA in a CRISPR array. Cpf1 processes the array transcript into mature crRNA which can be used to target Cpf1 to a specific region in the genome based on the oligo sequence (which acts as the guide RNA or gRNA).

There are also restriction sites for KpnI and SalI downstream of the CRISPR array in which homologous repair templates can be inserted. Using this plasmid one can thus insert a sequence of interest in the genome using homology-directed repair.


Figure 1: Map of the pSL2680 plasmid adapted from: Cpf1 Is A Versatile Tool for CRISPR Genome Editing Across Diverse Species of Cyanobacteria. Ungerer J, Pakrasi HB. Sci Rep. 2016 Dec 21;6:39681. doi: 10.1038/srep39681. 10.1038/srep39681 PubMed 28000776


For the purpose of our project, all constructs were designed to integrate into neutral sites of S. elongatus. Neutral sites are loci in the genome with unknown functions that can be disrupted without affecting cellular viability or causing any distinct phenotypes[4]. We constructed homology repair templates for inserting sequences into either Neutral Site I or Neutral Site III of the S. elongatus genome. The gRNA targets Cpf1 to a 20bp region in the Neutral Site of the genome, where Cpf1 makes a double-stranded break with a 5' overhang. The homologous repair template flanked by 'homology arms' to the Neutral Site is then used by the cell for homology-directed repair, which integrates the homologous repair template into the genome.

For our project, we aimed to insert cscB (sucrose permease) into the genome, which is a symporter that transports sucrose and H+ across the membrane[5]. This will allow S.elongatus to export the sucrose it produces intracellularly in response to salt stress as an osmoprotectant[5].

In cyanobacterial cells, sucrose is synthesized from uridine diphosphate glucose (UDP-Glu) and fructose 6-phosphate (F6P) by sucrose-phosphate synthase (SPS) and sucrose-phosphate phosphatase (SPP) which has been shown to lead to a 2-fold enhancement in intracellular sucrose concentration in Synechocystis sp. PCC 6803[6] .

We also aimed to overexpress the native gene sps which encodes a fusion protein of the enzymes SPS and SPP.. Sucrose phosphate synthase (SPS) is an enzyme that catalyzes the rate-limiting conversion of uridine diphosphate glucose (UDP-Glu), and fructose 6-phosphate (F6P) into sucrose 6-phosphate (S6P)[6]. SPP catalyzes the final rate-limiting step in the sucrose-biosynthesis pathway[7].


Figure 2: Illustration showing the sucrose production pathway in S. elongatus UTEX 2973. Figure adapted from: Lin, P. C., Zhang, F., & Pakrasi, H. B. (2020). Enhanced production of sucrose in the fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Scientific reports, 10(1), 1-8.

We also wanted to test the sucrose export capacity of cscB under promoters of different strengths for which we designed the composite part BBa_K3971010. Our advisor Virmal Jain suggested we test a range of promoters since the number of sucrose permease transporters inserted into the membrane might have an effect on the membrane integrity of the cell. 

The construct BBa_K3971010 was designed such that the promoter is flanked by two restriction enzyme sites for NdeI and BamHI, and can be excised out to be replaced by another promoter, thus saving a lot of time on cloning the entire construct into a vector.

A similar construct, BBa_K3971028 was designed to integrate sps into Neutral Site III respectively. The sucrose export capacity could be tested along with cscB in the same strain since both constructs target different Neutral Sites in the genome.

The promoters we decided on were constitutive as our advisors Prem Pritam and Virmal Jain had suggested. They reasoned that that would be more carbon-conscious as compared to inducible promoters such as IPTG inducible promoters and would also make the process more inexpensive. Since S. elongatus grows more slowly than E. coli and produces viable sucrose titers for E.coli W with the sucrose operon repressor removed, after about 48 hours[8] having constitutive production would also ensure a steady sucrose supply for E. coli viability without the need for precise inductive control through inducible promoters.

We aimed to test the following promoters upstream of the cscB, sps and spp genes and their effects on sucrose production capacity.

We also wanted to characterize the strengths of these promoters in order to compare them, for which we designed BBa_K3971009 which expresses SYFP2 (super yellow fluorescent protein - BBa_K864100). This construct also had a NdeI and BamHI restriction site flanking the promoter for the aforementioned reasons.


However, since we only had about two months in the lab due to the second wave of the COVID-19 pandemic, we were not able to test out our constructs.


Figure 3: Illustration showing how the pSL2680 plasmid can be used to make edits in the genome by inserting a Homologous Repair Template into a Neutral Site.

gRNA and Homology Repair Template Design


This design guide has been adapted from [1].

Guide RNA Design


The guide RNA or target sequence depends on where one wants to make an edit in the genome. Choose a 20nt sequence in the genomic region of interest that is preceded by a PAM site (either CTN or TTN - where N represents any nucleotide). The 20nt sequence is the gRNA that Cpf1 will use to target that locus in the genome. Since the gRNA is only 20nt in length, it can be synthesized using complimentary primers that have the target sequence.


Figure 4: Illustration showing how to pick a gRNA target sequence for Cpf1.

The primers should have 5' overhangs that are complimentary to the overhangs on the plasmid after AarI cleavage, which will allow the gRNA to be ligated into the plasmid.

Use the following 5' overhangs:

Forward primer overhang - AGAT
Reverse primer overhang - AGAC

Figure 5: Illustration showing primers with the required overhangs in order to ligate it into the plasmid.


Note: The gRNA must be cloned into the plasmid before the homology repair template.

Homologous Repair Template Design



The homologous repair template can be used to make any modifications to the genome since the template will be used by the cell for homology-directed repair after cleavage by Cpf1 which will integrate the template into the genomic locus.

The template can be constructed in many ways. We considered using Gibson Assembly as it was described in [1], however, since we had about two months to work in the lab due to the second wave of COVID-19 in India we were not able to receive and work with the NEB Gibson Assembly kit.

For Gibson Assembly of the Homologous Repair Template into the KpnI site of the plasmid, the template should have the following overhangs on the terminal left and right ends:

Upstream overhang - CATTTTTTTGTCTAGCTTTAATGCGGTAGTTGGTACC
Downstream overhang - GCCCGGATTACAGATCCTCTAGAGTCGACGGTACC
The red sequence is the KpnI restriction site sequence.

The 'homology arms' to the neutral sites were both at least 750bp as suggested by our advisors Prem Pritam and Virmal Jain and as described in [1].

Protocol



The protocol for cloning both the gRNA and the Homologous Repair Template into the pSL2680 plasmid can be found here.

This protocol has been adapted from [1] and has been slightly modified based on inputs from our advisors Prem Pritam and Virmal Jain.

E. coli constructs



There is a native bidirectional promoter in the csc operon present in the pCSCX plasmid which was a gift from Claudia Vickers (Addgene plasmid # 63918 ; http://n2t.net/addgene:63918 ; RRID:Addgene_63918).

This plasmid consists of the cscA (invertase), cscK (d-fructokinase), and cscB (sucrose permease) genes that make E. coli capable of consuming and metabolizing sucrose. We aimed to characterize this promoter's activity for which we created the composite part BBa_K3971024.
The promoter is flanked by yellow fluorescent and blue fluorescent (reversed) proteins on both sides. To characterize its strength in both directions a relative fluorescence measurement can be made of the two proteins.



Based on the results of the promoter characterization, we aimed to compare other bidirectional promoters and test their effect on sucrose consumption and the growth rate of E. coli. However, due to the second wave of the COVID-19 pandemic in India, we only had two months in the lab and could not characterize this promoter and aim to do so in the future.

References



  1. pSL2680 was a gift from Himadri Pakrasi (Addgene plasmid # 85581 ; http://n2t.net/addgene:85581 ; RRID:Addgene_85581)
  2. Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., ... & Koonin, E. V. (2015). An updated evolutionary classification of CRISPR-Cas systems. Nature Reviews Microbiology, 13(11), 722-736.
  3. Cpf1 Is A Versatile Tool for CRISPR Genome Editing Across Diverse Species of Cyanobacteria. Ungerer J, Pakrasi HB. Sci Rep. 2016 Dec 21;6:39681. doi: 10.1038/srep39681. 10.1038/srep39681 PubMed 28000776
  4. Pinto, F., Pacheco, C. C., Oliveira, P., Montagud, A., Landels, A., Couto, N., ... & Tamagnini, P. (2015). Improving a Synechocystis-based photoautotrophic chassis through systematic genome mapping and validation of neutral sites. DNA Research, 22(6), 425-437.
  5. Ducat, D. C., Avelar-Rivas, J. A., Way, J. C., & Silver, P. A. (2012). Rerouting carbon flux to enhance photosynthetic productivity. Applied and environmental microbiology, 78(8), 2660-2668.
  6. Lin, P. C., Zhang, F., & Pakrasi, H. B. (2020). Enhanced production of sucrose in the fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Scientific reports, 10(1), 1-8.
  7. https://www.genome.jp/entry/3.1.3.24
  8. Hays, S. G., Yan, L. L., Silver, P. A., & Ducat, D. C. (2017). Synthetic photosynthetic consortia define interactions leading to robustness and photoproduction. Journal of biological engineering, 11(1), 1-14.
  9. Sengupta, A., Madhu, S., & Wangikar, P. P. (2020). A Library of tunable, portable, and inducer-free promoters derived from cyanobacteria. ACS Synthetic Biology, 9(7), 1790-1801.
  10. Sengupta, A., Sunder, A. V., Sohoni, S. V., & Wangikar, P. P. (2019). Fine-tuning native promoters of Synechococcus elongatus PCC 7942 to develop a synthetic toolbox for heterologous protein expression. ACS synthetic biology, 8(5), 1219-1223.