Team:Ecuador/Experiments
<!DOCTYPE html>
Description
Model
Experiments
Engineering
Safety
Implementation
Hardware
Production of dsRNA
1. Design of target-gene dsRNAs
Agrobactory 593 is a bacterial modular platform in which it is possible to change the target pathogen by changing the gene of interest and therefore the design of the interfering Ribonucleic acid (RNAi). To apply the RNAi approach in Fusarium oxysporum f. sp. cubense tropical race 4 (Foc TR4), we began a review of the literature to find genes involved in the pathogenicity of the fungus, we select only those that have been previously used in RNAi assays. Next, because to date Foc TR4 has not been reported in Ecuador, we use the Fusarium oxysporum f. sp. cubense race 1 (Foc R1) strain (less aggressive) available in our laboratory, therefore we look for the candidate genes to have homology between Foc TR4 and Foc R1. The genes SGE1, ERG11, Velvet, and SIX1 were chosen for their role in the development of diseases (banana Fusarium Wilt) such as conidia, virulence, synthesis of secondary metabolites (fumonisins and fusarins), and wilt [1]. Subsequently, the design of double stranded ribonucleic acid (dsRNA) was carried out using the E-RNAi [2]. For more details check Part collection .
Several critical candidate genes were investigated in Foc R4T to choose the genes for the dsRNA design. The silencing of these genes could limit the fungus' survival or dispersal capacity. In addition, because the entry of Foc R4T for investigation is forbidden and also it is not reported in the country, Foc R1 was considered for in vitro testing and a confirmation of the homology of these genes was performed. The candidate genes SGE1, ERG11, Velvet, and SIX1 were discovered based on these considerations. SGE1 promotes the expression of SIX, which is required for the formation of conidia. ERG11 plays a role in the synthesis of ergosterol as well as conidia formation. Velvet is involved in the development of hyphae, the generation and germination of conidia, and the formation of virulence-inducing secondary metabolites. SIX1 plays the role of a virulence factor. Furthermore, it was discovered that ERG11 and SIX1 were used to silence Foc R4T [3], [4]. In Foc R1, SGE1 and Velvet have also been used [5], [6].
For the design of the dsRNA, we used the E-RNAi program and we validated its physicochemical characteristics. As criteria, we selected 21 nucleotide target sequences that begin with AA and are located within a region of the coding sequence, 50-100 nucleotides of the AUG start codon, and within 50-100 nucleotides of the stop codon. The presence of AA at the beginning of the sequence allows the use of dTdT at the 3 'end of the antisense sequence. We considered that the GC content should be less than 50% and we avoided sequences with repeats of three or more G or C, since its presence initiates intramolecular secondary structures that prevent silencing hybridization. Furthermore, we confirmed that RFC10-compatible restriction sites are not found in the sequences [6].
b. Primers design for gene identification| Primer | Sequence 5 '- 3' | Length (bp) | PCR product (bp) |
|---|---|---|---|
|
ERG11_F ERG11_R |
TTCCACTGGTTCCCTTTCGT TTGGCATTAGGGCAATCGTA |
20 20 |
340 |
|
SGE_F SGE_R |
ATGTCTGGAACCATGCCACTC CTACCACCACGCCTGACCATA |
21 21 |
951 |
|
Sixpb_F Sixpb_R |
ACCCGAGGACCGAGACTTTA CTGCGTGTCCGTATCATCCA |
20 20 |
180 |
|
Six1_F Six1_R |
CCGGATTTTGAGCTTTCGAC GTAGTGTTTGGAGGGCTTTAG |
21 22 |
720 |
|
Velvet_F Velvet_R |
ACTTTTGACTACAACGCCA CCCGCTTCCTCATACGAAC |
19 19 |
407 |
From the culture of the Foc R1 fungus in potato dextrose broth (PDB) medium with two weeks of growth, we proceeded with the extraction of deoxyribonucleic acid (DNA) (Benchling protocol) .
d. PCRUsing polymerase chain reaction (PCR), the genes of interest Velvet, Six1, Erg11, SGE were amplified (Benchling protocol).
2. Target-gene fragment production
In order to design interference RNAs that silence the virulence and viability genes of Foc R1 and TR4, we generate fragments for the production of specific dsRNAs for each gene of interest (SGE, ERG11, Velvet, and SIX1), which will be assembled (using restriction enzymes) with the widely used plasmid [7] (L4440 and L4440 enhanced).
To add restriction sites (RS) to the fragments for the dsRNA production, primers overhangs with RSs were designed for PstI and XbaI, compatible with the RFC10 assembly, described below. The fragments obtained will be assembled in the conventional plasmid L4440.
| Primer | Sequence 5 '- 3' | Length (bp) | PCR product (bp) |
|---|---|---|---|
|
dsRNA_ERG11_F dsRNA_ERG11_R |
attctgcagCTAAGGACAACGATGACAC acttctagaGTCGGGATGGTGTACTTG |
28 27 |
403 |
|
dsRNA_Velvet_R dsRNA_Velvet_F |
ttactgcagGGCGGACAGAAAGGT cagtctagaTGTGGAAGAGGGCAAG |
24 25 |
215 |
|
dsRNA_SGE1_R dsRNA_SGE1_F |
cgttctagaGGTACTGTTGTTGTGGCT actctgcagTGCCCAGTGATGATGA |
27 25 |
498 |
|
dsRNA_Six_F dsRNA_Six_R |
cgttctagaCGCCAGGAAGTCTACCAGA attctgcagTCCACCGTCGGCACCTT |
28 26 |
548 |
Due to the suggestion of our advisors, we decided to change the design of our chassis, so we changed the design and assembly of our parts, being necessary to add RS for the BglII (forward end) and KpnI (reverse end) enzymes, as described below. The obtained fragments will be assembled into the improved plasmid L4440.
| Primer | Sequence 5 '- 3' | Length (bp) | PCR product (bp) |
|---|---|---|---|
|
dsRNA_ERG11_F_2 dsRNA_ERG11_R_2 |
aaaaagatctGACACCATTAAGGAGCGAC aaaaggtaccAAGTAGGCCGAGTCAGTAGC |
29 30 |
481 |
|
dsRNA_SGE1_F_2 dsRNA_SGE1_R_2 |
aaaagatctCCCTTTCCAAACAGGCC aaaggtaccCCGTGTTGAGCTTCCTC |
26 26 |
324 |
|
dsRNA_SIX1_F_2 dsRNA_SIX1_R_2 |
aaaagatctAGACACACATCTAGGCGA aaaggtaccACCTTGAGCAATTCGACC |
27 27 |
639 |
|
dsRNA_Velvet_F_2 dsRNA_Velvet_R_2 |
aaaagatctGCAGCCTCTGGTATCAGA aaaggtaccACTCTCCATCAATCCAGGA |
27 28 |
548 |
The process began with the cultivation of Foc R1 in a static PDB medium, two growth stages were evaluated at 7 days and 14 days. Subsequently, RNA extraction was carried out, using a Kit that includes DNA degradation using DNase, ensuring the obtaining of good quality RNA (Benchling protocol) .
c. Reverse transcriptionReverse transcription, a process in which strands of RNA are converted into complementary DNA (cDNA) using enzymes called reverse transcriptases. We use RNA (extracted the same day) and random primers and Olido dT that hybridize with the template RNA and generate a starting point for synthesis (Benchling protocol).
d. Overhang PCRAmplification of fragments for the production of dsRNA by overhang PCR In order to add restriction enzymes sequences to our PCR product, we performed an overhang PCR. This technique uses the fidelity of the 3’ end of primers for a specific target to allow the addition of more sequence to the 5’ end (Benchling protocol).
3. Bacterial production of dsRNA using pL4440
Conventional dsRNA production is performed in Escherichia coli HT115 because it is a strain deficient in RNase III, an enzyme that could degrade dsRNA [1]. We decided to transform the L4440 plasmid linked to the target-gene fragment into E. coli DH5α, a strain with which the transformation protocol had previously been standardized in our laboratory. Once this step was completed, the aim was to extract the ligated plasmid from E. coli DH5α and bring it to a concentration suitable for transformation to E. coli HT115. Conventional dsRNA production is performed by induction with isopropyl-β-D-1-thiogalactopyranoside (IPTG) to activate the T7 promoter and initiate transcription [3].
The extraction of the L4440 plasmid was performed using the lysis-alkaline protocol, which is based on the fact that the chromosomal and plasmid DNA denature at different conditions, which can be used to separate them (Benchling protocol) .
b. Digestion and ligationTarget-gene fragments and L4440 plasmid were digested using enzymes Xba I and Pst I following instructions of the insert supplied by Promega corporation. Ligation was carried out using T4 DNA ligase of the same brand (Benchling protocol) .
c. Competent cells preparationCompetent cells were obtained from an E. coli culture with an OD=0.45. CCMB80 buffer widely used in iGEM was used to prepare chemically competent cells (Benchling protocol) .
d. Bacterial transformation- DH5α: E. coli DH5α strain was the first host considered due to the high efficiency of transformation reported in the literature. The bacterial transformation was developed by thermic shock following a variation of Hannah protocol.
- HT115 (DE3): E. coli HT115 strain was transformed by thermic shock as mentioned above (Benchling protocol) .
e. dsRNA production in HT115 strainLigation to plasmid L4440 was verified by Colony PCR using the following primers:
| Primer | Sequence 5 '- 3' | Length (bp) | PCR product (bp) |
|---|---|---|---|
|
pL4440C_F pL4440C_R |
gttttcccagtcacgacgtt tcagtgagcgaggaagcaac |
20 20 |
304 |
Subsequently, the transformed strain HT115 was cultivated until an OD = 0.4, at which time the inducer of IPTG would be added to start the production of dsRNA (Benchling protocol) .
f. dsRNA extraction and purificationdsRNA was obtained for conventional purification as reported by Seung-Joon Ahn and collaborators [1] (Benchling protocol) .
4. pL4440 improvement
In order to improve the production of dsRNA in E. coli DH5α and HT115 strains, we enhance the conventional plasmid L4440, bidirectional sequences of the T7 promoter, and two terminators were introduced into the plasmid backbone using 3A assembly and simple assembly. Also, ribosome binding sites and Shine-Dalgarno were added to provide stability to the dsRNA. For more details check Part collection .
Primers were designed to add RSs for the EcoRI, PstI, and SpeI enzymes to the conventional plasmid L4440 (subsequent simple and 3A Assembly). In addition, primers were designed for the verification of 3A Assembly.
| Primer | Sequence 5 '- 3' | Length (bp) | PCR product (bp) |
|---|---|---|---|
|
pL4440Modf_F pL4440Modf_R |
aaaGAATTCGCGGCCGCTTCTAGccttcctcgctcactga aaaTACTAGTAGCGGCCGCTGCAGtcgttttacaacgtcgtg |
40 42 |
2548 |
|
BBa_G00100 BBa_G00101 |
tgccacctgacgtctaagaa attaccgcctttgagtgagc |
20 20 |
314 |
Plasmids (pSB1C3 and pL4440 ) were extracted from bacteria grown in Luria Bertani medium (Benchling protocol) .
c. L4440 plasmid modification by PCRAmplification and modification of plasmid L4440 was performed using a high fidelity polymerase (Benchling protocol) .
d. Digestion and ligationThe gBlocks being designed in two parts (UP and DOWN), and it should be noted that both parts have the green fluorescence protein (GFP) indicator protein for easy visualization of a correct binding. Both necessary parts were digested with the enzymes EcoRI and PstI. The same enzymes were used for the digestion of the Backbones (pSB1C3 and pL4440) (Benchling protocol) .
e. Production of the assembled plasmidAfter obtaining competent E. coli DH5α cells, the bacterial transformation was carried out. This was done in order to obtain a greater amount of gBlocks, for both processes the previously mentioned protocols were used.
f. Digestion for 3A AssemblyAfter obtaining the assembled plasmids with the UP and DOWN parts, we proceeded with their digestion and ligation. The UP parts were digested with EcoRI and SpeI and the DOWN parts with PstI and XbaI. In both cases, gel purification was performed and the band corresponding to ~ 185 bp was cut. A similar process was carried out with the Backbones, using the EcoRI and PstI enzymes (gel and plasmid purification ~ 2 Kb) (Benchling protocol) .
g. AssembliesTwo types of assemblies were tried
- 3A Assembly: For the 3A assembly, the molar ratio used was vector: part UP: part DOWN of 1:25:25 (Benchling protocol) .
- Simple Assembly: From the assembled plasmids with the UP and DOWN parts, we proceeded to perform a simple assembly, in which the plasmid with the UP part was digested with PstI and SpeI enzymes (used as Backbone ~ 2 Kp) and the plasmid with the DOWN part was digested with PstI and XbaI enzymes (used as Insert ~ 185 bp). Expecting a final plasmid of ~ 2400 bp which has the UP and DOWN parts separated by the BglII and KpnI enzyme restriction sites. Subsequently, the transformation was carried out in E. coli DH5α.
h. Colony PCRLigation of the insert into the plasmid was verified by colony PCR using primers BBa_G00100 and BBa_G00101. The expected fragment is 646 bp (Benchling protocol) .
i. Addition of the fragments for dsRNA productionThe resulting plasmid from simple assembly (~ 648 pb) and the fragments for dsRNA production were digested with KpnI and BglII enzymes (Benchling protocol) . Both the final plasmids and the amplicons for each gene were purified. Then, they were ligated (expected size of 1.1 Kb) and transformed into E. coli HT115 (DE3) strain.
j. dsRNA production in HT115 strainThe production of dsRNA was carried out by induction with IPTG. Finally. DsRNA extraction and purification was performed (Benchling protocol) .
References
[1] V. Gurdaswani, S. B. Ghag, y T. R. Ganapathi, “FocSge1 in Fusarium oxysporum f. sp. cubense race 1 is essential for full virulence”, BMC Microbiology, vol. 20, núm. 1, p. 255, ago. 2020, doi: 10.1186/s12866-020-01936-y
[2] H. Thomas, and M. Boutros. “E-RNAi: a web application for the multi-species design of RNAi reagents--2010 update.” Nucleic acids research vol. 38,Web Server issue (2010): W332-9. doi:10.1093/nar/gkq317
[3] T. Dou et al., “Host‐induced gene silencing of Foc TR4 ERG6/11 genes exhibits superior resistance to Fusarium wilt of banana,” Plant Biotechnol J, vol. 18, no. 1, pp. 11–13, Jan. 2020, doi: 10.1111/pbi.13204.
[4] S. Widinugraheni et al., “A SIX1 homolog in Fusarium oxysporum f.sp. cubense tropical race 4 contributes to virulence towards Cavendish banana,” PLOS ONE, vol. 13, no. 10, p. e0205896, Oct. 2018, doi: 10.1371/journal.pone.0205896.
[5] V. Gurdaswani, S. B. Ghag, and T. R. Ganapathi, “FocSge1 in Fusarium oxysporum f. sp. cubense race 1 is essential for full virulence,” BMC Microbiology, vol. 20, no. 1, p. 255, Aug. 2020, doi: 10.1186/s12866-020-01936-y.
[6] S. B. Ghag, U. K. S. Shekhawat, and T. R. Ganapathi, “Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium wilt in banana,” Plant Biotechnol J, vol. 12, no. 5, pp. 541–553, Jun. 2014, doi: 10.1111/pbi.12158.
[7] S. Ahn, K. Donahue, Y. Koh, et al., “Microbial-Based Double-Stranded RNA Production to Develop Cost-Effective RNA Interference Application for Insect Pest Management” International Journal of Insect Science, vol. 11, pp. 1-8, 2019. doi; 10.1177/1179543319840323
Delivery and Release
QS-based lysis protein/population oscillator
This test was performed to characterize the influence of the Quorum Sensing (QS) system, based on the Lux operon, on the expression of a gene of interest To accomplish so, the plasmid including the LuxI, LuxR, and GFP components regulated by the pLUx promoter, as well as the iGEM parts of LOR and the chloramphenicol resistance gene, was assembled. A 4kpb plasmid was obtained after assembly and converted into E. cloni® cells (Lucigen). Fluorescence and absorbance measurements were taken with an OD600 greater than 0,05. Due to the increase in the bacterial population, QS signals begin to increase, due to the secretion of acyl-homoserine lactone (AHL) molecules, which promotes the expression of the Lux operon and leads to the production of GFP. As a result, enhanced GFP expression is a good indicator of how well the QS-based expression system is working.
- All experimental measurements were taken with Biotek CytationTM 3, using a 96-well plate.
- The cells were E. cloni® cells (Lucigen) transformed with the corresponding plasmid.
- For all experiments, we worked with an isolated colony that contains the corresponding plasmid.
- Cultures of 3mL falcon tubes with sLB medium with the corresponding antibiotic were prepared and incubated overnight (18 hours) at 37°C, 200 rpm.
- The overnight cultures were refreshed in 3 mL of sBL with the corresponding antibiotic and incubated at 37°C, 200 rpm for 4 hours.
- Culture tubes at OD600=0.05 were sit in cold water for 30 mins.
- We measured absorbance and fluorescence of four replicas of the sample starting with OD600=3.05e-6 during 14 hours.
b. ProtocolTime between measures 5 min, Temperature 37°C, Shaking Double orbital (Continuously), Absorbance wavelength 600 nm, Excitation wavelength 485 nm, Emission wavelength 528 nm, 96-well volume (individual) 200 μl.
RNA silencing
In vitro inhibition test
One approach to validate a candidate gene is to introduce an RNAi elicitor molecule into pest cells and assess its effect on the silencing phenotype [1]. These investigations were conducted to assess the effects of synthetic dsRNA molecules homologous to selected target genes on Foc R1. The assessment was performed using in vitro assays to measure the effects of the dsRNAs on spore germination and subsequent colony establishment.
This protocol aims to obtain conidia from Foc R1, this will be used in the inhibition assays (Benchling protocol) .
The antifungal activities of the dsRNA molecules were tested by a reduction in colony number with the following administration by imbibition into spores of Foc R1, as described by Bailey and Niblett [2]. We conducted experiments to determine the optimal test concentration of dsRNAs to use in the spore germination inhibition bioassays (Benchling protocol) .
References
[1] F. M. Mumbanza, A. Kiggundu, G. Tusiime, W. K. Tushemereirwe, C. Niblett, and A. Bailey, “In vitro antifungal activity of synthetic dsRNA molecules against two pathogens of banana, Fusarium oxysporum f. sp. cubense and Mycosphaerella fijiensis,” Pest Manag. Sci., vol. 69, no. 10, pp. 1155–1162, Oct. 2013, doi: 10.1002/ps.348
[2] A. Bailey and C. Niblett, “Bioassay for gene silencing constructs,” US20100257634A1, 2010 [Online]. Available: https://patents.google.com/patent/US20100257634A1/en
