Team:Yonsei Korea/Engineering

IGEM_YONSEI

In the Laboratory:

The Science
Behind It All

ENGINEERING SUCCESS
OVERVIEW        

    To develop a diagnosis tool in detecting the Magnaporthe oryzae fungi, we incorporated engineering along with synthetic biology into our research. Our goal was to develop a proof of concept for a detection system, which is simple but specific. Also, we aimed to design a tool that is easy to use and visualize, so that many people will be able to use it. Therefore, it was essential for us to incorporate the engineering design cycle: research → imagine (brainstorming) → design → test → learn & improve. We have optimized this in a way that is suitable and practical for our research.

    We divided our research into two phases, and went through several iterations of the engineering design cycle for each phase. Phase 1 aimed to apply synthetic biology to develop a system that could specifically detect the Magnaporthe oryzae gene. Phase 2 aimed to apply nanoscience and technology to develop a colorimetry tool to visualize the specific detection, which is important for practical purposes.

Through our stages of the engineering design cycle, we have achieved the following:

  1. 1. DNAzyme specifically detects the mif23 gene of Magnaporthe oryzae.
  2. 2. The detection system based on DNAzymes is effective, as DNAzyme cleavage activity is proportional to the amount of the substrate gene.
  3. 3. DNAzyme is specifically catalyzed by Cu2+ ions.
  4. 4. Gold nanoparticles are functionalized with the complementary sequences to our target gene.
PHASE ONE        
Phase 1: Applying synthetic biology in developing a specific detection system for Magnaporthe oryzae
1st cycle

1. Research
    After acknowledging that Magnaporthe oryzae and rice blast disease are severe issues in rice plantations, we started research on the current diagnosis and treatment methods of the rice blast disease. We found that current detection systems rely on Artificial Intelligence (AI) technologies (Chen, Ling, et al.) or PCR-based methods. Although these methods demonstrate rapid detection, we have found out that they are skill extensive or show late diagnosis. In addition, they are expensive, so farmers are not able to utilize current technologies. Current treatment methods have many potential problems as well, as farmers rely heavily on chemical fungicides (Magar, Acharya, et al.). Chemical fungicides are sprayed extensively at each stage of rice growth, causing pollution and posing a risk in the ecosystem, as they are highly toxic.

    To develop a nucleic acid-based diagnosis tool, we researched more on PCR-based detection systems, to get an idea about which genes can be used as a target for our detection system. The following is what we found as potential targets for detection:

2. Imagine (brainstorming)
    Based on the research, we started brainstorming the factors that should be considered in designing our diagnosis tool. First, it should be simple and easy to use. We thought that current technologies such as PCR are not practical for farmers to use, so we tried to incorporate DNAzymes into our research. Second, specific detection should take place. To do this, our system should target genes that are specific to M. oryzae. Third, it should be visualized with the naked-eye: it would not be practical to use expensive and complicated softwares or machines, nor need specific environmental conditions. We drafted ideas regarding colorimetry analysis, such as incorporating fluorescence or nanoparticles to show color change. Lastly, it should be affordable. To accomplish this, we thought of ideas that use the least amount of materials and equipment possible. This would not only reduce the price, but would also enhance the simplicity of the detection system.

Through this stage of brainstorming, we established the goal for the design phase: using DNAzymes that can specifically detect a unique gene of M. oryzae, and observing this activity with gold nanoparticles (colorimetry analysis). We incorporated DNAzymes into our idea, mainly because it would enhance the simplicity of our detection system, but not decrease specificity at the same time. Unlike many PCR-based detection methods, DNAzymes do not require DNA amplification and do not use specific enzymes. Therefore, complex buffer conditions and skills to use advanced instrumentations are not required. At the same time, it has high specificity, since it only exercises cleavage activity when the left and right binding arms of DNAzyme are properly bound to the target DNA. As we are aiming to develop a proof of concept that is simple and easy to use for farmers, we thought that DNAzymes would be a great idea in this context.

3. Design
    We incorporated the F-8 DNAzyme into our research to detect the unique gene of M. oryzae. Based on our research, we selected the mif23 gene as the target.

As the F-8 DNAzyme specifically catalyzes the cleavage at the thymidine of YTGC (Y=T/C) sequence, we found potential regions of the mif23 gene (Genbank ID: GI 4732021) where the F-8 DNAzyme could bind and cleave it. Based on this, we designed 4 possible DNAzymes.

    For example, our DNAzyme A would cleave the target Gene A based on the following mechanism:

Gene A
5’-acggccagtgccggcgacagctctagcaaccccactggctcggctgcctccgtcaccaaatccgggtcaggaccgcgggagacaaact-3’

DNAzyme A
3’-tgccggtcacggccgctgtcgagatcgttggggtgaccgagccgcctgggccgtaggtggaggcagtggtttaggcccagtcctggcgccctctgtttga-5’

  1. ● The blue highlighted ctgc sequence in Gene A is specifically recognized by the DNAzymeA. Among the “CTGC”, T (thymidine) is where DNAzymeA specifically exercises its catalytic activity.
  2. ● The purple highlighted gcctgggccgtaggtg sequence represents the loop structure of the DNAzyme. On the left is the left-binding arm (green), and on the right is the right-binding arm (pink). As described in the figure below, hybridization between complementary base pairs occurs. The left-binding arm can hybridize with the green sequence in Gene A, and the right-binding arm can hybridize with the pink sequence in Gene A.
  3. ● Therefore, DNAzymeA and target GeneA would interact as:

    In addition, in order for the DNAzymeA to be activated, important ions such as Cu2+ is essential. Therefore, with the addition of Cu2+, the target Gene A will be cleaved as below:

Gene A
5’-acggccagtgccggcgacagctctagcaaccccactggctcgg
ctgc
ctccgtcaccaaatccgggtcaggaccgcgggagacaaact-3’

DNAzyme A
3’-tgccggtcacggccgctgtcgagatcgttggggtgaccgagcc
gcctgggccgtaggtggaggcagtggtttaggcccagtcctggcgccctctgtttga-5’

    In designing our experiment, we added 3 controls. Therefore, 4 different types of conditions were tested in one experiment.

4. Test
    The synthetic DNA was ordered from BIONICS, a biotechnology company based in Korea.

    We designed the cleavage assay experiments based on the protocol provided by Wang, Zhang, et al. The difference between 3 and 4 is whether the reaction buffer was added. Therefore, in 3, the DNAzyme-substrate is expected to hybridize with each other, but it will not be cleaved. In contrast in 4, cleavage activity is expected to be shown as the reaction buffer is added.

    To ensure proper and specific hybridization between the DNAzyme and the substrate gene, the DNAzyme-substrate mixture was heated at 90°C for 5 minutes and cooled at 25°C (room temperature) for 10-15 minutes. The cleavage assay was then tested for DNAzyme-substrate A and B. Thereafter, the samples were incubated at 37°C for 16 hours for the cleavage reaction to occur. Finally, EDTA was added to stop the cleavage reaction.

    To visualize the results, agarose gel electrophoresis was performed. We optimized the agarose gel electrophoresis by trying at different agarose concentrations (1%, 1.2%, 2%), different gel running times (30 minutes, 10 minutes, every 10 minutes for 30 minutes), and different voltages (100V, 135V, 200V). To ensure that the DNA were properly stained by SYBR Green, we viewed it under the UV light as well. In addition, Nanodrop was done to ensure the DNA concentration and purity.

5. Learn & Improve
    From the agarose gel electrophoresis results, we were able to check that the hybridization between the DNAzyme and gene substrate occurs, by comparing sample 1 and 2 with sample 3: compared to the bands for samples 1 and 2 (which only contain either DNAzyme or substrate), the bands for sample 3 was thicker, which suggests that hybridization occurred. It seemed that the cleavage activity occurred when looking at sample 4, because the intensity of the band is weaker, compared to sample 3.

    However, the main problem was that the band for sample 2 were not appearing for all cases: both gene A and gene B were not appearing as a single band. DNA was properly stained when it was viewed under the UV light, so we assumed that other experiment methods other than agarose gel electrophoresis should be used to view the results. Also, although the intensity of the band at 4 decreased, we were not seeing expected bands which represent the cleaved products. We were expecting to see bands around 40 bp, but we were not able to visualize them.

Another concern was that the DNA purity was not good, as the Nanodrop results show. For instance, the 260/280 ratio of sample 1 - 4 from DNAzyme-substrate B were all above 1.8, which indicates that DNA in all of the samples are not pure (low purity). This suggests that the quality of the DNA might be low, which might interfere with the DNAzyme cleavage activity, as F-8 DNAzyme cleavage is highly dependent on the exact sequence: at the thymidine of YTGC (Y=T/C) sequence.

    For improving our research for the 2nd cycle, we need to consider the following:

  1. (1) Another experiment method for better visualization of bands
  2. (2) Add controls to optimize the experiment process and see how each procedure in the experiment affects the cleavage reaction
2nd cycle

1. Research
    In the 2nd cycle, we aimed to improve the visualization of the bands. Therefore, we researched other experiment methods other than agarose gel electrophoresis. We have found that native PAGE and denaturing PAGE were also used frequently. Agarose gels are used for large fragments of DNA, whereas polyacrylamide gels are better to use for shorter lengths of DNA. The difference between native and denaturing PAGE was that denaturing PAGE uses urea, so that double-stranded DNA will be separated into single-stranded DNA.

2. Imagine (brainstorming)
    Since our target gene is 88bp and DNAzyme is 100bp in length, we thought that PAGE would be a more suitable method for our experiment. Also, the cleaved gene products are about 40bp in length, so agarose gel electrophoresis would not be the best in visualizing. In addition to brainstorming about experiment methods, we have found the need to add more controls to optimize the experiment process and see how each procedure in the experiment affects the cleavage reaction.

3. Design
    In the 2nd cycle, we added two additional controls: how EDTA and heat incubation at 90°C affects the cleavage reaction.

  1. ● Sample 5: Equal to 4, but without EDTA. Since EDTA is not added, the ions present in the reaction buffer will not be chelated. In other words, since the ions are still present after 16 hours of incubation at 37°C, the DNAzyme will still be active. As a result, DNAzyme will be able to cleave the target substrate.
  2. ● Sample 6: Equal to 4, but without the heat incubation at 90°C.

    After the cleavage reaction, it was visualized with native PAGE (12% and 15%). The gel was run at 90V for 120 minutes. The figure below represents the native PAGE results.

1. Interpretation & analysis of bands
    It was possible to observe bands at 4 distinct locations, which are (a), (b), (c), and (d) in Figure 1. (c) and (d) each represents DNAzyme A and Gene A. (a) is observed in A-3 and A-4, but not in A-1 and A-2. Therefore, (a) would represent DNAzyme-Gene A hybridized, but not reacted or cleaved. This is because DNAzyme requires specific ions such as Cu2+ and Mn2+ to exercise its cleavage activity. However, since none of these are present in A-3, DNAzyme would not be catalyzed, and therefore would not cleave the gene (substrate) even though the two stands are hybridized with each other. (b) is only observed in A-4, and this represents that the cleavage activity occurred. Since A-4 contains the important ions such as Cu2+ and Mn2+, activated DNAzyme could cleave the gene (substrate). As gene (substrate) is cleaved at CTGC by DNAzyme, this 4bp would be released and the structure of the DNAzyme-gene complex would change. In other words, the cleaved gene except for CTGC is still hybridized with the DNAzyme binding arms, but has a different secondary structure compared to unreacted DNAzyme-gene hybridized structure. Since migration in PAGE is also affected by structure as well as size, the resulting product would be present at (b).

The diagram below represents possible structures that might have formed:

  1. ● Green: DNAzyme
  2. ● Yellow: Left-binding arm of the target gene
  3. ● Red: CTGC sequence - sequence where DNAzyme specifically recognizes the target gene
  4. ● Orange: Right-binding arm of target gene

2. Quantification of the band intensity
    Using Fiji, an image analysis software, we measured the light intensity of each of the bands (Figure 2a). Fiji measures the mean of the light intensity of the pixels within the selected area. The area of measurement was kept constant as 925. The result is shown as in Figure 2b (15% PAGE) and 2c (12% PAGE). (a), (b), (c), (d) represent the same thing as above.

The quantification process was conducted as:

  1. 1) Since the background is blue, adjust the picture into an 8-bit image.
  2. 2) Measure the mean light intensity of the background and each band.
  3. 3) Subtract the background value from the value of each band to calculate the net band intensity.

3. Analysis
    With the band intensity measurement results, we compared and analyzed the following:

4. Summary of the results

Urea PAGE results

    Sample DNAzyme-gene (substrate) A was reacted with a 2x reaction buffer. Here, a total 7 samples were tested: A-1 to A-7. Unlike in native PAGE, only the 2x buffer was used. Details about each sample can be found below:

    Samples A-4, 5, 6, 7 all contain 2x reaction buffers including CuCl2, but the ratio between DNAzyme: gene concentration varies. However, the concentration of DNAzyme is kept constant. A-4 has the minimum concentration and A-7 has the maximum concentration of gene A.

After the cleavage reaction, it was visualized with urea PAGE (8%). The gel was run at 200V for 40 minutes. The figure below represents the urea PAGE results.

1. nterpretation & analysis of bands
    Neglecting side bands and noises, it was possible to observe meaningful bands at 4 distinct locations, which are (a), (b), (c), and (d) in Figure 5.
    Some things to note is that although urea PAGE was used to separate possible hybridization complexes into single stranded DNA, the results showed that denaturing did not occur properly. In other words, the urea within the gel mesh would not be useful because the denaturation was not complete during the sample preparation step. To get rid of this, we could extend the denaturation time for 30 minutes or more. Also, since our target gene substrate and DNAzyme is single-stranded as its own, it could have formed additional secondary structures on its own. This led us to observe a similar band pattern as in native PAGE results.

    In addition, a lot of side bands and noises were detected, as seen at the upper and lower part of the urea PAGE gel. We ordered our DNA products without HPLC purification, meaning that other truncated synthesis products were not removed. Ensuring the high purity of our samples was not possible due to funding constraints, so this could have affected our results. This was evident from the appearance of several unspecific bands (contributing to a high background noise) in all lanes including the control groups: ssDNAzyme and single-stranded target gene.

    (c) and (d) each represent DNAzyme A and Gene A. (a) is observed in A-3 and A-4, but not in A-1 and A-2. Therefore, (a) would represent DNAzyme-Gene A hybridized, but not reacted or cleaved. This is due to the same reasons as in the native PAGE section. However, (b) appeared in urea PAGE, which was not present in native PAGE results. Unlike the thin band (b) in native PAGE, 2 bands were overlapping in urea PAGE (b). It is difficult to observe the 2 overlapping bands when the gene (substrate) concentration is low, but it becomes clear as the concentration increases, as shown in A-7 sample. (b) represents the cleaved products: the intensity is very weak in A-3, whereas it is clearly visible in A-4 to A-7. In fact, the weak intensity of (b) at A-3 might be just noise, as the intensity is very dim. The cleaved products (b) in urea PAGE would be analogous to (b) in native PAGE, although there is a difference in the appearance and the location of the bands. Although denaturation by urea was not 100% efficient, urea definitely would have affected the structure of the cleaved DNAzyme-gene structure, resulting in a different structure from (b) in native PAGE.

The diagram below represents possible structures that might have formed:

  1. ● Green: DNAzyme
  2. ● Yellow: Left-binding arm of the target gene
  3. ● Red: CTGC sequence - sequence where DNAzyme specifically recognizes the target gene
  4. ● Orange: Right-binding arm of target gene

2. Quantification of the band intensity
    As we did in native PAGE result analysis, we used Fiji to measure the light intensity of each of the bands (Figure 6a). The area of measurement was kept constant as 940. The result is shown in Figure 6b. (a), (b), (c), (d) represent the same thing as above.

The quantification process was conducted as:

  1. 1) Measure the mean light intensity of the background and each band.
  2. 2) Subtract the background value from the value of each band to calculate the net band intensity.

3. Analysis
    With the band intensity measurement results, we compared and analyzed the following:

4. Summary of the results

PART 2: NANOpARTICLES FUNCTIONALIZATION        
UV-Vis absorption aample DNA quantification

    Phase 1 of using gold nanoparticles for our detection system is to functionalize them with our 20 base pair complementary sequences to our target gene. Here we began the salt aging method to functionalize both thiolated DNA sequences TS1: 3’-tgccggtcacggccgctgtc-5’ and TS2: 3’-atcgttggggtgaccgagcc-5’ to two samples of gold nanoparticles. In total we have four samples (2 for TS1 and 1 for TS2). This enables better chances of proceeding with better functionalized gold nanoparticles as some samples could aggregate early on in the experiments.

  1. 1. Sample A1: 3’-tgccggtcacggccgctgtc-5’ functionalized
  2. 2. Sample A2: 3’-atcgttggggtgaccgagcc-5’ functonalized
  3. 3. Sample A3: 3’-tgccggtcacggccgctgtc-5’ functonalized
  4. 4. Sample A4: 3’-atcgttggggtgaccgagcc-5’ functonalized

    To functionalize our gold nanoparticles, first the oligonucleotide probes were prepared with PBS buffer (pH 8) and purified water. In order to functionalize them to our GNPs we needed to determine which samples had the DNA present in them; therefore, we used a nanodrop UV-Vis machine to detect the DNA absorbance at 260nm. The results were obtained as followed for all of our samples:

    Some samples did not contain DNA while others contained it, so we employed those with the DNA further in the experiment.

    In the next steps, phosphate adjustment buffer (final 9mM), surfactant solution (final ~0.1% (wt/v)) and salting buffer (final 0.3M NaCl) were added with the DNA and gold nanoparticles. The salting buffer was added six times over the course of two days. Our gold nanoparticles did not have any visible aggregates except for one sample, meaning that they have been properly functionalized.

    Currently we are continuing the next phase to hybradize our functionalized gold nanoparticles with our target gene and observe a color change from red to purple. We shall present these results in time for the Giant Jamboree.

FUTURE PLANS        

    Our DNAzyme needs to be checked against another substrate sequence, to confirm that exact sequence specificity is required for cleavage activity. Moreover, our gold nanoparticles should be further hybridized with our target gene to induce a color change from red to purple.

CONSIDERATIONS FOR REPLICATING THE EXPERIMENTS        

    In conducting the DNAzyme cleavage assay, it is important that all DNA samples are kept on ice while performing the experiments. Otherwise, it would cause DNA degradation, leading to inexact results. In addition, the denaturing step in urea PAGE should be done under a sufficient time. Since DNAzyme and target gene DNA are single stranded, there is a higher possibility of forming secondary structure on its own.

YONSEI_KOREA 2021

Yonsei_Korea is a convergent team of students based in Seoul, South Korea striving to create meaningful change utilizing synthtic biology in the IGEM 2021 Competition.