Team:Yonsei Korea/Parts

IGEM_YONSEI

In the Laboratory:

The Science
Behind It All

PARTS
PART        
  1. ● Basic part 1: DNAzyme
  2. ● Basic part 2: a region of mif23 gene
DESCRIPTION         
  1. ● Basic part 1: DNAzyme
    1. ○ DNAzyme specifically cleaves the target mif23 gene found in Magnaporthe oryzae. Specifically, it recognizes the YTGC (Y=T/C) region of the gene and cleaves at T residue, producing several cleaved products. This 100 base pairs long DNAzyme consists of 3 subregions: a left binding arm, a catalytic loop region, and a right binding arm. Two binding arms assist DNAzyme to hybridize with the target sequence to carry out the loop catalyzed cleavage mechanism.
  2. ● Basic part 2: a region of mif23 gene
    1. ○ mif23 gene is found in Magnaporthe oryzae and it is an infection structure specific protein.
USAGE         

    DNAzyme catalyzes the specific cleavage of its target substrate through base-pair pairing.

USAGE IN OUR IMPLEMENTATION        

    Our project uses basic part 1 to specifically bind to and cleave basic part 2. Cleavage reaction releases several truncated products, which can be employed in the visual readout based on gold nanoparticles.

TABLE         
Selected part name Part type Function Sequence
BBa_K4105001 Basic - Other DNAzyme tgccggtcacggccgctgtcgagatcgttggggtgaccgagccgcctgggccgtaggtggaggcagtggtttaggcccagtcctggcgccctctgtttga
BBa_K4105002 Basic - Other mif23
gene
fragment		 acggccagtgccggcgacagctctagcaaccccactggctcggctgcctccgtcaccaaatccgggtcaggaccgcgggagacaaact
YONSEI_KOREA 2021

Yonsei_Korea is a convergent team of students based in Seoul, South Korea striving to create meaningful change utilizing synthtic biology in the iGEM 2021 Competition.