Difference between revisions of "Team:Yonsei Korea/Proof Of Concept"

Our detection system consists of the following two main reactions:

    The core of our research is the DNA cleaving deoxyribozymes. Our deoxyribozyme or DNAzyme cleaves the target sequence at a specific recognition site consisting of YTGC (Y=T/C) base pairs. To carry out this cleavage, the DNAzyme requires the presence of metal ions Cu2+ as well as Mn2+. Without these ions, especially Cu2+, the DNAzyme cannot catalyze the cleavage reaction. Besides metal ions, the DNAzyme has to possess sequences that are complementary to the target substrate. Complementary sequences will hybridize and the DNAzyme will be able to cleave at the specific sites given the right working conditions, producing cleaved target DNA parts. These cleaved products are the starting component for the following nanoparticle-based reactions.

    Our system would further integrate gold nanoparticles (GNPs) and exploit their aggregation/dispersion properties to detect the presence of the cleaved target DNA parts. By functionalizing the complementary DNA strands of our cleaved target sequence onto GNPs, we can employ this system as a colorimetric readout to determine the presence of a target sequence in the solution. As for a detection system in itself, it would contain all the functionalized GNPs, DNAzymes and initial target gene in one system where the DNAzyme catalytic activity would first take place and consequently, its cleaved products would be detected by the GNPs, confirming the successful cleavage activity.

    WE employ DNAzymes in our research due to their many advantages. DNAzymes have the benefit of improved thermal stability and constructibility. Moreover, the main key to them is that they are highly selective to specifically cleave oligonucleotide substrates in the presence of specific metal ions. In order to successfully perform the DNAzyme cleavage assay for the target DNA detection, the following is needed:
- DNAzyme: specifically designed to target the gene (substrate)
- Gene (substrate): the target gene sequence of interest
- Reaction buffer with Cu2+ ions (ingredients are found in the Experiment section.)

    This reaction can take place in a 1.5 mL microcentrifuge tube, by mixing all of the required reagents together. After mixing, the solution needs to be heated at 90°C to ensure proper hybridization between the DNAzyme and gene (substrate). Here, the left and right binding arm of the DNAzyme hybridizes with the target DNA sequence (see Working Mechanism diagrams below). Exact hybridization is needed for the DNAzyme’s loop structure to cleave the target DNA at the desired YTGC (Y=T/C) sequence. This is followed by cooling at room temperature for 10-15 minutes and incubated at 37°C overnight for the cleavage reaction to take place.

One aspect we also considered while designing this project and its real-life use on farms was how much genetic material from rice leaves would be needed or how it would be extracted from rice crops on a farm without the use of complex methods or equipment. However, we noted this as a step to be considered in the future development of our concept, and not in our current scope of research.

    For this following step, we chose to exploit the aggregation/dispersion properties of gold nanoparticles as a visual detection system for our target gene sequence. Gold nanoparticles are advantageous as they are non-toxic, cheap, and can be easily functionalized. They are also sensitive to the distance between each particle, so by functionalizing certain components of specific lengths onto them, we can obtain visible color changes based on the presence of a target sequence due to their shifting wavelength absorbance accordingly. Here we also needed to consider the sensitivity and stability of the particles. A maximum modification or functionalization is needed to reduce the nonspecific binding and they should then be stable in ambient conditions.

    To have a further lead, we also needed to consider the environmental conditions at which these reactions with the nanoparticles take place. Ideally, for the hybridization reaction which is the main part of our gold nanoparticles coming into contact with our target cleaved product, room temperature is the most ideal as farmers won’t possess any special tools or devices to incubate at specific temperatures. When designing a detection system or a point of care device as we are, we also greatly considered the ease of use of this technology. For example, the simplest method would be to mix all components together in one solution and observe a color change through the naked eye. We mention the specifics of this in the following section on Working Mechanism.

    In general, we designed a simple concept to add DNA sequences in a solution containing the functionalized gold nanoparticles: if it is the target cleaved product, the solution will change color from red to purple which means the particles have aggregated according to their specificity to our target gene sequence.

    In our current research scope, we are only employing these gold nanoparticles as a visualization tool to confirm the detection of a cleaved product. However in principle, we would combine this with the initial DNAzyme cleavage activity into one whole system and not separately as we are doing now. Due to time constraints and challenges faced throughout our project, this is noted for the further development of our project for the future. At the moment, we are only using the nanoparticles as another visual readout for our cleaved products.

The DNAzyme cleaves the target DNA through the following mechanism:

    Essentially, we have our target gene and DNAzyme sequences as follows where ctgc is the specific recognition site:
Gene A
5’-acggccagtgccggcgacagctctagcaaccccactggctcggctgcctccgtcaccaaatccgggtcaggaccgcgggagacaaact-3’

DNAzyme A
3’-tgccggtcacggccgctgtcgagatcgttggggtgaccgagccgcctgggccgtaggtggaggcagtggtttaggcccagtcctggcgccctctgtttga-5’

This cleavage reaction will then yield the following three cleaved products:
Cleaved Products
        1. 5’-acggccagtgccggcgacagctctagcaaccccactggctcgg-3’
        2. ctgc
        3. 5’-ctccgtcaccaaatccgggtcaggaccgcgggagacaaact-3’

    To detect the cleaved products with gold nanoparticles, we use one of the cleaved products as our target gene (TG) and functionalize the 20 base pairs complementary to TG starting from the 5’ end and the 3’ end onto two different sets of gold nanoparticles, respectively. For the oligonucleotide probe design: we selected 20 base pairs for the DNA sequences that are functionalized onto our gold nanoparticles, which is ideal to notice the aggregation shift from dispersed particles and thus observe a color change from red to purple. We then obtain the following:
Target Gene
        1. TG: 5’-acggccagtgccggcgacagctctagcaaccccactggctcgg-3’

Thiolated Sequences (complementary to target gene)
        1. TS1: 3’-tgccggtcacggccgctgtc-5’
        2. TS2: 3’-atcgttggggtgaccgagcc-5’

Generally, the next phase of the working mechanism for our concept goes as follows:
        1. DNA functionalized gold nanoparticles in solution (GNP-TS1 and GNP-TS2)
        2. Add the target gene (TG) in solution
        3. Incubate at room temperature while shaking
        4. Observe color change from red to purple

    The complementary 20 base pair sequences TS1 and TS2 were functionalized on gold nanoparticles (30 nm) separately using the salt-aging method. They were then mixed together and kept as one solution, showing a red color (dispersion of nanoparticles). In order to detect our target cleaved product TG, we then add it to the gold nanoparticles and incubate at room temperature. If the hybridization reaction is successful, then TG will align with its complementary parts which are functionalized on GNP-TS1 and GNP-TS2 causing this cross-linked aggregate structure of the nanoparticles and target gene. As a result, we observe a color change from red to purple by the naked eye.

Zoomed in we have:

    Although this current scheme is used solely to detect the presence of one cleaved product from the DNAzyme catalytic activity, in essence for this to work as a whole detection system, we would need to combine both the cleavage reactions and hybridization reactions into one. This means, further developing this concept into one system that integrates all three: DNAzymes, initial target gene and functionalized gold nanoparticles. At the moment, we only combine the functionalized gold nanoparticles and cleaved product in one system while we separately carry out the DNAzyme cleavage activity to our target gene in another. The goal is to combine these two systems or reactions into one fully functioning system for detection as such:

    When designing the concept of our system we aimed to make it simple to use, cheap and effective. For the DNAzyme cleavage assay, no specific enzyme is needed for the reaction so it reduces the complexity of the experiment. For example, the experiment conditions are less strict compared to many other biology experiments. In addition, amplification of DNA is not required as well unlike many PCR-based detection technologies. The specificity of the DNAzyme cleavage activity is solely dependent on the DNA sequence itself; therefore, it is very simple to design: the target gene sequence is the only required information in designing the DNAzyme. Lastly, no expensive or high-technology-based instrumentation is needed to observe the color change of the nanoparticles based on their aggregation, implying relatively low cost. Many people, regardless of their background knowledge or laboratory experience, will be eligible to use this tool when fully developed into a functioning product/detection tool. The simplicity and manageability of the DNAzyme cleavage assay are what make our system strong and appealing, and it has high potential to be used in any part of the world.