Difference between revisions of "Team:Yonsei Korea/Engineering"

OVERVIEW        

    To develop a diagnosis tool in detecting the Magnaporthe oryzae fungi, we incorporated engineering along with synthetic biology into our research. Our goal was to develop a proof of concept for a detection system, which is simple but specific. Also, we aimed to design a tool that is easy to use and visualize, so that many people will be able to use it. Therefore, it was essential for us to incorporate the engineering design cycle: research → imagine (brainstorming) → design → test → learn & improve. We have optimized this in a way that is suitable and practical for our research.

    We divided our research into two phases, and went through several iterations of the engineering design cycle for each phase. Phase 1 aimed to apply synthetic biology to develop a system that could specifically detect the Magnaporthe oryzae gene. Phase 2 aimed to apply nanoscience and technology to develop a colorimetry tool to visualize the specific detection, which is important for practical purposes.

Through our stages of the engineering design cycle, we have achieved the following:

PHASE ONE        

1. Research
    After acknowledging that Magnaporthe oryzae and rice blast disease are severe issues in rice plantations, we started research on the current diagnosis and treatment methods of the rice blast disease. We found that current detection systems rely on Artificial Intelligence (AI) technologies (Chen, Ling, et al.) or PCR-based methods. Although these methods demonstrate rapid detection, we have found out that they are skill extensive or show late diagnosis. In addition, they are expensive, so farmers are not able to utilize current technologies. Current treatment methods have many potential problems as well, as farmers rely heavily on chemical fungicides (Magar, Acharya, et al.). Chemical fungicides are sprayed extensively at each stage of rice growth, causing pollution and posing a risk in the ecosystem, as they are highly toxic.

    To develop a nucleic acid-based diagnosis tool, we researched more on PCR-based detection systems, to get an idea about which genes can be used as a target for our detection system. The following is what we found as potential targets for detection:

2. Imagine (brainstorming)
    Based on the research, we started brainstorming the factors that should be considered in designing our diagnosis tool. First, it should be simple and easy to use. We thought that current technologies such as PCR are not practical for farmers to use, so we tried to incorporate DNAzymes into our research. Second, specific detection should take place. To do this, our system should target genes that are specific to M. oryzae. Third, it should be visualized with the naked-eye: it would not be practical to use expensive and complicated softwares or machines, nor need specific environmental conditions. We drafted ideas regarding colorimetry analysis, such as incorporating fluorescence or nanoparticles to show color change. Lastly, it should be affordable. To accomplish this, we thought of ideas that use the least amount of materials and equipment possible. This would not only reduce the price, but would also enhance the simplicity of the detection system.

Through this stage of brainstorming, we established the goal for the design phase: using DNAzymes that can specifically detect a unique gene of M. oryzae, and observing this activity with gold nanoparticles (colorimetry analysis). We incorporated DNAzymes into our idea, mainly because it would enhance the simplicity of our detection system, but not decrease specificity at the same time. Unlike many PCR-based detection methods, DNAzymes do not require DNA amplification and do not use specific enzymes. Therefore, complex buffer conditions and skills to use advanced instrumentations are not required. At the same time, it has high specificity, since it only exercises cleavage activity when the left and right binding arms of DNAzyme are properly bound to the target DNA. As we are aiming to develop a proof of concept that is simple and easy to use for farmers, we thought that DNAzymes would be a great idea in this context.

3. Design
    We incorporated the F-8 DNAzyme into our research to detect the unique gene of M. oryzae. Based on our research, we selected the mif23 gene as the target.

As the F-8 DNAzyme specifically catalyzes the cleavage at the thymidine of YTGC (Y=T/C) sequence, we found potential regions of the mif23 gene (Genbank ID: GI 4732021) where the F-8 DNAzyme could bind and cleave it. Based on this, we designed 4 possible DNAzymes.

    For example, our DNAzyme A would cleave the target Gene A based on the following mechanism:

Gene A
5’-acggccagtgccggcgacagctctagcaaccccactggctcggctgcctccgtcaccaaatccgggtcaggaccgcgggagacaaact-3’

DNAzyme A
3’-tgccggtcacggccgctgtcgagatcgttggggtgaccgagccgcctgggccgtaggtggaggcagtggtttaggcccagtcctggcgccctctgtttga-5’

    In addition, in order for the DNAzymeA to be activated, important ions such as Cu2+ is essential. Therefore, with the addition of Cu2+, the target Gene A will be cleaved as below:

Gene A
5’-acggccagtgccggcgacagctctagcaaccccactggctcgg
ctgc
ctccgtcaccaaatccgggtcaggaccgcgggagacaaact-3’

DNAzyme A
3’-tgccggtcacggccgctgtcgagatcgttggggtgaccgagcc
gcctgggccgtaggtggaggcagtggtttaggcccagtcctggcgccctctgtttga-5’

    In designing our experiment, we added 3 controls. Therefore, 4 different types of conditions were tested in one experiment.

4. Test
    The synthetic DNA was ordered from BIONICS, a biotechnology company based in Korea.

    We designed the cleavage assay experiments based on the protocol provided by Wang, Zhang, et al. The difference between 3 and 4 is whether the reaction buffer was added. Therefore, in 3, the DNAzyme-substrate is expected to hybridize with each other, but it will not be cleaved. In contrast in 4, cleavage activity is expected to be shown as the reaction buffer is added.

    To ensure proper and specific hybridization between the DNAzyme and the substrate gene, the DNAzyme-substrate mixture was heated at 90°C for 5 minutes and cooled at 25°C (room temperature) for 10-15 minutes. The cleavage assay was then tested for DNAzyme-substrate A and B. Thereafter, the samples were incubated at 37°C for 16 hours for the cleavage reaction to occur. Finally, EDTA was added to stop the cleavage reaction.

    To visualize the results, agarose gel electrophoresis was performed. We optimized the agarose gel electrophoresis by trying at different agarose concentrations (1%, 1.2%, 2%), different gel running times (30 minutes, 10 minutes, every 10 minutes for 30 minutes), and different voltages (100V, 135V, 200V). To ensure that the DNA were properly stained by SYBR Green, we viewed it under the UV light as well. In addition, Nanodrop was done to ensure the DNA concentration and purity.

5. Learn & Improve
    From the agarose gel electrophoresis results, we were able to check that the hybridization between the DNAzyme and gene substrate occurs, by comparing sample 1 and 2 with sample 3: compared to the bands for samples 1 and 2 (which only contain either DNAzyme or substrate), the bands for sample 3 was thicker, which suggests that hybridization occurred. It seemed that the cleavage activity occurred when looking at sample 4, because the intensity of the band is weaker, compared to sample 3.

    However, the main problem was that the band for sample 2 were not appearing for all cases: both gene A and gene B were not appearing as a single band. DNA was properly stained when it was viewed under the UV light, so we assumed that other experiment methods other than agarose gel electrophoresis should be used to view the results. Also, although the intensity of the band at 4 decreased, we were not seeing expected bands which represent the cleaved products. We were expecting to see bands around 40 bp, but we were not able to visualize them.

Another concern was that the DNA purity was not good, as the Nanodrop results show. For instance, the 260/280 ratio of sample 1 - 4 from DNAzyme-substrate B were all above 1.8, which indicates that DNA in all of the samples are not pure (low purity). This suggests that the quality of the DNA might be low, which might interfere with the DNAzyme cleavage activity, as F-8 DNAzyme cleavage is highly dependent on the exact sequence: at the thymidine of YTGC (Y=T/C) sequence.

    For improving our research for the 2nd cycle, we need to consider the following:

1. Research
    In the 2nd cycle, we aimed to improve the visualization of the bands. Therefore, we researched other experiment methods other than agarose gel electrophoresis. We have found that native PAGE and denaturing PAGE were also used frequently. Agarose gels are used for large fragments of DNA, whereas polyacrylamide gels are better to use for shorter lengths of DNA. The difference between native and denaturing PAGE was that denaturing PAGE uses urea, so that double-stranded DNA will be separated into single-stranded DNA.

2. Imagine (brainstorming)
    Since our target gene is 88bp and DNAzyme is 100bp in length, we thought that PAGE would be a more suitable method for our experiment. Also, the cleaved gene products are about 40bp in length, so agarose gel electrophoresis would not be the best in visualizing. In addition to brainstorming about experiment methods, we have found the need to add more controls to optimize the experiment process and see how each procedure in the experiment affects the cleavage reaction.

3. Design
    In the 2nd cycle, we added two additional controls: how EDTA and heat incubation at 90°C affects the cleavage reaction.

4. Test
    The synthetic DNA was ordered from BIONICS.

    We designed the cleavage assay experiments based on the protocol provided by Wang, Zhang, et al. The experiment procedure is the same as in the 1st cycle.

    To visualize the results, native PAGE was performed. 12% PAGE was prepared, and the gel was run at 900V for 60 minutes.

5. Learn & Improve

    While using PAGE, sample 2 was visible, which was not possible to observe while performing agarose gel electrophoresis. In addition, we were able to check that the hybridization between the DNAzyme and gene substrate occurs, by comparing sample 1 and 2 with sample 3. In sample 3, there are two bands: the upper band represents the hybridized DNAzyme-substrate complex and the lower band represents the DNAzyme that is not hybridizing with the gene. This should happen because we inserted 10 times more concentration of DNAzyme compared to the concentration of the gene substrate. However, it was still hard to clearly see the cleavage activity. Comparing samples 3 and 4, it is hard to see the difference in the bands, although it seems like the intensity of the lower band is slightly weaker in sample 4, compared to sample 3. In addition, the PAGE results of sample 4 ~ 6 are similar: it is hard to visualize the difference between them.

    For improving our research for the 3rd cycle, we need to consider the following:

1. Imagine (brainstorming) & Design
    Based on the DNAzyme and gene substrate sequences that were provided in the reference paper of F-8 DNAzyme (Wang, Zhang, et al.), we added additional sequences to the left and right arms of the sequence in the paper, to increase the length of synthetic DNA. We designed it so that each single stranded DNA will not self-hybridize, and that it would hybridize with each other instead. We have used a program to ensure that the DNAzyme_Paper and Gene_Paper strands would hybridize to each other well. The following shows the DNAzyme_Paper and the corresponding Gene_Paper sequence. The highlighted sequence in yellow are the base pairs that were added by us additionally (the black letters are the original sequences that were provided by the reference paper).

    In addition, we recognized the need to see how the cleavage activity changes as the concentration of the reaction buffer changes. We have found that the Cu2+ ions are especially important in catalyzing the DNAzyme activity. In this context, we hypothesized that increasing the concentration of the reaction buffer (thus, increasing the concentration of Cu2+ ions) would enhance the cleavage activity, which would lead to more of the gene substrate to be cleaved. If this tendency is shown in PAGE results, this would ensure that the cleavage activity is actually exercised by the DNAzymes.

2. Test
The synthetic DNA was ordered from IDT.

We designed the cleavage assay experiments based on the protocol provided by Wang, Zhang, et al. The experiment procedure is the same as in the 1st and 2nd cycle. The controls are the same as in the 1st cycle.

    One difference from the cleavage assay in the 1st cycle is that we tried at different concentrations of the reaction buffer. The standard concentration is 2x reaction buffer (Wang, Zhang, et al.), but we also tested at 1x, 3x, 4x, and 5x.
    To visualize the results, native PAGE was performed under 90V. To optimize the conditions of PAGE, it was performed at different polyacrylamide gel concentrations (12% and 15%) and at different gel running times (90 minutes and 120 minutes).

    3 rounds of experiments were performed with the DNAzyme-substrate Paper sequences to show that the experiment produced consistent results.

3. Learn & Improve

    All 3 rounds of experiments showed consistent results: the band patterns were the same, regardless of the reaction buffer concentrations (1x/2x/3x/4x/5x) and the polyacrylamide gel concentrations (12% or 15%). In addition, it was possible to observe the decrease in the band intensity in sample 4, as the concentration of the reaction buffer increased. This ensures not only that Cu2+ ions are important in F-8 DNAzyme activity, but also ensures that the DNAzyme cleavage activity is working.

    Sample 3 bands show that hybridization between the DNAzyme and gene substrate occurs, since the bands are appearing near the top. Also, there is a shift in the sample 4 bands, when it is compared with sample 3. As the gene substrate is cleaved, the shape of the DNAzyme-substrate complex will change, leading to the shift in the bands.

    Overall, we learned that cleavage activity is working with the sequences from the reference paper (Wang, Zhang, et al.), meaning that the cleavage reaction with the F-8 DNAzymes and our current experiment methods are actually working. This suggests that the quality of the DNA might have been interfering with the cleavage assay. For our next experiments, we decided to perform the same experiment with the DNAzyme-substrate A sequences, but with the synthetic DNA that were synthesized by IDT.

4. Design & Test
    The synthetic DNA was ordered from IDT. Also, the same experiment conditions and procedures with the DNAzyme-substrate Paper were used. To visualize the results, native PAGE (12% and 15%) was performed under 90V for 120 minutes.

5. Learn & Improve
    Regardless of the reaction buffer concentrations (1x/2x/5x) and the polyacrylamide gel concentrations (12% or 15%), the band patterns were the same. In other words, consistent results were obtained. In addition, it was possible to observe the decrease in the band intensity in sample 4, as the concentration of the reaction buffer increased. The cleavage reaction for sample 4 was possible compared to sample 3, because the reaction buffer contained Cu2+ and Mn2+, which are the most important ions. Without them, DNAzyme cannot catalyze the cleavage of its substrate, as seen in sample 3.

    Sample 3 bands show that the hybridization between the DNAzyme and gene substrate occurs, since one additional band is appearing near the top: (a). In sample 4 bands, there is a decrease in band intensity at the (a) position. In addition, there is another band appearing slightly below: (b).

    The following is a diagram of structures at band (a) and (b):

    For improving our research for the 4th cycle, we need to consider the following:

1. Research & Imagine (brainstorming)
    In the 4th cycle, we aimed to confirm that our detection system was efficient and what determines the cleavage activity of the DNAzyme. According to Wang, Zhang, et al., Cu2+ seemed critical in the DNAzyme activity, although they have mentioned Mn2+ as well. Up to the 3rd cycle, we have proved that our DNAzyme works under the reaction buffer, but we have not tested which ions are most significant in catalytic activity. Therefore, we planned to test the DNAzyme cleavage activity in the absence of Cu2+ ions.

    Second, we wanted to confirm that our system is an effective system: the cleavage activity of DNAzyme should be proportional to the amount of gene (substrate) present. Therefore, we planned to see how the DNAzyme cleavage activity varies as the concentration of the gene (substrate) changes.

    Lastly, we decided to use denaturing PAGE (urea PAGE) this time, in order to separate molecules based solely on the molecular weight, as urea unfolds possible secondary structures and destroys hybridization between strands.

2. Design
    Based on the research & imagine (brainstorming) stage, we have decided to make a 2x reaction buffer without Cu2+ ions. The composition of other ingredients and ions are the same, so it will be possible to see whether or not Cu2+ is essential for cleavage activity. In addition, we made different concentrations of gene (substrate), while keeping the concentration of DNAzyme constant. We designed our experiment to test at 4 different ratios - DNAzyme : Gene (substrate) = 1 : 0.1, 1 : 0.25, 1 : 0.5, 1: 1. Since 10µM DNAzyme is used, the concentration of the substrate would be: 1µM, 2.5µM, 5µM, and 10µM.

3. Test
    The synthetic DNA was ordered from IDT. The experiment procedure is the same as in 1st, 2nd, and 3rd cycle, but with different reaction conditions and controls.

    To visualize the results, denaturing (urea) PAGE was performed. 8% urea PAGE gel was made, and it was run at 200V for 40 minutes.

4. Learn & Improve

    Samples A-4 to A-7 had all the needed reagents. In contrast, the A-3 contained all the required reagents except for Cu2+ ions. We confirmed that DNAzyme must have the Cu2+ ions to cleave the substrate because we did not detect the middle band in Lane 5, which were observed in remaining lanes.

    Samples A-4 to A-7 had an increasing concentration of the target substrate, while that of DNAzyme remained unchanged at 10 uM. The 1:1 ratio between DNAzyme and substrate (10uM : 10uM) was the most effective reaction since we observed a shrunken band size of DNAzyme compared to other samples. This indicated that DNAzyme cleaved the available substrate fully, leaving only unreacted DNAzymes.

    For further analysis, we used Fiji, an open source image analysis software, to quantify the band intensity. Here, the PAGE results from the 3rd cycle were analyzed as well. The band intensity was measured to quantify the amount of DNA present in each band. In case of PAGE results, the picture was adjusted to an 8-bit image because the original background was blue. Then, the quantification process was conducted as:

    After the net band intensity was calculated, we analyzed based on the results. A detailed description of these results can be found in the Results section.

    Through this, we were able to conclude the following:

    Based on synthetic biology, we were able to prove that the DNAzyme designed based on the target gene sequence was successful in specifically detecting the target DNA by cleaving the DNA. This cleavage activity is efficient under the presence of Cu2+ ions, and is proportional to the amount of target DNA present. We were able to achieve this based on simplicity, which makes our system highly advantageous. Without using any specific enzyme, expensive purification, instrumentation, and advanced technology, detection was possible based on solely synthetic DNA.

PHASE TWO        

1. Research
    After making the decision to include a nano component in our research, we began to heavily research different detection mechanisms or visual readouts that aligned with our initial concept design. From this we made a list of two main components including ease of use or simplicity and clear visual color change that is noticeable with the naked eye. Out of our options, gold nanoparticles were the most promising step as they possess many benefits and advantages such as being non-toxic, cheap and can be easily functionalized.

    Gold nanoparticles are also sensitive to the distance between each of their particles, so if something triggers their aggregation, then their surface plasmon resonance will become coupled and shift their absorbance. Gold nanoparticles that are dispersed show a red color while aggregated particles show a purple or blue color (Zagorovsky, Chan, et al).

    We read many research papers and review articles on gold nanoparticles and how they can be used as a colorimetric detection tool for specific DNA sequences or for pathogens. After reviewing many different papers with our nano team, we were able to finalize a narrow focus and method to functionalize specific DNA sequences onto gold nanoparticles which could be used to detect the complementary sequences and aggregate to form a color change.

2. Imagine (brainstorming)
    Once we narrowed down our focus, we continued to read and review more papers on specific methods and procedures to functionalize DNA sequences onto gold nanoparticles as well as think about how our overall detection system will work. In essence, we wanted to make it very simple to the point where it was adding A to B and seeing a color change with the naked eye. This was to cover our key point which was simplicity. Moreover, with simplicity comes a lower cost in most cases, so we wanted to also develop something that would be cheap and easily accessible to people.

    Therefore, through brainstorming with our nano team, we established the concept to our mechanism or detection system: we wanted to attach specific DNA sequences to the nanoparticles which are complementary to our target gene that we can obtain from Magnaporthe oryzae. After this, we would add the actual target gene into the gold nanoparticle solution in order for it to hybridize or complement back that which was functionalized on the nanoparticles and change the aggregation/dispersion properties of them, thus causing a color change. Nevertheless, here came one challenge which was to specify exactly when and how the nanoparticles would aggregate, making sure they are specific to our target gene as well as stable in solution. We were able to find one protocol as well as a design concept that matched exactly what we were aiming for which will be covered next in the Design section.

3. Design
    We chose to functionalize the 20 base pairs from the 3’ and 5’ end of our target gene on two pools of gold nanoparticle sets, respectively. With this, we aim to create a square-like aggregate structure when these functionalized gold nanoparticles come in contact with our target gene. In order for them to aggregate, there must be a space between each DNA strand functionalized on the nanoparticles once hybridized with the complementary target gene. This ensures that they will bind specifically to our target gene. For example, if our target gene is 3’-AAAABBAAABBAAAA-5’, then we functionalize 5’-BBBBA-3’ on the first set of nanoparticles and 5’-ABBBB-3’ on the set of second nanoparticles. What will be the space or blank here between the strands is the middle part of the target gene. Nevertheless, when the target gene is added to this solution containing both these functionalized gold nanoparticles, it will hybridize accordingly, forming a cross-linked, square-like aggregate structure, turning the solution purple as the particles are not freely dispersed anymore.