Team:MEPhI/Engineering
Engineering Success
Means of delivery (biocompatible silicon nanoparticles)
One of the questions we asked was “How will our small interfering RNAs (siRNA) and genetic constructs be delivered to the patient's body?". Studying the scientific literature, we were looking for a delivery system with specific properties, such as biodegradability, low toxicity, affordability, high load capacity. Also, our delivery system must be reliable in manufacturing. We came to the conclusion that some types of nanoparticles meet these criteria well. We studied many types of nanoparticles (NPS) and chose silicon nanoparticles (SiNPs) as the carrier of genetic constructs and RNA.
SiNPs are one of the new directions in the field of delivery of therapeutic drugs based on nucleic acids. In addition, SiNPs have a number of valuable unique properties, such as a high level of biocompatibility and biodegradability. SiNPs decompose in the human body to form silicic acid, which is relatively harmless to the human body and can be easily excreted through the kidneys. In addition, the process of SiNPs manufacturing is relatively simple and there are several technologies described in the literature for obtaining this type of nanoparticles. In our experiments, we tested nanoparticles produced by electrochemical etching and laser ablation. According to our data, SiNPs obtained electrochemically have too loose a surface and are not suitable for stable surface functionalization by amino groups. SiNPs obtained by laser ablation had a stronger surface structure and proved to be more convenient for use in our experiments.
We decided to test several ways to modify the surface of nanoparticles to obtain positively charged amino groups capable of interacting with nucleic acids. Four different surface modifications were selected for the study. The first modification involved pre-boiling SiNPs in H2O2 for two hours to form OH groups on the surface. Then the surface was modified with 2-aminoethyl-3-aminopropyltrimethoxysilane (AE-APTMS). In the second approach, we did not use H2O2 at the first stage but immediately processed SiNPs using AE-APTMS. The third modification was also performed using AE-APTMS, but the SiNPs in the initial suspension was previously oxidized with 15% H2O2. In the fourth series of experiments, we used quaternary ammonium salts to coat SiNPs.
In the main series of experiments, we tested the ability of nanoparticles to bind to siRNA and studied the rate of desorption of siRNA from the surface of nanoparticles. According to our results, the third approach to the modification of SiNPs allows loading the maximum amount of siRNA onto nanoparticles' surfaces. The data obtained are shown in the figures below.
Figure 1: Maximal loading capacity for SiNPs with different surface modifications:
- Pre-boiled in H2O2 nanoparticles with AE-APTMS;
- Immediately modified with AE-APTMS without H2O2;
- Prooxidized and modified with AE-APTMS;
- Quaternary ammonium salts coating.
The SiNPs obtained in hydrogen peroxide solution demonstrate almost twofold loading capacity compared to those ablated in deionized water.
As a result, we can use Silicon nanoparticles as a delivery system for our material. It is not the only way to deliver our genetic constructions and RNA to the human body, but the fact that we can use different approaches to get our engineered microbiota broadens the usage area of our development. And the best method of delivery can be picked up for every case.
Selection of RNA and proteins capable of performing a radioprotective function.
To solve this problem, we analyzed databases containing information about the transcriptome of people living in regions with high natural levels of radiation exposure (with a dose load per person of more than 15 mGr per year). And also analyzed the available scientific literature on this topic (for example, https://doi.org/10.1038/s41598-020-80405-y ).
To achieve maximum effect, we decided to use three types of targets (inserts) in our genetic constructs:
Proteins that showed a significant (more than 7 times) increase in the level of expression in a cohort of people from regions with a high natural background of ionizing radiation
Micro RNA (miRNA) to suppress the activity of those genes that showed a significant decrease in activity in a cohort of people from regions with a high natural background of ionizing radiation
Proteins are homologous to the radioprotective proteins of the tardigrade. The search for the corresponding proteins was carried out using the protein BLAST program on the UNIPROT website (https://www.uniprot.org/blast /)
For each type of insert, we decided to choose the three most promising sequences and test them as part of a plasmid vector. Thus, 9 targets were selected for testing.
Although there is evidence that small interfering RNAs are directly involved in the regulation of the radioprotective properties of the mammalian organism (Int J Mol Sci. 2021 Mar; 22(5):2396. doi:10.3390/ijms22052396), we decided to abandon the use of this type of target, because according to the literature there is a high probability of influencing other characteristics of the organism with many negative side effects.
Genetic vector
We designed two variations of our system: for lacrobacteria that would be used for temporal exposures to radiation and for E.Coli, designed for long-lasting radiation exposures.
Lactobacteria doesn’t integrate into the biofilm and will be secreted. In this case, we would not need an inducible promoter due to the activity time of Lacto- and bifidobacteria in the human intestine which takes several hours and is comparable to the activation time of the inducible promoter.
E Coli is integrated into the biofilm, so we regulate the expression of proteins using the arabinose-inducible promoter pBAD
Vectors for E.Coli:
Ori pBR322 - The origin (ori) is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells.
Par101 - Partition (par) locus from the pSC101 plasmid is required for stable maintenance of the plasmid in a bacterial cell population.
It is a binding site for DNA gyrase. The stabilization of plasmid inheritance is mediated by the ability of par to generate negative supercoils in plasmid DNA. This element is essential for correct segregation, in lack of par a half of cells lose the plasmid.
KanR - Kanamycin resistance gene. It allows to easily detect plasmid-containing bacteria when the cells are grown on selective media and provides those bacteria with a pressure to keep the plasmid.
T7 promoter - Promoter from T7 bacteriophage. It is responsible for initiating the transcription of the insert gene into RNA.
T7 RBS - Ribosome binding site from T7 bacteriophage. It is responsible for the recruitment of a ribosome during the initiation of translation.
Wnt10a - Wnt proteins constitute a large family of secreted glycoproteins that control diverse aspects of embryonic development and adult homeostasis
They have an influence on the balance between proliferation and differentiation in many cell types, they are implicated in biological processes like bone formation, immune regulation, cancer, and stem cell renewal.
Many studies have linked activation of Wnt/β-catenin signaling pathway to radioprotection, especially of the salivary gland, oral mucosa, and gastrointestinal epithelium through inhibition of apoptosis and preservation of normal tissue functions. Wnt10a has been reported as one of the most overexpressed proteins in inhabitants of high background-radiation areas.
T7 Terminator - Terminator from T7 bacteriophage. It is necessary to stop the transcription of the insert gene.
Ori pBR322 - The origin (ori) is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells.
Par101 - Partition (par) locus from the pSC101 plasmid is required for stable maintenance of the plasmid in a bacterial cell population.
It is a binding site for DNA gyrase. The stabilization of plasmid inheritance is mediated by the ability of par to generate negative supercoils in plasmid DNA. This element is essential for correct segregation, in lack of par a half of cells lose the plasmid.
KanR - Kanamycin resistance gene. It allows to easily detect plasmid-containing bacteria when the cells are grown on selective media and provides those bacteria with a pressure to keep the plasmid.
pBAD – pBAD is an inducible promoter that allows the insert gene expression according to the available arabinose concentration.
T7 RBS – Ribosome binding site from T7 bacteriophage. It is responsible for the recruitment of a ribosome during the initiation of translation.
BLM – Ribosome binding site from T7 bacteriophage. It is responsible for the recruitment of a ribosome during the initiation of translation.
T7 Terminator – Terminator from T7 bacteriophage. It is necessary to stop the transcription of the insert gene.
Vectors for Lactobacteria:
Ori pBR322 – The origin (ori) is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells.
Par101 - Partition (par) locus from the pSC101 plasmid is required for stable maintenance of the plasmid in a bacterial cell population.
It is a binding site for DNA gyrase. The stabilization of plasmid inheritance is mediated by the ability of par to generate negative supercoils in plasmid DNA. This element is essential for correct segregation, in lack of par a half of cells lose the plasmid.
KanR – Kanamycin resistance gene. It allows to easily detect plasmid-containing bacteria when the cells are grown on selective media and provides those bacteria with a pressure to keep the plasmid.
T7 promoter – Promoter from T7 bacteriophage. It is responsible for initiating the transcription of the insert gene into RNA.
T7 RBS – Ribosome binding site from T7 bacteriophage. It is responsible for the recruitment of a ribosome during the initiation of translation.
BLM – ATP-dependent DNA helicase that unwinds single- and double-stranded DNA in a 3'-5' direction. It is involved in several pathways contributing to the maintenance of genome stability, such as replication, reparation
T7 Terminator – Terminator from T7 bacteriophage. It is necessary to stop the transcription of the insert gene.
Ori pBR322 – The origin (ori) is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells.
Par101 – Partition (par) locus from the pSC101 plasmid is required for stable maintenance of the plasmid in a bacterial cell population.
It is a binding site for DNA gyrase. The stabilization of plasmid inheritance is mediated by the ability of par to generate negative supercoils in plasmid DNA. This element is essential for correct segregation, in lack of par a half of cells lose the plasmid.
KanR – Kanamycin resistance gene. It allows to easily detect plasmid-containing bacteria when the cells are grown on selective media and provides those bacteria with a pressure to keep the plasmid.
T7 promoter – Promoter from T7 bacteriophage. It is responsible for initiating the transcription of the insert gene into RNA.
T7 RBS – Ribosome binding site from T7 bacteriophage. It is responsible for the recruitment of a ribosome during the initiation of translation.
Wnt10a – Wnt proteins constitute a large family of secreted glycoproteins that control diverse aspects of embryonic development and adult homeostasis
They have an influence on the balance between proliferation and differentiation in many cell types, they are implicated in biological processes like bone formation, immune regulation, cancer, and stem cell renewal.
Many studies have linked activation of Wnt/β-catenin signaling pathway to radioprotection, especially of the salivary gland, oral mucosa, and gastrointestinal epithelium through inhibition of apoptosis and preservation of normal tissue functions. Wnt10a has been reported as one of the most overexpressed proteins in inhabitants of high background-radiation areas.
T7 Terminator – Terminator from T7 bacteriophage. It is necessary to stop the transcription of the insert gene.
List of primers used to obtain inserts for the genetic vectors:
PAR101
F: 5’ CACGGGCAAATCGCTGAATA
R: 5’ GACAGTAAGACGGGTAAGCCT
With prefix and suffix
F: 5’ GAATTCGCGGCCGCTTCTAGAGCACGGGCAAATCGCTGAATA
R: 5’ CTGCAGCGGCCGCTACTAGTAGACAGTAAGACGGGTAAGCCT
BLM RecQ like helicase
F: 5’ ATGGCTGCTGTTCCTCAAAAT
R: 5’ TTACTTGTCGTCATCGTCCTT
With prefix and suffix
F: 5’ AAAGAATTCGCGGCCGCTTCTAGATGGCTGCTGTTCCTCAAAAT
R: 5’ AAACTGCAGCGGCCGCTACTAGTATTACTTGTCGTCATCGTCCTT
Wnt10aF 5’ ATGGGCAGCGCCCACCC
R 5’ TCACTTGCAGACGCTGACC
With prefix and suffix
F 5’ AAAGAATTCGCGGCCGCTTCTAGATGGGCAGCGCCCACCC
R 5’ AAACTGCAGCGGCCGCTACTAGTATCACTTGCAGACGCTGACC
siRNA
| Gene | RNA oligo sequences 21nU guide (5′→3′) 21nU passenger (5′→3′) |
| TBX2 T-box Transcription factor 2 | 5’ ACUUAUAGCGGCAAUCGUCAG 5’ GACGAUUGCCGCUAUAAGUUC |
| PDCD11 | 5’ AAAGUUCAGGCAAGUGAAGUA 5’ CUUCACUUGCCUGAACUUUUC |
Testing the radioprotective activity of genetic constructs expressing mRNA for proteins Wnt10a and BLM
Crews of future starships are expected to receive extremely high doses of space radiation exceeding the limits of their tolerance during Long-term spaceflights. Within the preliminary research of Team PI’s, adherent cells of mammalian connective tissue revealed a capability to survive after irradiation at doses significantly higher than known limits for the whole organisms (6-8 Gy).
Figure. cultured rabbit chondrocytes irradiated at a dose of 80 Gy. LIVE/DEADstaining two days after irradiation. Cells were predominantly alive (the figure obtained by Dr. Anna Yakimova, Ph.D., and Anna Smirnova, MSc)
In order to approximate the endogenic radioprotective effect of Wnt10a and BLM on human cells, we exposed them to 20 Gy irradiation following the pretreatment with bacterial-derived radioprotective proteins. The irradiation dose was estimated as 25% of previously evaluated tolerance for mammalian connective tissue.
Experimental Protocol
- Cells of RPMI 8866 Human Cell Line were used in dosage of 500 000 cells per well and precultured in 1 ml of cell culture media (PRMI 1688 medium + 10% FBS).
- Conditioned media of gene-engineered bacterias (WNT and BLM) were filtered (0.22 µm micropores) to eliminate living bacterias and added to the wells with RPMI 8866 cells as 1:100.
- cell cultures were exposed to 20 Gy Beta-irradiation.
- The evaluation of cell viability was performed after two days using LIVE/DEAD Assay (Ethidium homodimer-1 and Calcein AM) and a confocal microscope.
Figure. a - PRMI 1688 cell line with WNT-contained media +20 Gy irradiation; b - PRMI 1688 cell line with BLM-contained media +20 Gy irradiation; c - PRMI 1688 cell line with WNT+BLM-contained media +20 Gy irradiation; d – PRMI 1688 cell line with control Bacterial media without radioprotectors +20 Gy irradiation; e - PRMI 1688 cell line (Positive control), no irradiation; f - Negative control, cells were frozen in -20C within 2 days.
We observed no living cells in the experimental group. Some living cells are presented in a Positive control group. Interestingly, that amount of cells dramatically decreases in all Experimental (with irradiation) groups, unlike both Positive and Negative control groups. cells are most likely to be dead immediately after irradiation, and within two days were dissociated in media.
The findings may suggest that the 20 Gy is too high dose for evaluation of radioprotective agents on human suspension cells. The results show us how far is our goal. We believe that future extended research incl. multiple doses of irradiation and bacterial radioprotectors are required.