Team:Hamburg/Contribution

As probably many other teams we did not miss out on the experience of making mistakes. We know that mistakes and learning from them are part of making progress so we collected some of our mistakes and problems so that future iGEM teams can learn from them.

mistakes/problems...	… and how to avoid them
getting stuck at non-functioning assemblies/ side projects and losing time	keep the focus on the part that is most crucial for proceeding with work don’t get distracted by side projects
not synthesising some of our constructs to stay on schedule	try different approaches for solving problems don’t try the same not working
organisms secretly pick up a resistance	don’t forget your negative controls don’t continue with the experiment if your negativcontaolls are positiv
no PCR product	run a gradient PCR to find out the right annealing temperature use a different polymerase add DMSO
GGA does not work	change molar ratio of inserts and backbone (usually varies between 2:1 and 5:1 (insert:vector)) backbone dephosphorylation (no ligation of backbones to themselves) cut in antibiotic resistance gene (proof that at least both parts of the backbone were assembled correctly)
protein expression does not work/ low yield	add ethanol to avoid inclusion bodies different temperatures different media (for example terrific broth instead of LB broth) or supplement with glucose and magnesium chloride IPTG concentration (between 0.1 and 1 mM)

Linkers

As we were building many different fusion constructs we thought of a way to simplify varying the distance between both partners of the construct. A specific distance between two interacting proteins needs to be guaranteed.^[1]

The linkers we designed provide different distances by different lengths. We also considered the use of either flexible or rigid linkers for our constructs, since the flexibility of linkers seems to have an influence on the activity of fusion proteins.^[1]

We designed linkers with lengths of 10 and 20 amino acids. It has been shown that most linkers of fusion proteins have a length between 2 and 31 amino acids, thus we tried to cover this range. ^[2]

By choosing different kinds of amino acids we controlled linker flexibility. While in flexible linkers Glycine and Serine are very common, proline is more often present in rigid linkers.^[2]

To be able to use those linkers for our project we designed them with another feature which are sites for restriction enzymes. This way we can place them between the sequences of the enzymes that are going to be fused.

Other iGEM teams working with fusion proteins can profit from our idea by choosing the linker they consider to be working best for their construct based on the natural distance the proteins need for interaction. If it is unclear what characteristics the linker might need, future teams can try out all different linkers to get an idea of what linker the construct will need to work best.

Due to time limitations we were not able to test our designed linkers to optimise electron transfer between the fused enzymes for a higher yield and compare those to the linkers that were predicted by our software tool.

In the following table we show an overview over the linkers we designed.

Table 1: List of designed linkers with their flexibility, length and sequence.

part name	flexibility	length [bp]	sequence
BBa_K3846150	flexible	30	ttcgtgggtggcggcggttctggtggatcc
BBa_K3846151	flexible	60	ttcgtgggtggcggcggttctggcggtggtggcagcggtggcggcggtagcggcggatcg
BBa_K3846152	rigid	30	ttcgtgcctccaccaccgccaccaccctcg
BBa_K3846153	rigid	60	ttcgtgccaccaccgccgctaccgccgccaccgctgccaccaccgccacctcccggatcg
BBa_K3846500	flexible	28	aattgggtggcggcggttctggtggatc
BBa_K3846501	rigid	28	aattgcctccaccaccgccaccaggatc
BBa_K3846502	flexible	58	aattgggtggcggcggttctggcggtggtggcagcggtggcggcggtagcggcggatc
BBa_K3846503	rigid	58	aattgccaccaccgccgctaccgccgccaccgctgccaccaccgccacctcccggatc

[1] S. M. Hoffmann, M. J. Weissenborn, Ł. Gricman, S. Notonier, J. Pleiss, B. Hauer, ChemCatChem 2016, 8, 1591–1597.

[2] V. P. Reddy Chichili, V. Kumar, J. Sivaraman, Protein Sci. 2013, 22, 153–167.

Software tool

Our software tool LEA (Linker Extraction from Alignments) can be used by future iGEM Teams to predict possible linker sequences for various fusion constructs. It is a simple and easy to use command line tool, which at its core relies on sequence homology. Various parameters can be manipulated by the user. In the end our tool delivers comprehensible and easy to use results. Furthermore our implemented pipeline can be easily modified and improved by future teams. Parts of the tool like the implemented automated BLAST search can also be integrated into future software tools if needed. The implemented MSA processor and the linker extraction can also be called separately. Overall our tool can assist future laboratory teams with optimizing fusion proteins by suggesting linker sequences based on the knowledge of known fusion proteins. A thorough documentation of LEA can be found on the corresponding wiki page and the GitHub repository of the tool.

Table 2: List of suggested linkers predicted by LEA for CYP1A1-CPR fusion

part name	length [bp]	sequence
BBa_K3846154	81	ttcggatttgtggttaaagcgaaaagtaaaaaaattcctctgggtggcatcccgtcgccgagcaccgagcagtcagcatcg
BBa_K3846155	105	ttcgactttttcatgcgcgcgactctgcgtcatggaatgtcggcaacggaattagaggaccagctgaaaggcggcaccgcccattcaaagagtagcgatggatcg
BBa_K3846156	111	ttcgatttttatattaacgcgaccctgcgccatggaatgactccgacggagttagaacacgtgctggcaggtaacggcgcgacctcatcgagcacacacaatatcaaatcg
BBa_K3846157	156	ttcgtgactattaaaccagatgggtttcgcgttcgtgcaaccttacgtcgcggccagagtgcgaccggcctgtcgcagggctcgatgagcgcctctggtgctacgtcaagc gtggcatcccctggacccccggcggcgacaggtgcccaaagatcg
BBa_K3846158	135	ttcgtaactctgaaaccggatggctttacgattcgcgtgcgtccccgcaaaaaggaagctatgaccgcgatgcctggtgcgcagccggaagaaaacggacgtc aagaggaacgaccatcggcaccggccgcatcg
BBa_K3846159	144	ttcgtgactattaagccagcccatttttatgtgcacgcactgcctcgtgaaggtaaaccccagttgcttgcgacgccgtcagcagctccgttcagtagccatgcccgc gagacaaccaacgcgagcttaccagcgtccccatcg