Team:CPU CHINA/Lab

Experiment 1

Component Characterization

Characterization of PAOX1，SpyTag-(ELP)10-MnP/HFB1/AAO and MnP

Linearization of plasmid:

The isolated plasmid pPIC9K_SpyTag-(ELP)10-MnP/AAO/HFB1 and pPIC9K_MnP were linearized respectively by incubating with FD (Fast Digest) Sac I enzyme in the following reaction system at 37℃ for 1 hour.

component volume
Plasmid 10 μg
FD SacI 5 μL
10 x FD buffer 5 μL
ddH2O to 50 μL

The linearized DNA scaffolds used for electrotransformation need to be desalted.

Preparation of competent cells:

Fig. 1 Method of competent cells preparation

Transformation:

P.pastoris GS115 were transformed with linearized pPIC9K_SpyTag-(ELP)10-MnP/AAO/HFB1, pPIC9K_sfGFP and pPIC9K_MnP, which will be inserted into the genome (at 5‘ PAOX1, AOX1 transcription terminator or 3’ AOX1) by homologous recombination.

At least 80 μL competent cells were mixed with 20 μL linearized DNA, incubated for 5-15 min on ice, and transferred to an ice-cold and sterile 0.2-cm gap electroporation cuvette. The cells were pulsed according to the manufacturer’s instructions for P.pastoris at 1500 V, 25 μF. The electroporated cells were immediately diluted in 1 mL ice-cold 1 M sorbitol, and 100- to 200-µL aliquots were spread on MD plates (2 % agar, 1.34 % yeast nitrogen base without amino acids, 4×10-5 % biotin, 2 % dextrose).

Screening for Mut+ and MutS transformants:

The single colonies grown on MD plates after electrotransformation were picked by sterile toothpick and then streaked or patched in a regular pattern on a MD plate and a MM plate (2 % agar, 1.34 % yeast nitrogen base without amino acids, 4×10-5 % biotin, 0.5 % methanol), respectively. This action was repeated until 100 transformants were patched. The plates were then incubated at 30°C for 2 days. After 2 days, scored the plates. Mut+ transformants, which possessed the phenotype we need, grew well on both MD and MM plates. MutS transformants grew well only on MD plates, and showed little or no growth on the MM plates.

Preculture procedure:

After screening for Mut+ and MutS transformants and performing DNA sequencing (by Sangon Biotech) to verify that the correct exogenous genes were recombined, 5 kinds of P.pastoris transformants were grown in 50ml buffered complex glycerol medium (BMGY; 1 % yeast extract, 2 % peptone, 100mM potassium phosphate buffer pH 6.0, 1.34 % yeast nitrogen base without amino acids, 4×10-5 % biotin, 1 % glycerol)[1]

Methanol induction:

After the optical density of 600nm(OD600) of the precultures in BMGY reached 2-6, inoculate the yeast into buffered complex methanol medium (BMMY; same as BMGY but without glycerol, while added 2% methanol) to OD600 of 1). [1]

Quantitative reverse-transcription PCR (qRT-PCR):

Quantitative reverse-transcription PCR (qRTPCR) was applied to evaluate the mRNA expression level of the proteins. The total RNA was extracted out by the Spin Column Yeast Total RNA Purification Kit(Sangon Biotech) and reversely transcribed into cDNA by the HiScript II Reverse Transcriptase(Vazyme). The Quantitative PCR (qPCR) was carried by ChamQ Universal SYBR qPCR Master Mix(Vazyme).

Both the reference gene(ACT1) and the target gene were screened, and the mRNA expression level was relatively quantified using a variation of the Livak method, and the fold difference is defined as the following equation:
F o l d   d i f f e r e n c e = 2 C t − A C T 1 − C t − t a r g e t Fold\ difference=2^{C_{t-ACT1}-C_{t-target}}

Enzyme production:

The yeast are cultivated at 28℃, 280 rpm. 2 %(v/v) methanol was added every 24h.

The OD600 of the cultivation were assayed every 12h

The SDS polyacrylamide gel electrophoresis analysis(SDS-PAGE) of both the cell lysate and supernatant were carried out every 24h with 15% resolving gel.

Enzyme linked immunosorbent assay(ELISA)

The Microbial histidine tag (HIS-Tag) ELISA kit was used to quantify SpyTag-MnP/AAO/HFB1 and MnP/IZU, the manganese peroxidase (MnP) ELISA kit was used to quantify SpyTag-MnP and MnP/IZU.

Enzymatic activity assay

SpyTag-MnP/MnP[2]

Principle: MnP activity was measured by monitoring the oxidating process of 2,6-dimethoxyphenol (2,6-DMP) at 469 nm. (An extinction coefficient of 49.6 mM-1 cm-1 was used for the formation of 2,2',6,6'-tetramethoxydibenzo-1,1'-diquinone)

Fig. 2 Oxidation process of 2,6-DMP

T--CPU_CHINA--Lab--Experiment 2 enzyme activity MnP

Method:

  • The reaction mixtures prepared in advance: 0.4mM MnSO4, 50mM sodium malonate(pH 4.5), 1M 2,6-DMP

  • Testing procedures: mix 140 μ l \mu l reaction mixture and 40 μ l \mu l enzyme solution. By adding 20 μ l \mu l 0.1mM H2O2, the reaction was initiated and the optical density of 469nm(OD469) were tested every 30s for 5 minutes.

  • The definition of enzymatic activity: The amount of enzyme required for the reaction with 1 μM 2,6-DMP at room temperature (25℃) for 1 minute is 1 U.
    c 2 , 6 − D M P = Δ A a s s a y − Δ A c o n t r o l ϵ 469 × d × 1000 × 2 = Δ A a s s a y − Δ A c o n t r o l 49.6 × 0.5 × 1000 × 2 U = c 2 , 6 − D M P × V r e a c t i o n 0.04 = ( Δ A a s s a y − Δ A c o n t r o l ) × 403.2 c_{2,6-DMP}=\frac{\Delta A_{assay}-\Delta A_{control}}{\epsilon_{469}\times d}\times 1000\times 2=\frac{\Delta A_{assay}-\Delta A_{control}}{49.6\times 0.5}\times 1000\times 2\\ U=\frac{c_{2,6-DMP}\times V_{reaction}}{0.04}=(\Delta A_{assay}-\Delta A_{control})\times403.2

AAO[3]

  • Principle: The veratryl alcohol was used as substrate and the formation of veratraldehyde ( ϵ 310 \epsilon_{310} ​​=9.300 mM-1cm-1) was measured to assay the activity of AAO.

    Fig. 3 Oxidation process of veratryl alcohol

  • The reaction mixtures prepared in advance: 800 μ l \mu l of 100mM sodium phosphate buffer pH6.0, 100 μ l \mu l ​ of 50mM veratryl alcohol

  • Testing procedures: 100 μ l \mu l of enzyme solution was added to the 900 μ l \mu l reaction mixtures to initiate the reaction. The OD310 was measured every 30s for 10 minutes.

  • The definition of enzymatic activity: the amount of enzyme that converts 1 μ m o l \mu mol ​ substrate per minute at room temperature is defined as 1 U.
    c v e r a t r a l d e h y d e = Δ A a s s a y − Δ A c o n t r o l 9.3 × 0.5 × 1000 U = c v e r a t r a l d e h y d e × V r e a c t i o n 0.1 = ( Δ A a s s a y − Δ A c o n t r o l ) × 2150.54 c_{veratraldehyde}=\frac{\Delta A_{assay}-\Delta A_{control}}{9.3\times 0.5}\times 1000\\ U=\frac{c_{veratraldehyde}\times V_{reaction}}{0.1}=(\Delta A_{assay}-\Delta A_{control})\times 2150.54

Experiment 2

Assembly and Characterization of System

Protein expression and purification

The gene encoding dCas9 was preserved on the pET-28a plasmid stored in our laboratory. The gene encoding SpyCatcher was synthesized as gene fragments (GeneScript) and was inserted into the multiple cloning site (MCS) of the pUC-19 plasmid (GeneScript). Certain primers were designed and used to amplify the two gene fragments from each vector by polymerase chain reaction (PCR), and the homologous recombinase Exnase Multis (Vazyme) was used to integrate them and insert them into the MCS of pET-28a (+) plasmid (laboratory preservation). The assembled plasmid were transformed into E.coli DH5α (Shanghai Weidi Biotechnology Co, Ltd) competent cells, which were grown for 15 h in 37℃ in LB culture containing 1‰ kanamycin. FastPure Plasmid Mini Kit (Vazyme) is used to extract the plasmid from the amplified culture. Purified plasmid was transformed to the E. coli BL21 (DE3) (Shanghai Weidi Biotechnology Co, Ltd) competent cell, which were grown in 37℃ in LB Culture containing 1‰ kanamycin until OD 600 reached 0.6. Protein expression was subsequently induced at 25℃ for an additional 15 h by adding 100 μM IPTG. The cells were harvested by centrifugation at 4000 × g for 10 min, suspended in lysis buffer with 50 mM HEPES, 500 mM NaCl, 20 mM imidazole, pH 7.5, lysed by high pressure homogenizer (ATS Engineering, Ltd), and additionally centrifuged at 15000 × g for 30 min at 4℃ to collect the soluble lysate.

dCas9-SpyCatcher was purified by binding to Ni-NTA resin (GE), washing five times with 50 mM HEPES, 500 mM NaCl, 20 mM imidazole, pH 7.5, and eluting with 500 mM imidazole. Eluted dCas9-SpyCatcher was buffer exchanged with 20 mM HEPES, 500 mM NaCl, pH 7.5, concentrated using Amicon Ultra 15 mL centrifugal columns (3 kDa MWCO, Milipore), and storde at -80℃.

sgRNA and DNA template synthesis

To synthesize sgRNA, the template was first PCR amplified from a DNA plasmid (pUC-19) containing the gRNA scaffold using a forward primer containing a T7 promoter and the target sequence. Primer sequences for each target site are shown below; note that the same reverse primer was used for synthesizing sgRNA template for all three types of target sites. Subsequently the three templates were purified using agarose gel electrophoresis, The gel was recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme).

Forward primers (5' -> 3') Reverse primer (5' -> 3')
T1: TAATACGACTCACTATAGGGCTACCATAGGCACCACGAGGTTTTAGAGCTAGAAATAGCA (Common for all target sites) AAAAGCACCGACTCGG
T2: TAATACGACTCACTATAGGGGGCACCATACCGAGTGATGGTTTTAGAGCTAGAAATAGCA
T3: TAATACGACTCACTATAGGGATATCGTTTACCAAAACGGGTTTTAGAGCTAGAAATAGCA

sgRNA for each binding site was then transcribed from a corresponding template using the folowing reaction system at 37℃ until a large amount of white precipitate is produced, and purified by TRIZOL method.

  • Template 20 μL
  • 1 M Tris, pH 8.0 100 μL
  • 1 M MgCl2 25 μL
  • 1 M DTT 10 μL
  • 1 M Spermidine 2 μL
  • 1 % Triton X-100 10 μL
  • T7-RNP 10 μL
  • NTP 4 × 60 μL
  • DEPC-Water 579 μL

The dsDNA scaffold was similarly PCR amplified from a DNA plasmid (pUC-19) containing the target sequence using a forward primer, 5'-TTCCACTCGGTTGAGCCG-3', and a revese primer 5'-CTAGAACGCCCCCTATGAGAG-3'. The products were purified using agarose gel electrophoresis, The gel was recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme).

Assembly of protein-dCas9-DNA complex

For binding dCas9-SpyCatcher to the DNA template, first 10 μM dCas9-SpyCatcher was mixed with 10 μM corresponding sgRNA in a buffer containing 50 mM HEPES, 500 mM NaCl, pH 7.5 and incubated for 30 min. Subsequently, each type of dCas9-SpyCatcher-sgRNA complex was mixed with the DNA template under the same buffer conditions for 1 h at room temperature; the reaction mixture contained 0.5 μM DNA template and 2 μM of each (dCas9-sgRNA) complex loaded with different sgRNA. Use the electrophoretic mobility shift assay (EMSA) experiment to verify binding.
For assembling the protein-dCas9-DNA complex, 20 μM SpyTag-containing proteins were mixed with 10 μM dCas9-SpyCatcher and allowed to conjugate for 1 h. Then, sgRNA was added to the reaction mixture at 10 μM and incubated for 10 min. Subsequently, each type of (protein-SpyTag):(dCas9-SpyCatcher):sgRNA complex was mixed with the dsDNA scaffold for 1 h at room temperature; the reaction mixture contained 0.5 μM DNA template and 2 μM of each complex loaded with different combinations of protein and sgRNA. Use the Superdex 200 Increase 10/300 GL (GE) to verify the binding of protein-dCas9 complex and use the Superose 6 10/300 GL (GE) to verify the binding of the final complex.

Experiment 3

Efficacy Test of Polyethylene Degrading System

Pretreatment of polyethylene material

The PE gloves were cut into slices of 0.5 × 0.5 cm, cleaned three times with 75% ethanol and dried for 2h in an oven at 37°C, then reserved in clean pcr tubes for further incubation for further incubation.

Incubation of polyethylene(PE) with MnP

Formulate the incubation system containing 0 mM sodium malonate (pH 6.0), 0.2 mM MnSO4, 0.1 mM H2O2, 150 mM NaCl, 0.1% Tween 80 and 1 U SpyTag-MnP, while the other control group untreated. Each group contains 3 separated system which numbered 1/2/3. Screenings of each piece were recorded by optical microscope as the initial data.

After incubation, the pieces were washed as the following steps: Collect and incubate the PE films with 1%SDS, then ultrasonicated for 10 min. Soak them with 0.1M NaOH and discard the solution after 20 min of ultrasonication. Finally, the films were rinsed with ddH2O and 75% Ethanol, dried at 37℃ for 1 hour, then ready for further detection.[4]

Detection of results

1. Optical microscope detection method

In pre-test, we observed changes on the surface, so that we took out samples numbered 1/2/3 on the 4th, 8th, and 12th day after incubation, respectively.

Then the samples were preserved for subsequent observation.

2. Infrared Spectroscopy Analysis

Fourier Transform Infrared (FTIR) imaging was applied to analyze the changes of surface chemical components and functional groups. The Attenuated Total Refraction (ATR) technology was applied.

3. HT-GPC Analysis

The molecular weight distribution (MWD) changes of PE films were analyzed using High Temperature Gel Permeation Chromatography (HT-GPC). The column set was PL gel MIXED-B LS 300 x 7.5 mm x 3, and the eluent was TCB stabilised with 0.0125% BHT. Trichlorobenzene was used as a mobile phase (1 mL/min) at 150℃.

4. Scanning electron microscope, SEM

Limited of instruments and technique, the tests were relegated to the Center of Modern Analysis Nanjing University.

Experiment 4

Site Specific Mutation

1- Polymerase Chain Reaction(PCR)

Experimental groups: Mutant 1#-10#

PCR reaction system:

  • DNA Template : 1 μl plasmid of MnP
  • DNA Polymerase and buffer system : 10 μl PrimeSTAR
  • Primers: 1μl F-primer + 1μl R-primer

PCR amplified procedure:

All the PCR components are mixed together and are taken through series of 3 major cyclic reactions conducted in an automated, self-contained thermo-cycler machine.

  • Thermal denaturation: The reaction mixture was heated to 98℃ for 3 min for predegeneration.

  • Denaturation: The reaction mixture was heated to 98℃ for 1 min. During this, the double stranded DNA is denatured to single strands due to breakage in weak hydrogen bonds.

  • Annealing: The reaction temperature was rapidly lowered to 54°C for 30 seconds. This allows the primers to bind (anneal) to their complementary sequence in the template DNA.

  • Elongation: The reaction mixture was heated to 72℃ for 4 min. In this step, the polymerase enzyme sequentially adds bases to the 3′ each primer, extending the DNA sequence in the 5′ to 3′ direction.

  • Cyclic reactions: the step 2 3 4 were repeated for 30 times.

  • Complementary extension: The reaction mixture was heated to 72℃ for 10 min.

2- AGE (agarose gel electrophoresis)

Materials: Agarose powder, 1X TBE buffer (89 mM Tris-base, 89 mM boric acid and 2 mM EDTA) prepared from 10X TBE, Ethidium Bromide (5 mg/ml), Gel loading dye (Glycerol and orange dye),1 kb and 100 bp DNA ladder, horizontal electrophoresis apparatus and power supply.

Electrophoretic conditions: 130V 25min

  1. Measure the 0.25 grams of agarose to make 1% agarose gel(25ml TAE buffer). Heat the solution to boiling in the microwave to dissolve the agarose to produce a homogeneous mixture.
  2. Add 0.5 μl of ethidium bromide to the dissolved agarose and mix .
  3. Get a gel plate and a comb and put the two dams into the slots on each side of the gel plate. Make sure that they fit tight. Pour the melted agarose onto the gel plate in the electrophoresis tray. Place the comb in its place. Let the gel cool to room temperature and fully solidificated.
  4. Place the gel in the electrophoresis chamber. Pour enough electrophoresis buffer (1X TBE) to cover the gel to prevent overheating of the gel.Carefully remove the comb.
  5. Prepare the DNA sample by mixing around 20μl PCR product with 2 μl of loading dye.
  6. Add 3 μl DNA ladder into the first well by using a micropipette. Carefully place the prepared samples into adjacent wells.
  7. Electrophorese the samples at 130 V for 25 minutes.
  8. Carefully remove the gel, place it onto the UV light box and take a picture for the gel.
3- FastPure Gel DNA Extraction

Materials: FastPure Gel DNA Extraction Mini Kit(Vazyme Biotech)

Protocol:

  1. After DNA electrophoresis for fractionating DNA fragments, excise the single stripe of DNA fragment from the agarose gel under UV light. Weigh the gel slice (without microcentrifuge tube) to calculate its volume: The volume of 100 mg gel slice is approximately
    100 μl, assuming the density is 1 g/ml.
  2. Add 1 volume Buffer GDP, incubate at 50°C- 55°C for 7 - 10 min (according to the gel size, adjust incubation time until the gel completely dissolved). Invert the tube 2 times during the incubation.
  3. Spin briefly to bring the sample to the bottom of the tube, insert a FastPure DNA Mini Columns-G into a 2 ml Collection Tube, carefully transfer the solution maximally of 700 μl once a time to the filtration columns, centrifuge at 12,000 x g for 30 - 60 sec.
  4. Discard the filtrate and reuse the Collection Tube, add 300 μl of Buffer GDP to the column, incubate at room temperature for 1 min, centrifuge at 12,000 x g for 30 - 60 sec.
  5. Discard the filtrate and reuse the Collection Tube, add 600 μl of Buffer GW (with ethanol added) to the filtration column, centrifuge at 12,000 x g for 30 - 60 sec.
  6. Repeat step5.
  7. Discard the filtrate and reuse the Collection Tube, centrifuge the empty column at 12,000 x g for 2 min.
  8. Insert the column into a clean 1.5 ml microcentrifuge tube, add 7 μl - 30 μl of Elution Buffer to the center of the column membrane, incubate for
    2 min, and then centrifuge at 12,000 x g for 1 min. Discard the filtration column, store DNA at -20℃.
4- DpnⅠdigestion

The reaction system(20 μl):

Component Addition Final concentration
10×Buffer Tango (With BSA) 2 μL 1×
Dpn I (10 U/μL) 0.5-2 μL 0.25-1 U/μL
DNA（0.5-1 μg/μL） 1 μL 25-50 ng/μL
Nuclease-free water Up to 20 μL -

Procedure:

the mixture was incutated in water bath at 37℃ for 1 hour.

5- Recombination

Protocol:

  1. Calculate the amount of DNA for recombination by formula. Dilute linearized vectors and inserts before recombination to make sure the loading accuracy. The volume of each component loaded should
    be no less than 1 μl.

    Set up the following reaction on ice:

    Components Addition
    Linearized Vectors X μl
    Inserts Y μl
    5× CE Ⅱ Buffer 4 μl
    Exnase Ⅱ 2 μl
    ddH2O to 20 μl

    The optimal mass of vector = [0.02 × number of base pairs] ng (0.03 pmol)
    The optimal mass of insert = [0.04 × number of base pairs]ng (0.06 pmol)

  2. Gently pipette up and down for several times to mix thoroughly. Spin briefly to bring the sample to the bottom of the tube before reaction.

  3. Incubate at 37°C for 30 min and immediately place the tube at 4°C or on ice.

6- Transformation
  1. Place the competent cells(DH5α) on ice
  2. Pipet 10 μl of the recombination products to 50 μl of the competent cells, flip the tube several times to mix thoroughly, and then place the tube still on ice for 30 min.
  3. Heat-shock the tube at 42°C for 45 sec and then immediately chill on ice for 2 - 3 min.
  4. Add 450 μl of LB medium (without antibiotics) to the tube. Then, shake at 37°C for 1 hour.
  5. Preheat the LB plate which contains appropriate selection antibiotic at 37°C.
  6. Centrifuge the culture at 2,500 rpm for 3 min, discard 900 μl of supernatant. Then, re-suspend the pellet with 100 μl of remaining medium and plate it on an agar plate which contains appropriate selection antibiotic.
  7. Incubate at 37°C for 12 -16 hours.

Reference

[1] Cereghino, J. L. & Cregg, J. M. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS microbiology reviews 24, 45-66, doi:10.1111/j.1574-6976.2000.tb00532.x (2000).

[2] Manganese(II) oxidation by manganese peroxidase from the basidiomycete Phanerochaete chrysosporium. Kinetic mechanism and role of chelators.J Biol Chem. 1992 Nov 25; 267(33):23688-95.

[3] Jankowski N, Koschorreck K, Urlacher VB. High-level expression of aryl-alcohol oxidase 2 from Pleurotus eryngii in Pichia pastoris for production of fragrances and bioactive precursors. Appl Microbiol Biotechnol. 2020;104(21):9205-9218. doi:10.1007/s00253-020-10878-4

[4] Zhang J, Gao D, Li Q, et al. Biodegradation of polyethylene microplastic particles by the fungus Aspergillus flavus from the guts of wax moth Galleria mellonella. Sci Total Environ. 2020;704:135931. doi:10.1016/j.scitotenv.2019.135931