Line 86: | Line 86: | ||
</p> | </p> | ||
<div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/d/d8/T--Vilnius-Lithuania--multiple_assembly_gel.png" /> | <div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/d/d8/T--Vilnius-Lithuania--multiple_assembly_gel.png" /> | ||
− | <div> <b> Fig. 1. </b> Restriction analysis | + | <div> <b> Fig. 1. </b> Restriction analysis of pTRKH2 vector with new MCS. 1st sample - restriction control, 2nd - pTRKH2 with old MCS, 3rd-6th - pTRKH2 new old MCS. |
</div> | </div> | ||
</div> | </div> | ||
Line 479: | Line 479: | ||
</p> | </p> | ||
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/5/5e/T--Vilnius-Lithuania--BLOTAS.png" width=600px/> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/5/5e/T--Vilnius-Lithuania--BLOTAS.png" width=600px/> | ||
− | <div> <b> Fig. 36. </b> Western blot.</div> | + | <div> <b> Fig. 36. </b> Western blot of PPDK. </div> |
</div> | </div> | ||
<p>Next step was PPDK stabilisation, we found out that denatured PPDK can be stabilised in a buffer containing 0.375 M arginine. PPDK was then further purified through nickel affinity chromatography and used for further experiments.</p> | <p>Next step was PPDK stabilisation, we found out that denatured PPDK can be stabilised in a buffer containing 0.375 M arginine. PPDK was then further purified through nickel affinity chromatography and used for further experiments.</p> | ||
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/a/ad/T--Vilnius-Lithuania--Netirpus_tirpus.png" width=300px/> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/a/ad/T--Vilnius-Lithuania--Netirpus_tirpus.png" width=300px/> | ||
− | <div> <b> Fig. 37. </b> | + | <div> <b> Fig. 37. </b> Fractions.</div> |
</div> | </div> | ||
<h4>SELEX</h4> | <h4>SELEX</h4> | ||
Line 736: | Line 736: | ||
</div> | </div> | ||
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/b/b4/T--Vilnius-Lithuania--No_1.2_tert.png" width=500px/> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/b/b4/T--Vilnius-Lithuania--No_1.2_tert.png" width=500px/> | ||
− | <div> <b> Fig. | + | <div> <b> Fig. 48. </b> Tertiary structure of No. 1.2 modified aptamer sequence.</div> |
</div> | </div> | ||
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/4/44/T--Vilnius-Lithuania--No_2.2_tert.png" width=600px/> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/4/44/T--Vilnius-Lithuania--No_2.2_tert.png" width=600px/> | ||
− | <div> <b> Fig. | + | <div> <b> Fig. 48. </b> Tertiary structure of No. 2.2 aptamer sequence.</div> |
</div> | </div> | ||
<h4>Aptamer NGS sequencing</h4> | <h4>Aptamer NGS sequencing</h4> | ||
Line 746: | Line 746: | ||
</p> | </p> | ||
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/5/5e/T--Vilnius-Lithuania--SELEX_5th_round_example.png" width=600px/> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/5/5e/T--Vilnius-Lithuania--SELEX_5th_round_example.png" width=600px/> | ||
− | <div> <b> Fig. | + | <div> <b> Fig. 49. </b> NGS first indexing optimization. 3<sup>rd</sup> cycle aptamers were degraded. </div> |
</div> | </div> | ||
<div class="table-container"> | <div class="table-container"> | ||
Line 870: | Line 870: | ||
<h4>For further testing aptamers</h4> | <h4>For further testing aptamers</h4> | ||
<h5>Anti-HSA aptamer with PDA</h5> | <h5>Anti-HSA aptamer with PDA</h5> | ||
− | <p>In aptamer database we found a sequence for human serum albumin (HSA) and ordered it with amine modification on 5’ end of ssDNA. Overall sequence and secondary structure is shown in figure | + | <p>In aptamer database we found a sequence for human serum albumin (HSA) and ordered it with amine modification on 5’ end of ssDNA. Overall sequence and secondary structure is shown in figure 50.</p> |
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/9/99/T--Vilnius-Lithuania--HSA_Apt-06.png" /> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/9/99/T--Vilnius-Lithuania--HSA_Apt-06.png" /> | ||
− | <div> <b> Fig. | + | <div> <b> Fig. 50. </b> Anti-HSA aptamer sequence and tertiary structure.</div> |
</div> | </div> | ||
<p>It was tested in conjugation with PDA and showed positive results. Both negative control (non-native BSA) and distilled water did not show color change. From this we can say that the chosen anti-HSA aptamer is specific and suitable for diagnostic test as positive blood control.</p> | <p>It was tested in conjugation with PDA and showed positive results. Both negative control (non-native BSA) and distilled water did not show color change. From this we can say that the chosen anti-HSA aptamer is specific and suitable for diagnostic test as positive blood control.</p> | ||
<div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/a/ae/T--Vilnius-Lithuania--PDA_results.png" width=500px/> | <div class="figure-container center"> <img alt="" src="https://static.igem.org/mediawiki/2021/a/ae/T--Vilnius-Lithuania--PDA_results.png" width=500px/> | ||
− | <div> <b> Fig. | + | <div> <b> Fig. 51. </b> Testing of anti-PPDK and anti-HSA aptamers by conjugating with PDA. a - PDA with anti-HSA aptamer shows positive selection for native form BSA, b - PDA with SELEX developed anti-PPDK aptamer |
shows positive selection for all types of solutions, c - PDA with anti-PPDK aptamer after humid air-blow shows positive selection in all area, d - PDA without aptamer as negative control.</div> | shows positive selection for all types of solutions, c - PDA with anti-PPDK aptamer after humid air-blow shows positive selection in all area, d - PDA without aptamer as negative control.</div> | ||
</div> | </div> | ||
Line 885: | Line 885: | ||
</p> | </p> | ||
<p> | <p> | ||
− | For more detailed control reactions water and ethanol were chosen. Both of them showed positive results. Color developed on PDA by ethanol was different from those with water based solutions - a little bit on the darker side with a pinch of brown discoloration (figure | + | For more detailed control reactions water and ethanol were chosen. Both of them showed positive results. Color developed on PDA by ethanol was different from those with water based solutions - a little bit on the darker side with a pinch of brown discoloration (figure 51. spot 5). |
</p> | </p> | ||
<p> | <p> |
Revision as of 03:53, 22 October 2021
RESULTS
Prevention
Reconstruction of shuttle vector
For the construction of the naringenin synthesis cassette that would work in both Escherichia coli Nissle 1917 and Lactobacillus casei BL23, we chose to use the pTRKH2 shuttle vector. We modified the plasmid’s original multi-cloning site (MCS). This was successfully done by amplifying the pTRKH2 vector with MCS deletion primers in PCR reaction (Fig. 1), and generating the new MCS site with designed oligonucleotides (Fig. 1).
Promoter characterization
Before the actual experiments, we optimized our measurement condition with an iGEM measurement kit according to the standard protocol. This optimization allowed choosing the most appropriate gain settings in the plate reader.
To assure the most efficient possible naringenin production pathway, we had to select the most suitable promoters for the expression of naringenin synthesis genes. Evaluation was done by analysing the results of superfolder green fluorescent protein (sfGPF) expression rates under the promoters of interest and dividing the intensiveness of the signal by the OD600 during the course of 6 hours (Fig. 2).
Evaluation of transcription efficiency dependency on E. coli Nissle 1917 genomic site
We decided to insert naringenin metabolic pathway encoding genes into E. coli Nissle 1917 genome. This experimental decision helps to overcome the problem of additional antibiotic usage, reduce the fluctuations gained because of unstable plasmid copy numbers in cells. Furthermore, metabolic pathway genomic insertion helps to overcome horizontal gene transfer problem. This is particularly important as probiotics interact with a huge variety of microorganisms in our intestine.
To measure the transcription activity from two genomic regions, we have inserted sfGFP under slpA promoter into colicin and nupG genes (fig. 4, 5) and compared the amount of fluorescence (fig. 6). As we can see in fig. 4, GFP insertion into colicin gene has been successful with 89 percent efficiency and GFP insertion into nupG gene a bit lower (fig. 5).
The results of fluorescence measurement (fig. 6) showed that transcription activity was higher and more stable in colicin site.
GFP expression in L. paracasei BL23
After promoters evaluation in E. coli DH5 alpha strain and finding out that p-slpA was the strongest promoter, we decided to insert sfGFP construct under p-slpA control into L. paracasei BL23 genome. For this reason, we have inserted sfGFP coding gene into pLCNICK plasmid and placed it under transcriptional control of slpA promoter. This new plasmid has been obtained by digestion of pLCNICK with BglI and BshTI restriction endonucleases and ligation with sfGFP construct. GFP insertion into pLCNICK plasmid has been validated by visible fluorescence. Designed system was only suitable for DH5 alpha strain bacteria (fig. 52). In consequence, we decided to further investigate E. coli Nissle 1917 as our chassis.
mRNA cyclization system evaluation
During the same set of experiments as for promoter characterization, mRNA cyclization (BBa_K3904217) performance was tested in our system.
At first, the fluorescence of E. coli Nissle 1917 bacteria containing pTRKH2+sfGFP and pTRKH2+loop+sfGFP plasmids with different promoters was measured.
Since mRNA cyclization system performance was not as expected, we decided to repeat the experiment while using longer sequence protein TAL fused with sfGFP. What is more, these measurements were conducted in E. coli DH5 alpha and at different temperatures of 37 °C and 24 °C, since during the construction of mRNA cyclization system, we noticed that it begins to fluoresce after incubation at room temperature.
Each experiment had three controls: positive – fluorescent E. coli DH5 alpha with J23101 Anderson promoter, negative – non-fluorescent bacteria, contamination – media with an antibiotic.
In the 7 figure, one can see that there is no significant difference in the mRNA cyclization performance in 37 °C and 24 °C because the shift of the curves is only affected by the lower OD600 values in 24 °C. The bottom graph illustrates averaged data at 37 °C. Interestingly, it was noticed that mRNA cyclization does not allow the accumulation of the sfGFP protein. After some time, the system reaches equilibrium, and the fluorescence/OD600 ratio stabilizes.
Conclusions
One of our chosen protein synthesis enhancing mechanisms - mRNA cyclization - appeared not to work as expected. In our case, it did not increase protein production. Interestingly, protein synthesis stabilization was noticed as a novel property of this system and may be further tested.
Metabolic pathway construction
To construct the pTRKH2 vector containing all four genes of the naringenin metabolic pathway we amplified pTRKH2 vector and all four naringenin synthesis genes using primers that contain specific restriction endonuclease recognition sites. This way we should have been able to digest each sequence with appropriate restriction enzymes and create a library of inserts with sticky ends, that can be ligated into the target vector as the ending part of composite insert or as a part of the whole naringenin synthesis cassette. However, we were only able to construct plasmids containing only TAL and TAL+4CL under slpA promotor (Fig. 8), cassettes that later were found to have been mutated by Sanger sequencing.
To get the construct containing all four genes we chose the strategy of Gibson assembly. By amplifying the pTRKH2 vector and all naringenin synthesis genes with primers containing flanking regions that form homologous pairs with each other in the manner that a complete naringenin synthesis cassette should be constructed in a single tube reaction. Nevertheless, we were not able to obtain the desired construct. In a parallel, fused proteins were successfully constructed in the pTRKH2 vector and analysed further.
Endogenous metabolism modulation toward enhanced naringenin synthesis
To enhance naringenin synthesis in E. coli Nissle 1917 we have created ackA-pta double knockout. Firstly, we knockouted ackA (fig. 9), and pta (fig. 10) genes separately with 100 percent and 60 percent efficiency, respectively. Later on, we used ackA knockout to generate ackA-pta double knockout (fig. 11) with 80 percent efficiency. For further experiments used ackA knockout have been verified by ackA gene sequencing.
Our next move was to create tyrP knockout. Firstly, we have successfully obtained tyrP knockout (fig. 12).
However, we have not succeeded in creating double or triple knockouts (ackA-tyrP or ackA-pta-tyrP). As you can see in the fig. 13, restriction of cPCR product from randomly selected transformants do not show genomic modification in the tyrP gene. Interestingly, in the positive control line we can see very large DNA fragment (> 10 kbp). We could not explain this result without additional genomic analysis.
We have repeated PCR from previously obtained tyrP knockouts and all knockouts had this one sharp fragment above 10 kbp ladder line (fig. 14). These surprising results might be obtained because of some unknown genomic reorganization of edited genomic locus. The exact reorganization output can be determined by genome sequence which was not in our focus. As we seek to avoid usage of undetermined changes containing E. coli Nissle 1917 strain, we decided to do not use tyrP knockout in further experiments. In addition, we do not succeed in obtaining adhE gene knockout even after testing two different sgRNAs.
Naringenin evaluation
To evaluate the quantity of synthesis by our constructs/enzymes, we employed HPLC-MS to find naringenin and intermediate compounds. All enzymes were subjected to analysis first by themselves and further in different combinations. Both control for native cellular metabolism and with additional substrates were taken into account.
First, we created control chromatograms for naringenin and first enzymatic intermediate - p-coumaric acid (product of Tyrosine ammonia lyase (TAL) from naringenin synthesis pathway). By dissolving technical grade compounds in pure water we found retention times:
Naringenin | p-coumaric acid |
---|---|
6.88 min | 6.17 min |
This information enabled us to search for compounds in more complex mixtures, in particular LB medium from overnight cultures. Furthermore, we were able to distinguish our products based on retention time, m/z and UV-Vis absorption spectrum.
Using the HPLC-MS method we analyzed the media samples of cultures containing pTRKH2 vectors with TAL gene and J23101 Anderson or surface layer protein A (slpA) promoters. The data of the experiments showed that plasmid with J23101 Anderson promoter and TAL encoding sequence determines an efficient synthesis of p-coumaric acid in our transformants, nevertheless analogous processes have not been identified in the samples containing slpA promoter. We hypothesized that the reason for this data non-reproducibility may be a possible mutation in pTRKH2 vector containing slpA promoter, the hypothesis later was approved by Sanger sequencing.
Similar intermediate compound detection strategy was applied for constructs containing 4CL and CHS encoding sequences. We supplied cultures with p-coumaric acid as a substrate for their specific reactions and used HPLC-MS method to detect the consumption of p-coumaric acid. The experiments were conducted with cultures containing pTRKH2 vectors with 4CL gene and J23101 Anderson or slpA promoters, as well as linked (linkers: GSG, GGGGS, (GGGGS)2, (GGGGS)3, EAAAK, (EAAAK)2, (EAAAK)3) 4CL and CHS genes under the same promoters. However, none of the aforementioned constructs have been found to demonstrate distinct enzymatic activity by consummation of the given substrate.
In the hopes of finding further intermediates we searched for a few additional m/z as a result of accumulation. p-coumaroyl-CoA and naringenin chalcone were chosen as the ones who could give us more information. However, fusion protein samples did not show any signs of naringenin chalcone. Moreover, we found the same m/z of p-coumaroyl-CoA in both control and sample from the desired construct medium when supplied with additional p-coumaric acid. This suggested to us that we could not precisely determine the quantity of synthesized p-coumaroyl-CoA because we do not know detailed information about internal processes. We hypothesize that control E. coli DH5 alpha has 4CL homology enzymes for forming carbon-sulfur bonds as acid-thiol ligases and thus synthesis of p-coumaroyl-CoA by both recombinant and native enzymes overshadow one another. We even cannot be sure about synthesis of a particular compound because it needs further analysis by NMR as chromatograms and UV-Vis spectrum lack structural information.
Detailed reports from HPLC-MS are referred to in table 2.
Name | Description | File |
---|---|---|
Technical grade p-coumaric acid | Technical grade p-coumaric acid was dissolved in water for reference chromatogram and other specifications. | Download |
TAL1 lysate | First enzyme Tyrosine ammonia lyase (TAL) in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. Culture was lysed to check for compounds inside cells. | Download |
TAL1 LB medium | First enzyme Tyrosine ammonia lyase (TAL) in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. Only LB medium was subjected to HPLC-MS analysis. | Download |
DH5alpha with p-coumaric acid | Only DH5alpha without any plasmid cells were grown in LB medium with supplied p-coumaric acid. | Download |
LB with p-coumaric acid | LB medium with p-coumaric acid. | Download |
LB without p-coumaric acid | LB medium without p-coumaric acid. | Download |
GS1 LB medium without p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid without supplied p-coumaric acid to LB medium. | Download |
GS1 lysate with p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid without supplied p-coumaric acid to LB medium. | Download |
GS1 lysate with p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid without supplied p-coumaric acid to LB medium. | Download |
GS1 LB medium with p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. | Download |
GSG LB medium with p-coumaric acid | Fusion protein (4CL and CHS) construct with GSG linker in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. Culture was lysed to check for compounds inside cells. | Download |
Naringenin | Technical grade naringenin dissolved in distilled water. | Download |
In parallel, we have also introduced linked 4CL-CHS and CHI (5th mutant) encoding genes into the E. coli Nissle 1917 genome (fig. 18, 19). cPCR of transformants probably containing TAL encoding gene in the colicin gene has not shown clear results as additionally to the expected 1.7 kp band there were and two a bit smaller bands. For this reason, we conducted enzymatic activity measurement by identifying p-coumaric acid appearance in growth medium in order to validate TAL encoding gene insertion into E. coli Nissle 1917 genome.
As we have identified TAL enzymatic activity in previous experiments, we measured TAL enzymatic activity, where TAL encoding gene is inserted into E. coli Nissle 1917 genome. We have grown cocultures composed of wild type Nissle producing TAL, ackA-pta double Nissle knockout producing linked 4CL-CHS enzymes and wild type Nissle producing CHI. After 48 hours cocultures inoculation in LB medium at 37°C HPLC-MS measurement has been done. It revealed that only TAL was enzymatically active from our naringenin metabolic pathway.
Kill-switch
VapXD kill-switch accuracy was firstly evaluated with a serial dilution spotting method. Sets of agar plates with and without bile salts were incubated in different temperatures of 37 °C, 30 °C, and room temperature (24 °C). However, the distinction between plates with and without bile salts supplementation was only seen at room temperature (figures 20 and 21).
Results showed bile-regulated and cold-inducible VapXD kill-switch and bile-regulated and p-slpA VapXD kill-switch work on agar plates at room temperature, as with lower OD600 values they inhibited cell growth.
Further VapXD kill-switch performance was tested in liquid medium, as OD600 measurements were performed. First of all, VapD toxin (BBa_K3904000) activity was characterized while regulating its production with cold-induced promoter (BBa_K3904003). Graphs at the top of figure 22 illustrate bacteria growth without toxin and graphs at the bottom with the toxin in different temperatures. While comparing obtained data in 37 and 24 °C, temperature change can be seen as inducing greater toxin production and cell death. On the other hand, VapX activity is not fully accurate due to the leakage of the promoter during the temperature change from 37 to 24 °C.
What is more, VapXD with the bile-induced promoter before antitoxin and with the cold-induced promoter before toxin was characterized. Graphs in the top of X figure demonstrate bacteria growth with and without bile salts supplementation in media at 24 °C, as graphs in the bottom at 37 °C. It can be seen that OD600 in the presence of bile salts and 37°C bacteria grow more exponentially than without bile salts and in 24 °C. In the ideal case, no antitoxin should be produced in the absence of bile salts and 24 °C, and toxin synthesis should be induced. However, the results indicate that in such conditions, bacteria growth is only slightly repressed.
When results in 37 °C obtained with different OD600 values were averaged (Fig. X. Mean comparison with/no bile 37 °C), the difference between measurements with and without bile salts appeared to be mathematically insignificant.
The activity of different promoters before VapX toxin was compared without bile salts supplementation in media at 37 °C. From promoters’ strength evaluation measurements (fig. 25), it was seen that the p-slpA promoter (BBa_K3904712) is the strongest in our inventor. VapXD assessment also showed that under this promoter, toxin production is more significant than under other promoters. The sloping graph rise illustrates this because more toxin is produced, and bacteria growth is inhibited. However, after the results were averaged, no significant difference between different promoters was seen.
While comparing results with different promoters in 24 °C, no significant difference can be seen (fig. 26).
Furthermore, we successfully inserted the VapXD system construct into E. coli Nissle 1917 genome (fig. 27, 28). Both of these VapXD systems constructs have been inserted into the E. coli Nissle 1917 genome with 100 percent efficiency and proved by DNA sequencing.
VapXD kill-switch inserted in E.coli Nissle 1917 genome was also characterized by OD600 measurements. The results of the genomic construct were compared to the plasmid construct.
The first observation from fig. 29 was that bacteria containing construct in the genome grow more exponentially. It does not have to maintain antibiotic resistance and the burden for the cell lowers.
As shown in fig. 30 no significant difference in the VapXD kill-switch performance was seen while comparing results of the genomic and plasmid constructs with the same promoters.
While comparing results obtained during the measurements with and without bile salts (fig. 31), no significant difference was seen. This once again indicates promoter leakage and the system's inaccuracy.
Further suggestions for VapXD kill-switch implementation
As it can be seen from the results discussed before, there are some places for the VapXD kill-switch improvement. One of them could be to search for alternative (weaker or constitutive) promoters instead of bile-induced. What is more, a bigger variety of promoter could be tested in order to obtain 2:1 stoichiometry of antitoxin and toxin in a more accurate way.
Detection
Entamoeba histolytica recombinant protein synthesis
In order obtain suitable biomarkers for Entamoeba histolytica detection, we needed to produce recombinant Entamoeba histolytica proteins - pyruvate, phosphate dikinase (PPDK) and cysteine proteinase 5 (CP5). The CP5 gene was cloned into a pET-28a(+) vector which is used to tag proteins with a histidine tag on both C and N terminus. The PPDK gene was first cloned into a pET-28a(+) plasmid, that we modified by removing extra amino acids before the histidine tags. However, constructs kept mutating so we decided to clone it into the default pET-28a(+) plasmid to keep the chance of mutation at minimum. The conditions of biomass growth were similar for both proteins, the induction was carried out in the BL21 strain of E. coli for 3 hours in 37°C at concentration of 0.6 mM IPTG for CP5 and 1 mM for PPDK. The bacteria containing the PPDK plasmid also were grown in TB medium and the CP5 containing transformants were grown in LB medium.
Since active protease can lyse this protein producing organism, the CP5 gene contains an inactive and insoluble pro-enzyme site that has a N-terminal pro-sequence, which can be cut off by the enzyme itself outside the cell. Therefore, the purification of CP5 was supposed to be done in three distinct steps: denaturation, renaturation and activation. Unfortunately, the yield of the protein was too low and the process itself was too costly to repeat it several times in order to optimize the purification conditions. We could only see the same pre-enzyme band in the SDS gel after the final step. According to the relevant literature we speculate that the most important factor in the process is the ratio between the protein and the refolding buffer. This was the only thing we could not check during our experiments, as we could not manage to successfully concentrate the reforded protein.
Since we could not purify the active and soluble protein we had to find a way to stabilise the denatured protein in a buffer suitable for aptamer selection i.e. without urea or other strong denaturants. We tried out several compounds with protein stabilising potential and discovered that denaturated CP5 pro-enzyme is stabilised by CuCl2. Unfortunately, the stabilising effect was not as significant as we hoped and there was not enough of the protein in our soluble fraction to use for our further experiments.
Although we failed to produce the CP5 protein, we still had another possible biomarker - PPDK. The purification of this protein was supposed to be much simpler based on the literature, however we faced the same problems here as well. Although we found some of our target protein in the soluble fraction, the amount was too insufficient compared to what we needed to evolve the aptamers. It also seemed to have formed insoluble inclusion bodies. We hypothesise that it happens because of the extra amino acids in the pET-28a(+) backbone. We managed to increase the solubility by lysing the cells in the presence of detergents - Triton X-100 and NP-40. However, the protein was still barely visible on the Western blot membrane.
Next step was PPDK stabilisation, we found out that denatured PPDK can be stabilised in a buffer containing 0.375 M arginine. PPDK was then further purified through nickel affinity chromatography and used for further experiments.
SELEX
To perform systematic evolution of ligands by exponential enrichment (SELEX) in vitro we used the basic SELEX protocols using magnetic beads. A protein with a His-tag is attached to the beads and after the incubation of target protein in the aptamer pool we can wash off the residual non-attached oligonucleotide sequences and perform a PCR reaction by loading the beads directly to the PCR mixture. Although the SELEX process itself seemed to be rater simple, we did have to optimise several selection parameters. The PCR reaction only worked when we substituted the TE buffer for water as the aptamer storage solvent, since even minimal amounts of EDTA in the aforementioned buffer tended to prevent Taq polymerase from amplifying the target DNA strands. The magnetic beads themselves also seemed to inhibit the amplification process when it was performed using Taq polymerase, therefore we decided to compare different polymerases and settled on Phusion polymerase, since it displayed the highest reaction efficiency.
Examplery SELEX inputs and outputs by rounds are depicted in table 3.
Round | Input DNA (µg) | Beads + Target structure (µg) (1:1) | Binding Incubation Time (min) | Washing Steps | Number of PCR Cycles | Output - Yield (µg) | Input/Output ratio (I/O) |
---|---|---|---|---|---|---|---|
1 | 29 | 80 | 90 | 1x 500 µl | 12 | 1.816 | 6.3% |
2 | 0.92 | 40 | 60 | 1x 500 µl | 17 | 1.335 | 145.1% |
3 | 0.72 | 40 | 60 | 2x 500 µl | 24 | 0.964 | 134.8% |
4 | 0.82 | 40 | 60 | 2x 500 µl | 20 | 1.096 | 133.2% |
5 | 0.83 | 40 | 60 | 2x 500 µl | 14 | 5.772 | 695.4% |
6 | 0.78 | 40 | 45 | 2x 500 µl | 16 | 4.840 | 622.9% |
7 | 1.50 | 40 | 45 | 2x 1000 µl | 13 | 3.540 | 236.0% |
8 | 1.12 | 40 | 30 | 2x 1000 µl | 18 | 3.236 | 290.2% |
9 | 1.43 | 40 | 30 | 2x 1000 µl | 16 | 3.640 | 254.2% |
10 | 2.37 | 40 | 15 | 2x 1000 µl | 16 | 6.762 | 285.2% |
Emulsion PCR (ePCR)
We found creation of emulsion an easy task, nonetheless few problems occured. Firstly, the initial version of emulsion showed irresistivity for thermal cycling and micelles broke after 15 cycles of PCR, when according to the relevant literature, it was supposed to happen after approximately 30 cycles. For this we tried creating emulsions in colder conditions and by mixing them for longer. None of these strategies showed better results. Additionally, comparison of ePCR and open PCR (oPCR) products was done. In figure X different cycle count was used and from this data we can see that oPCR started generating non-specific fragments after 25 cycles and emulsion PCR lagged at overall production of fragments. What is more, In the end both methods did not create the same fragments.
ePCR v1
We observed produced micelles using fluorescent microscopy (400x Magnification) with purified GFP shown in figures 40 and 41.
Micelles were stable at room temperature while observing them.
ePCR v2
We tested updated composition emulsion and it did not show any signals of breakage even after 50 PCR cycles. The main problem with this is when we want to check nonspecific PCR products in electrophoresis. It is not an easy task to break emulsion with neither 1-butanol, nor isopropanol. However when used in PCR purification kit the emulsion has gone from cloudy to clear from binding buffer and centrifugation at 20.000 rcf.
To recreate both versions of emulsions see instructions in our protocols and materials.
Observations
Distribution among PCR tubes by 50 µl leaves quite visible mineral oil smear on pipette tips. It is better to produce more of the overall mixture for higher yield. As per visual examination emulsion breaks even after 10 cycles of PCR which suggests that different emulsifiers should be used.
Recommendations for future usage
- Prepare 20 percent more overall volume to have desired final reaction coverage.
- Use ABIL EM 90 instead of Span 80 for better emulsion preservation during PCR. Keep in mind that using ABIL EM 90 will require additional materials for emulsion breakage.
- Break emulsions with a binding buffer from your PCR purification kit. To ensure breakage test your kit on sample.
Aptamer Sanger sequencing
6th, 8th and 10th rounds of SELEX were selected for Sanger sequencing of aptamers. PCR products from each round were blunt-end ligated into pUC19 for transformation. Molar ratio of aptamers and vector as 50:1 (aptamers:vector) for more efficient multi insert ligation. Each round was plated on different LB medium plate with ampicillin. 50 colonies from each round were selected for colony PCR and delivered for further direct sequencing. Last round results were aligned by CLUSTAL multiple sequence alignment (MUSCLE 3.8) and with gathered data generated WebLogo with website from University of California, Berkeley.
The results were filtered using Perl scripts from any unspecific fragments, and their frequency was calculated using local BLAST. Consequently, two sequences with the highest frequency are shown in table 4.
No. | Aptamer sequence | Count |
---|---|---|
1 | AGAGTCGGTCGATAGTACTATCGACCGACTCT | 8 |
2 | GAGTCGGTCGATAGTACTATCGACCGACTCT | 4 |
As we saw from sequencing results that aptamer No. 2 is a subsequence of aptamer No. 1. However they have different secondary and tertiary structures. For both of them structures are depicted in figures X and X. Secondary structure was folded using The UNAFold Web Servers mFold application at 20°C. Furthermore, tertiary structures were created using RNAComposer from Vienna formatting. We acknowledge that RNA structure is not the same as DNA, however in previous researches showed that composition of DNA and RNA is highly similar and thus 3D RNA structure can be used as DNA.
Furthermore we decided to check whether our structures are influenced by primer sequences used in SELEX. We added them to sequences as if they were extracted using PCR. Also secondary and tertiary structures were done using previous websites.
No. | Aptamer sequence | Count |
---|---|---|
1.2 | TGACATTGCCACTCTGAACCAGAGTCGGT CGATAGTACTATCGACCGACTCTACTATCGACCGACTCTGATC |
8 |
2.2 | TGACATTGCCACTCTGAACCGAGTCGGTC GATAGTACTATCGACCGACTCTACTATCGACCGACTCTGATC |
4 |
Aptamer NGS sequencing
In order to sequence our aptamers by NGS Illumina MiSeq platform we designed primers for extending aptamers with needed indexes and adapters. Using Illumina Experiment manager we created sample sheet containing crucial instrumental data. All used primers for indexing are uploaded to part registry are shown in table 5.
No | 5' end | 3' end |
---|---|---|
1 | Seq_In_1.1 | Seq_In_2.1 |
2 | Seq_In_1.2 | Seq_In_2.2 |
3 | Seq_In_1.3 | Seq_In_2.3 |
4 | Seq_In_1.4 | Seq_In_2.4 |
5 | Seq_In_1.5 | Seq_In_2.5 |
6 | Seq_In_1.6 | Seq_In_2.6 |
7 | Seq_In_1.7 | Seq_In_2.7 |
8 | Seq_In_1.8 | Seq_In_2.8 |
9 | Seq_In_1.9 | Seq_In_2.9 |
10 | Seq_In_1.10 | Seq_In_2.10 |
All 20 sequences have the same Tm for PCR.
PDA synthesis with aptamers
The first STEP in PDA synthesis is 10,12-Tricosadiynoic acid (TCDA) ester activation with NHS. After that it can react with an amine group and form covalent bond. To recreate both versions of emulsions see instructions in our protocols and materials.
Materials:
Name | M (g/mol) |
---|---|
10,12-Tricosadiynoic acid (TCDA) (91445) | 346.55 |
10,12-pentacosadiynoic acid (PCDA) (76492) | 374.60 |
N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC-HCl) (E6383) | 191.70 |
Ethanolamine (411000) | 61.08 |
N-hydroxysuccinimide (NHS) (130672) | 115.09 |
Methylene chloride (Dichloromethane - DCM) | - |
Dimethyl-2-(dimethylphosphino)ethylphosphine (DMPE) | 150.14 |
After dissolving the final fatty acid and aptamer conjugated compounds mixture in chloroform PVDF membrane was dipped 3 times into it and dried between each immersion. Finally the membrane was dried thoroughly and placed under direct UV light (254 nm) for 1 minute. The end product is a blue colored PDA inside of PVDF.
For further testing aptamers
Anti-HSA aptamer with PDA
In aptamer database we found a sequence for human serum albumin (HSA) and ordered it with amine modification on 5’ end of ssDNA. Overall sequence and secondary structure is shown in figure 50.
It was tested in conjugation with PDA and showed positive results. Both negative control (non-native BSA) and distilled water did not show color change. From this we can say that the chosen anti-HSA aptamer is specific and suitable for diagnostic test as positive blood control.
Anti-PPDK aptamer with PDA
Results from Sanger sequencing suggested us to order specific aptamers with amine modified 5’ end for coupling with TCDA. Both aptamer and aptamer with primer sequences were coupled and polymerized. The reaction with pyruvate phosphate kinase solution showed positive results as well as reaction with control buffer and bovine serum albumin. No visual difference was seen.
For more detailed control reactions water and ethanol were chosen. Both of them showed positive results. Color developed on PDA by ethanol was different from those with water based solutions - a little bit on the darker side with a pinch of brown discoloration (figure 51. spot 5).
In our case we think that evolutionized and sequenced aptamers that were synthesized for polymerization do not meet criteria needed for positive selection of PPDK. Further analysis of SELEX sequences should be done.
IT aptamer evaluation
We evaluated the affinity of the first three neural network model (TEA) generated sequences with aptamer-based Western blot. For each target protein four cases were studied: the first one - a control, for which the protein of interest was taken without any aptamer and other three cases for each of the chosen aptamer from the list.
We did not observe any significant signal in the blot with albumin aptamers, although there was a rather bright band at the position of 100 kDa for the first and second aptamer of EhPPDK, which might indicate interaction between the aptamer and the protein. Due to the lack of time, we could not investigate aptamer binding affinity by applying another method. In order to make more confident statements about TEA's ability to produce affine aptamer sequences, more target cases should be studied, different scoring functions and different validation methods should be applied.