Protein Expression:

In this part of the project, we wanted to express and purify plant proteins to use them as targets for the protein-SELEX process. This was necessary as not purifying the proteins can lead to a lot of background noise1. It is also crucial to reach certain target concentrations required for efficient SELEX2. At this point in the project, we still planned to use Arabidopsis thaliana proteins with a pathogen-induced expression pattern as detection targets for our lateral flow assay. The expression was always meant to be a proof of concept, as we already had to establish SELEX in parallel due to time constraints. But despite that we still wanted to show that expressing the correct proteins ourselves was possible. Our original candidates were PR1, FKBP65, ROC3, and UGT74F2 but after some feedback on their expression patterns, we removed FKBP65 and ROC3 from our list. Instead, we added F6'H1, PAD3, and FMO1 as additional candidates.

We chose to express our proteins in E. coli. The cloning was done in the MACH1 strain We used the standard vector pET21a(+) for all of our cloning. This vector also includes a poly-His tag which we wanted to use for purification later on. To receive the genes for our candidate proteins we extracted cDNA from Col-0 Arabidopsis thaliana plants. This cDNA was used as a template for PCR to amplify the target genes. By designing primers with overhangs we introduced restriction enzyme cutting sites for later cloning steps.

We had some trouble achieving high DNA yields with this method, so we tried switching to Gibson assembly for the two candidates PR1 and UGT74F2. The primers used were:

The PCR was followed up by a gel electrophoresis, where we could only confirm amplification of UGT74F2.

Figure 1: DNA-gel showing the amplification of UGT74F2 in the preceding PCR. The band can be observed at roughly 1400 bp, just as expected from UGT74F2. PR1 didn't show any amplification. The ladder used is a GeneRulerTM 1kb DNA ladder from Thermo ScientificTM.

As we only needed one protein for our SELEX process we continued to work with UGT74F2 and didn't further pursue cloning for the other candidates.. UGT74F2 was inserted into pET21a+ by Gibson assembly. We confirmed whether the gene was inserted properly by colony PCR and subsequent sequencing. We used the T7 promoter forward primer: "CGCGAAATTAATACGACTCAC" and the T7 terminator reverse primer: "GCTAGTTATTGCTCAGCGG" for both applications. Both methods showed that the insertion worked. We then transformed Rosetta E. coli cells with our pET21a+_UGT74F2-construct. Rosetta cells are designed to enhance the expression of eukaryotic proteins and are suitable for induction with IPTG. A Coomassie-stained SDS gel showed a strong expression of a protein with a size of roughly 50 kDa, just what we expected from UGT74F2. This protein can only be observed after induction with IPTG.

Figure 2: Coomassie-stained SDS gel of *E. coli* cell extract from before and after the induction with IPTG. After the induction there is a clear band at roughly 50 kDa, which is the size we expect UGT74F2 to have. The ladder is a PageRulerTM Plus Prestained protein ladder from ThermoScientificTM.

These results show our successful expression of UGT74F2. Unfortunately, we were not able to detect the protein on a subsequent Western Blot with anti-His-tag-antibodies. This missing His-tag-binding is probably what also caused us to fail with the His-tag purification of our protein. But with this expressed protein, protein-SELEX would have been possible. It was our first big success on our way to a functioning test.

At this point in the project, we switched from protein- to cell-SELEX due to new insights from experts, meaning we didn't need purified proteins anymore. We therefore stopped experimenting on this subproject. For us it still serves as a proof of concept that expressing the proteins as targets for SELEX ourselves is possible.

The following parts were used during the protein expression:

RUBY - Test of a newly developed noninvasive reporter system

Reporter genes are frequently used to monitor cellular activity, localize proteins, or visualize gene expression8. Yet many of the presently used ones are limited due to the requirement of expensive equipment, a sterile working environment or the sacrifice of plant material8. In our project we tested the efficiency of the recently developed RUBY reporter system, which has been reported to be noninvasive and easy-to-use 8. We implemented the reporter system in our constructs for a better assessment of the health status of plants regarding pathogenic stress. Depending on the chosen promoter, the results of these studies can inform the choice of potential targets for protein SELEX.

The RUBY reporter codes for three enzymes which catalyze the conversion of tyrosine to betalain, a pigment that is visible to the naked eye. The enzymes needed for its synthesis in plants are P450 oxygenase CYP76AD, L-DOPA 4,5-dioxygenase and a glucosyltransferase. 8

The first step for the biosynthesis of betalain is the hydroxylation of tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA). This reaction is catalysed by the P450 oxygenase CYP76AD1. L-DOPA is then further oxidized into cyclo-DOPA by CYP76AD1. This reaction can also be catalyzed by L-DOPA 4,5-dioxygenase which results in betalamic acid. Lastly, betalamic acid is condensed with cyclo-DOPA into betanidin. This pigment can be used as a selection marker to monitor cellular activity and has been successfully used in both rice and Arabidopsis thaliana. 8

In our work, two constructs containing the RUBY reporter were designed. The first construct contained the pathogenesis-related gene promoter 1 (PR1), the RUBY reporter and the native Arabidopsis thaliana HSP18.2 terminator.

Figure 3: PR1_RUBY in the B415p9o vector. The red feature shows the PR1 insert and the 3 features following are the genes coding for the enzymes required for the synthesis of betalain.

The second construct was used as a control. It consisted of the constitutive A. thaliana P35S promoter, the RUBY reporter and the native Arabidopsis thaliana HSP18.2 terminator. This construct was used to assess the functionality of the newly developed reporter gene in Arabidopsis thaliana.

Figure 4: Control construct consisting of the P35S_RUBY in the B415p9o vector. The grey feature shows the P35S insert and the 3 features following are the genes coding for the enzymes required for the synthesis of betalain.

The methods and primers used for this work can be found in the following link Ampelpflanze .

Transformation of Arabidopsis thaliana with the control construct (figure 4) induced a change of the coloration of the whole plant. This proved that the RUBY gene cassette was functional and capable of inducing the synthesis of betalain (figure 5). 8

Figure 5: Control construct consisting of the P35S_RUBY in the B415p9o vector. The grey feature shows the P35S insert and the 3 features following are the genes coding for the enzymes required for the synthesis of betalain.

Figure 6: Control construct consisting of the P35S_RUBY in the B415p9o vector. The grey feature shows the P35S insert and the 3 features following are the genes coding for the enzymes required for the synthesis of betalain.

The T1 seeds presented a red coloration as expected.

Figure 7: The difference in color between A. thaliana wildtype (left) and with RUBY construct transformed (right) seeds. The RUBY seeds show a red color.

The red color of the seeds indicates that the transformation has been successful. This is a first step to verifying the functionality of our reporter system. The next step would be planting the seeds and observing the color of the seedlings. Our Test of the non-invasive reporter shows an adequate proof-of-concept.

Pathogen Forecast

In order to help people understand and evaluate the risks of pathogens, we would like to introduce a pathogen forecast system.

Prototype of a pathogen forecast website

As of now it is just a design prototype in which we mixed in our pathogen map prototype (pathogen simulator).

References

1. Komarova, N., & Kuznetsov, A. (2019).

   Inside the Black Box: What Makes SELEX Better?.

   Molecules 24(19), 3598.

   CrossRefGoogle ScholarBack to text

2. Levine, H. A., & Nilsen-Hamilton, M. (2007).

   A mathematical analysis of SELEX.

   Computational Biology and Chemistry 31(1), 11-35.

   CrossRefGoogle ScholarBack to text

3. Locus: AT2G14610. Arabidopsis.org.

   (October 2, 2021). Retrieved on October 11, 2021. from https://www.arabidopsis.org/servlets/TairObject?name=AT2G14610&type=locus

   Back to text

4. Azevedo, C., Betsuyaku, S., Peart, J., Takahashi, A., No l, L., Sadanandom, A., ... & Shirasu, K. (2006).

   Role of SGT1 in resistance protein accumulation in plant immunity.

   The EMBO Journal 25(9), 2007-2016.

   CrossRefGoogle ScholarBack to text

5. Gechev, T., Minkov, I., & Hille, J. (2005).

   Hydrogen Peroxide-induced Cell Death in Arabidopsis: Transcriptional and Mutant Analysis Reveals a Role of an Oxoglutarate-dependent Dioxygenase Gene in the Cell Death Process.

   IUBMB Life (International Union of Biochemistry and Molecular Biology: Life) 57(3), 181-188.

   CrossRefGoogle ScholarBack to text

6. B ttcher, C., Chapman, A., Fellermeier, F., Choudhary, M., Scheel, D., & Glawischnig, E. (2014).

   The Biosynthetic Pathway of Indole-3-Carbaldehyde and Indole-3-Carboxylic Acid Derivatives in Arabidopsis .

   Plant Physiology 165(2), 841-853.

   CrossRefGoogle ScholarBack to text

7. Hartmann, M., Zeier, T., Bernsdorff, F., Reichel-Deland, V., Kim, D., Hohmann, M., ... & Zeier, J. (2018).

   Flavin Monooxygenase-Generated N-Hydroxypipecolic Acid Is a Critical Element of Plant Systemic Immunity.

   Cell 173(2), 456-469.e16.

   CrossRefGoogle ScholarBack to text

8. He, Y., Zhang, T., Sun, H., Zhan, H., & Zhao, Y. (2020).

   A reporter for noninvasively monitoring gene expression and plant transformation.

   Horticulture Research 7(1).

   CrossRefGoogle ScholarBack to text