Line 389: | Line 389: | ||
<h4> Kill-switch | <h4> Kill-switch | ||
</h4> | </h4> | ||
− | <p> | + | <p>VapXD kill-switch accuracy was firstly evaluated with a serial dilution spotting method. Sets of agar plates with and without bile salts were incubated in different temperatures of 37 °C, 30 °C, and room temperature (24 |
°C). However, the distinction between plates with and without bile salts supplementation was only seen at room temperature (figures X and X). | °C). However, the distinction between plates with and without bile salts supplementation was only seen at room temperature (figures X and X). | ||
</p> | </p> | ||
Line 400: | Line 400: | ||
<p><i>VapXD system without promoter before toxin – K, bile-regulated and cold-inducible VapXD kill-switch marked as 1, Bile-regulated and p-slpA VapXD kill-switch - 2, bile-regulated and J23101 VapXD kill-switch - 3, bile-regulated and J23106 VapXD kill-switch - 4, bile-regulated and J23101 VapXD kill-switch - 5.</i> | <p><i>VapXD system without promoter before toxin – K, bile-regulated and cold-inducible VapXD kill-switch marked as 1, Bile-regulated and p-slpA VapXD kill-switch - 2, bile-regulated and J23101 VapXD kill-switch - 3, bile-regulated and J23106 VapXD kill-switch - 4, bile-regulated and J23101 VapXD kill-switch - 5.</i> | ||
</p> | </p> | ||
− | <p | + | <p>Results showed bile-regulated and cold-inducible VapXD kill-switch and bile-regulated and p-slpA VapXD kill-switch work on agar plates at room temperature, as with lower OD<sub>600</sub> values they inhibited cell growth. |
</p> | </p> | ||
− | <p> | + | <p>Further VapXD kill-switch performance was tested in liquid medium, as OD<sub>600</sub> measurements were performed. First of all, VapD toxin (<a href="http://parts.igem.org/Part:BBa_K3904000" target=”_blank”>BBa_K3904000</a>) activity was characterized |
while regulating its production with cold-induced promoter (<a href="http://parts.igem.org/Part:BBa_K3904003" target=”_blank”>BBa_K3904003</a>). Graphs at the top of figure X illustrate bacteria growth without toxin and graphs | while regulating its production with cold-induced promoter (<a href="http://parts.igem.org/Part:BBa_K3904003" target=”_blank”>BBa_K3904003</a>). Graphs at the top of figure X illustrate bacteria growth without toxin and graphs | ||
− | at the bottom with toxin in different temperatures. While comparing obtained data in 37 and 24 | + | at the bottom with toxin in different temperatures. While comparing obtained data in 37 and 24 °C, temperature change can be seen as inducing greater toxin production and cell death. On the other hand, VapX activity |
− | is not fully accurate due to the leakage of the promoter. | + | is not fully accurate due to the leakage of the promoter during the temperature change from 37 to 24 °C. |
</p> | </p> | ||
<div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/6/62/T--Vilnius-Lithuania--vapxd-1.png" /> | <div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/6/62/T--Vilnius-Lithuania--vapxd-1.png" /> | ||
<div> <b> Fig. X. </b> VapD toxin (<a href="http://parts.igem.org/Part:BBa_K3904000" target=”_blank”>BBa_K3904000</a>) characterization.</div> | <div> <b> Fig. X. </b> VapD toxin (<a href="http://parts.igem.org/Part:BBa_K3904000" target=”_blank”>BBa_K3904000</a>) characterization.</div> | ||
</div> | </div> | ||
− | <p> | + | <p>What is more, VapXD with the bile-induced promoter before antitoxin and with the cold-induced promoter before toxin was characterized. Graphs in the top of X figure demonstrate bacteria growth with and without bile salts supplementation |
− | in media at 24 | + | in media at 24 °C, as graphs in the bottom at 37 °C. It can be seen that OD<sub>600</sub> in the presence of bile salts and 37°C bacteria grow more exponentially than without bile salts and in 24 °C. In the ideal |
− | case, no antitoxin should be produced in the absence of bile salts and 24 | + | case, no antitoxin should be produced in the absence of bile salts and 24 °C, and toxin synthesis should be induced. However, the results indicate that in such conditions, bacteria growth is only slightly repressed. |
</p> | </p> | ||
<div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/d/d2/T--Vilnius-Lithuania--vapxd-2.png" /> | <div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/d/d2/T--Vilnius-Lithuania--vapxd-2.png" /> | ||
<div> <b> Fig. X. </b> Cold-shock promoter (<a href="http://parts.igem.org/Part:BBa_K3904003" target=”_blank”>BBa_K3904003</a>) activity comparison in different temperatures and with/without bile salts.</div> | <div> <b> Fig. X. </b> Cold-shock promoter (<a href="http://parts.igem.org/Part:BBa_K3904003" target=”_blank”>BBa_K3904003</a>) activity comparison in different temperatures and with/without bile salts.</div> | ||
</div> | </div> | ||
− | <p>When results in 37 | + | <p>When results in 37 °C obtained with different OD<sub>600</sub> values were averaged (Fig. X. Mean comparison with/no bile 37 °C), the difference between measurements with and without bile salts appeared to be mathematically |
insignificant. | insignificant. | ||
</p> | </p> | ||
<div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/7/7e/T--Vilnius-Lithuania--vapxd-3.png" /> | <div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/7/7e/T--Vilnius-Lithuania--vapxd-3.png" /> | ||
− | <div> <b> Fig. X. </b> Cold-shock promoter (<a href="http://parts.igem.org/Part:BBa_K3904003" target=”_blank”>BBa_K3904003</a>) comparison with and no bile salts in 37 | + | <div> <b> Fig. X. </b> Cold-shock promoter (<a href="http://parts.igem.org/Part:BBa_K3904003" target=”_blank”>BBa_K3904003</a>) comparison with and no bile salts in 37 °C.</div> |
</div> | </div> | ||
− | <p> | + | <p>The activity of different promoters before VapX toxin was compared without bile salts supplementation in media at 37 °C. From promoters’ strength evaluation measurements (fig. X), it was seen that the p-slpA promoter |
( | ( | ||
<a href="http://parts.igem.org/Part:BBa_K3904228" target=”_blank”>BBa_K3904712</a>) is the strongest in our inventor. VapXD assessment also showed that under this promoter, toxin production is more significant than under other | <a href="http://parts.igem.org/Part:BBa_K3904228" target=”_blank”>BBa_K3904712</a>) is the strongest in our inventor. VapXD assessment also showed that under this promoter, toxin production is more significant than under other | ||
− | promoters. The sloping graph rise illustrates this because more toxin is produced, and bacteria growth is inhibited. However, after the results were averaged, no significant difference between different promoters was seen | + | promoters. The sloping graph rise illustrates this because more toxin is produced, and bacteria growth is inhibited. However, after the results were averaged, no significant difference between different promoters was seen. |
</p> | </p> | ||
<div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/7/7d/T--Vilnius-Lithuania--vapxd-4.png" /> | <div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/7/7d/T--Vilnius-Lithuania--vapxd-4.png" /> | ||
− | <div> <b> Fig. X. </b> Comparison of VapXD kill-switch with different promoters before toxin (without bile salts in 37 | + | <div> <b> Fig. X. </b> Comparison of VapXD kill-switch with different promoters before toxin (without bile salts in 37 °C).</div> |
</div> | </div> | ||
− | <p>While comparing results with different promoters in 24 | + | <p>While comparing results with different promoters in 24 °C no significant difference can be seen (fig. X). |
</p> | </p> | ||
<div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/e/ed/T--Vilnius-Lithuania--vapxd-5.png" /> | <div class="figure-container"> <img alt="" src="https://static.igem.org/mediawiki/2021/e/ed/T--Vilnius-Lithuania--vapxd-5.png" /> | ||
− | <div> <b> Fig. X. </b> Comparison of VapXD kill-switch with different promoters before toxin (without bile salts in 24 | + | <div> <b> Fig. X. </b> Comparison of VapXD kill-switch with different promoters before toxin (without bile salts in 24 °C).</div> |
</div> | </div> | ||
− | <p> | + | <p>Furthermore, we successfully inserted the VapXD system construct into <i>E. coli</i> Nissle 1917 genome (fig. X, fig. X). Both of these VapXD systems constructs have been inserted into the <i>E. coli</i> Nissle 1917 genome with 100 |
% efficiency and proved by DNA sequencing. | % efficiency and proved by DNA sequencing. | ||
</p> | </p> |
Revision as of 00:14, 22 October 2021
RESULTS
Prevention
Reconstruction of shuttle vector
For the construction of the naringenin synthesis cassette that would effectively work in both Escherichia coli Nissle 1917 and Lactobacillus casei BL23, we chose to use the pTRKH2 shuttle vector. However, to construct a pTRKH2 vector that would fit all our desired inserts, we needed to modify it by changing the plasmid’s original multi-cloning site (MCS), this was done by amplifying pTRKH2 vector with MCS deletion primers in PCR reaction (Fig. X), and simultaneously generating the new MCS site containing required sticky ends by annealing four oligonucleotide sequences. Afterwards, the linear pTRKH2 plasmid lacking the old MCS sequence was ligated together with the new MCS sequence and verified by restriction analysis (Fig. X).
Promoter characterization
To assure the most efficient possible naringenin production pathway, we had to select the most suitable promoters for the expression of naringenin synthesis genes. Before the actual experiments, we optimized our measurement condition with an iGEM measurement kit according to the standard protocol. This optimization allowed choosing the most appropriate gain settings in the plate reader and standardizing our results. This was done by evaluating superfolder green fluorescent protein (sfGPF) expression rates under the promoters of interest and dividing the intensiveness of the signal by the OD600 of the medium during the course of 6 hours. The data showed that (Fig. X).
The generalized data has shown that surface layer protein A promoter (p-splA) and BBa_1033225 (CP44) promoter demonstrates the greatest expression strength among all investigated sequences, since it displays the significantly higher fluorescence to OD600 ratio over the course of the whole experiment as well as similar acceleration and velocity dynamics (Fig.X).
Evaluation of transcription efficiency dependency on E. coli Nissle 1917 genomic site
We seek to create naringenin producing probiotics. For this reason, we decided to insert naringenin metabolic pathway encoding genes into E. coli Nissle 1917 genome. This experimental decision helps to overcome the problem of additional antibiotic usage, reduce the fluctuations gained because of unstable plasmid copy numbers in cells. Furthermore, metabolic pathway genomic insertion helps to overcome horizontal gene transfer problem. This is particularly important as probiotics interact with a huge variety of microorganisms in our intestine and together have an impact on our metabolism. Firstly, to measure the transcription activity from two genomic regions, we have inserted sfGFP into colicin and nupG genes (fig. X, X) and compared the amount of fluorescence (fig. X). As we can see in fig. X, GFP insertion into colicin gene has been successful with 89 % efficiency and GFP insertion into nupG gene a bit lower (fig. X).
mRNA cyclization performance in our system was evaluated by measuring the fluorescence/OD600 ratio of bacteria with pTRKH2+TAL-sfGFP and pTRKH2+loop+TAL-sfGFP plasmids. It was noticed that this system did not work as expected and did not increase protein production. For detailed results and their analysis go to the Measurement page.
GFP expression in L. paracasei BL23
After promoters evaluation in E. coli DH5 alpha strain and finding out that PslpA promoter, which is constitutive L. paracasei promoter, shows the highest transcriptional activity compared to other evaluated promoters, we decided to insert sfGFP construct under PslpA control into L. paracasei BL23 genome. For this reason we have inserted sfGFP coding gene into pLCNICK plasmid and placed it under transcriptional control of PslpA promoter. This new plasmid has been obtained by digestion of pLCNICK with BglI and BshTI restriction endonucleases and ligation with sfGFP construct. GFP insertion into pLCNICK plasmid has been validated by restriction analysis of pLCNICK harboring E. coli DH5 alpha transformants and their produced fluorescence detection (fig. X).
mRNA cyclization system evaluation
During the same set of experiments as for promoter characterization, mRNA cyclization (BBa_K3904217) performance was tested in our system.
At first, the fluorescence of E. coli Nissle 1917 bacteria containing pTRKH2+sfGFP and pTRKH2+loop+sfGFP plasmids with different promoters was measured.
Since mRNA cyclization system performance was not as expected, we did a deeper analysis of the reference article [15] and decided to repeat the experiment while using longer sequence protein TAL fused with sfGFP. What is more, these measurements were conducted in E. coli DH5alpha and at different temperatures of 37 °C and 24 °C, since during the construction of mRNA cyclization system, we noticed that it kind of activates and begins to fluorescent after incubation at the room temperature.
Each experiment had three controls: positive – fluorescent E. coli DH5a with J23101 Anderson promoter, negative – non-fluorescent bacteria, contamination – media with an antibiotic.
In the X figure, one can see that there is no significant difference in the mRNA cyclization performance in 37 °C and 24 °C because the shift of the curves is only affected by the lower OD600 values in 24 °C. The bottom graph illustrates averaged data at 37 °C. Interestingly, it was noticed that mRNA cyclization does not allow the accumulation of the sfGFP protein. After some time, the system reaches equilibrium, and the fluorescence/OD600 ratio stabilizes.
Conclusions
One of our chosen protein synthesis enhancing mechanisms - mRNA cyclization - appeared not to work as expected and described in the Yang et al. article [15]. In our case, it did not increase protein production. Interestingly, protein quantity stabilization was noticed as a novel property of this system and may be further tested.
Metabolic pathway construction
To construct the pTRKH2 vector containing all four genes of the naringenin metabolic pathway we amplified pTRKH2 vector and all four naringenin synthesis genes using primers that contain specific restriction endonuclease recognition sites. This way we should have been able to digest each sequence with appropriate restriction enzymes and create a library of inserts with sticky ends, that can be ligated into the target vector as the ending part of composite insert or as a part of the whole naringenin synthesis cassette. However, we were only able to construct plasmids containing only TAL and TAL+4CL, cassettes that later were found to have been mutated by Sanger sequencing.
To get the construct containing all four genes we chose the strategy of Gibson assembly. By amplifying the pTRKH2 vector and all naringenin synthesis genes with primers containing flanking regions that form homologous pairs with each other in the manner that a complete naringenin synthesis cassette should be constructed in a single tube reaction. Nevertheless, we were not able to obtain the desired construct.
Endogenous metabolism modulation toward enhanced naringenin synthesis
Furthermore, to enhance naringenin synthesis in E. coli Nissle 1917 we have created ackA-pta double knockout. Firstly, we knockouted ackA (fig. X), and pta (fig. X) genes separately with 100 % and 60 % efficiency, respectively. Later on, we used ackA knockout to generate ackA-pta double knockout (fig. X) with 80 % efficiency. For further experiments used ackA knockout have been verified by ackA gene sequencing.
Our next move was to create tyrP knockout. Firstly, we have successfully obtained tyrP knockout (fig. X).
However, we have not succeeded in creating double or triple knockouts (ackA-tyrP or ackA-pta-tyrP). As you can see in the fig. X, restriction of cPCR product from randomly selected transformants do not show genomic modification in the tyrP gene. Interestingly, in the positive control line we can see very large DNA fragment (> 10 kbp). We could not explain this result without additional genomic analysis.
We have repeated PCR from previously obtained tyrP knockouts and all knockouts had this one sharp fragment above 10 kbp ladder line (fig. X). These surprising results might be obtained because of some unknown genomic reorganization of edited genomic locus. The exact reorganization output can be determined by genome sequence which was not in our focus. As we seek to avoid usage of undetermined changes containing E. coli Nissle 1917 strain, we decided to do not use tyrP knockout in further experiments. In addition, we do not succeed in obtaining adhE gene knockout even after testing two different sgRNAs.
Naringenin evaluation
To evaluate the quantity of synthesis by our constructs/enzymes, we employed HPLC-MS to find naringenin and intermediate compounds. All enzymes were subjected to analysis first by themselves and further in different combinations. Both control for native cellular metabolism and with additional substrates were taken into account.
First, we created control chromatograms for naringenin and first enzymatic intermediate - p-coumaric acid (product of Tyrosine ammonia lyase (TAL) from naringenin synthesis pathway). By dissolving technical grade compounds in pure water we found retention times:
Naringenin | p-coumaric acid |
---|---|
6.88 min | 6.17 min |
This information enabled us to search for compounds in more complex mixtures, in particular LB medium from overnight cultures. Furthermore, we were able to distinguish our products based on retention time, m/z and UV-Vis absorption spectrum.
Using the HPLC-MS method we analyzed the media samples of cultures containing pTRKH2 vectors with TAL gene and J23101 Anderson or surface layer protein A (slpA) promoters. The data of the experiments showed that plasmid with J23101 Anderson promoter and TAL encoding sequence determines an efficient synthesis of p-coumaric acid in our transformants, nevertheless analogous process has not been identified in the samples containing slpA promoter. We hypothesized that the reason for this data non-reproducibility may be a possible mutation in pTRKH2 vector containing slpA promoter, the hypothesis later was approved by Sanger sequencing.
Similar intermediate compound detection strategy was applied for constructs containing 4CL and CHS encoding sequences. We supplied cultures with p-coumaric acid as a substrate for their specific reactions and used HPLC-MS method to detect the consumption of p-coumaric acid. The experiments were conducted with cultures containing pTRKH2 vectors with 4CL gene and J23101 Anderson or slpA promoters, as well as linked (linkers: GSG, GGGGS, (GGGGS)2, (GGGGS)3, EAAAK, (EAAAK)2, (EAAAK)3) 4CL and CHS genes under the same promoters. However, none of the aforementioned constructs have been found to demonstrate distinct enzymatic activity by consummation of the given substrate.
In the hopes of finding further intermediates we searched for a few additional m/z as a result of accumulation. p-coumaroyl-CoA and naringenin chalcone were chosen as the ones who could give us more information. However, fusion protein samples did not show any signs of naringenin chalcone. Moreover, we found the same m/z of p-coumaroyl-CoA in both control and sample from the desired construct medium when supplied with additional p-coumaric acid. This suggested to us that we could not precisely determine the quantity of synthesized p-coumaroyl-CoA because we do not know detailed information about internal processes. We hypothesize that control E. coli DH5α has 4CL homology enzymes for forming carbon-sulfur bonds as acid-thiol ligases and thus synthesis of p-coumaroyl-CoA by both recombinant and native enzymes overshadow one another. We even cannot be sure about synthesis of a particular compound because it needs further analysis by NMR as chromatograms and UV-Vis spectrum lack structural information.
Detailed reports from HPLC-MS are referred to in table X.
Name | Description | File |
---|---|---|
Technical grade p-coumaric acid | Technical grade p-coumaric acid was dissolved in water for reference chromatogram and other specifications. | Download |
TAL1 lysate | First enzyme Tyrosine ammonia lyase (TAL) in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. Culture was lysed to check for compounds inside cells. | Download |
TAL1 LB medium | First enzyme Tyrosine ammonia lyase (TAL) in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. Only LB medium was subjected to HPLC-MS analysis. | Download |
DH5alpha with p-coumaric acid | Only DH5alpha without any plasmid cells were grown in LB medium with supplied p-coumaric acid. | Download |
LB with p-coumaric acid | LB medium with p-coumaric acid. | Download |
LB without p-coumaric acid | LB medium without p-coumaric acid. | Download |
GS1 LB medium without p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid without supplied p-coumaric acid to LB medium. | Download |
GS1 lysate with p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid without supplied p-coumaric acid to LB medium. | Download |
GS1 lysate with p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid without supplied p-coumaric acid to LB medium. | Download |
GS1 LB medium with p-coumaric acid | Fusion protein (4CL and CHS) construct with GGGGS linker in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. | Download |
GSG LB medium with p-coumaric acid | Fusion protein (4CL and CHS) construct with GSG linker in pTRKH2 plasmid with supplied p-coumaric acid to LB medium. Culture was lysed to check for compounds inside cells. | Download |
Naringenin | Technical grade naringenin dissolved in distilled water. | Download |
Genome
In parallel, we have also introduced linked 4CL-CHS and CHI (5th mutant) encoding genes into the E. coli Nissle 1917 genome (fig. X, X). cPCR of transformants probably containing TAL encoding gene in the colicin gene has not shown clear results as additionally to the expected 1.7 kp band there were and two a bit smaller bands. For this reason, we conducted enzymatic activity measurement by identifying p-coumaric acid appearance in growth medium in order to validate TAL encoding gene insertion into E. coli Nissle 1917 genome.
As we have identified TAL enzymatic activity in previous experiments, we measured TAL enzymatic activity, where TAL encoding gene is inserted into E. coli Nissle 1917 genome. …..REZULTATAI…… Secondly, we decided to measure linked 4CL-CHS proteins enzymatic activity after insertion into genomic DNA of E. coli Nissle 1917……..REZULTATAI…..
Finally, we have grown cocultures composed of wild type Nissle producing TAL, ackA-pta double Nissle knockout producing linked 4CL-CHS enzymes and wild type Nissle producing CHI. After 48 hours cocultures inoculation in LB medium at 37°C HPL-MS measurement has been done . As we see in fig. X, …..RESULTATAI……….
Kill-switch
VapXD kill-switch accuracy was firstly evaluated with a serial dilution spotting method. Sets of agar plates with and without bile salts were incubated in different temperatures of 37 °C, 30 °C, and room temperature (24 °C). However, the distinction between plates with and without bile salts supplementation was only seen at room temperature (figures X and X).
VapXD system without promoter before toxin – K, bile-regulated and cold-inducible VapXD kill-switch marked as 1, Bile-regulated and p-slpA VapXD kill-switch - 2, bile-regulated and J23101 VapXD kill-switch - 3, bile-regulated and J23106 VapXD kill-switch - 4, bile-regulated and J23101 VapXD kill-switch - 5.
Results showed bile-regulated and cold-inducible VapXD kill-switch and bile-regulated and p-slpA VapXD kill-switch work on agar plates at room temperature, as with lower OD600 values they inhibited cell growth.
Further VapXD kill-switch performance was tested in liquid medium, as OD600 measurements were performed. First of all, VapD toxin (BBa_K3904000) activity was characterized while regulating its production with cold-induced promoter (BBa_K3904003). Graphs at the top of figure X illustrate bacteria growth without toxin and graphs at the bottom with toxin in different temperatures. While comparing obtained data in 37 and 24 °C, temperature change can be seen as inducing greater toxin production and cell death. On the other hand, VapX activity is not fully accurate due to the leakage of the promoter during the temperature change from 37 to 24 °C.
What is more, VapXD with the bile-induced promoter before antitoxin and with the cold-induced promoter before toxin was characterized. Graphs in the top of X figure demonstrate bacteria growth with and without bile salts supplementation in media at 24 °C, as graphs in the bottom at 37 °C. It can be seen that OD600 in the presence of bile salts and 37°C bacteria grow more exponentially than without bile salts and in 24 °C. In the ideal case, no antitoxin should be produced in the absence of bile salts and 24 °C, and toxin synthesis should be induced. However, the results indicate that in such conditions, bacteria growth is only slightly repressed.
When results in 37 °C obtained with different OD600 values were averaged (Fig. X. Mean comparison with/no bile 37 °C), the difference between measurements with and without bile salts appeared to be mathematically insignificant.
The activity of different promoters before VapX toxin was compared without bile salts supplementation in media at 37 °C. From promoters’ strength evaluation measurements (fig. X), it was seen that the p-slpA promoter ( BBa_K3904712) is the strongest in our inventor. VapXD assessment also showed that under this promoter, toxin production is more significant than under other promoters. The sloping graph rise illustrates this because more toxin is produced, and bacteria growth is inhibited. However, after the results were averaged, no significant difference between different promoters was seen.
While comparing results with different promoters in 24 °C no significant difference can be seen (fig. X).
Furthermore, we successfully inserted the VapXD system construct into E. coli Nissle 1917 genome (fig. X, fig. X). Both of these VapXD systems constructs have been inserted into the E. coli Nissle 1917 genome with 100 % efficiency and proved by DNA sequencing.
VapXD kill-switch inserted in E.coli Nissle 1917 genome was also characterized by OD600 measurements. The results of the genomic construct were compared to the plasmid construct.
The first observation from fig. X was that bacteria containing construct in the genome grow more exponentially. It does not have to maintain antibiotic resistance and the burden for the cell lowers.As shown in fig. X no significant difference in the VapXD kill-switch performance was seen while comparing results of the genomic and plasmid constructs with the same promoters.
While comparing results obtained during the measurements with and without bile salts (fig. X), no significant difference was seen. This once again indicates promoter leakage and the system's inaccuracy.
Detection
Entamoeba histolytica recombinant protein synthesis
In order obtain our aptamers through the SELEX process we first needed to produce recombinant Entamoeba histolytica proteins - pyruvate, phosphate dikinase (PPDK)[6] and cysteine proteinase 5 (CP5) [7]. The synthesised CP5 gene was cloned into a pET-28a(+) vector plasmid which is used to tag proteins with a histidine tag on both C and N terminus. The PPDK gene was first cloned into a pET-28a(+) we modified to not contain extra amino acids before the histidine tags but the constructs kept mutating so we decided to clone it into the default pET-28a(+) plasmid to keep the chance of mutation to a minimum. The conditions of biomass growth were similar for both proteins, the induction was carried out in the BL21 strain of E. coli for 3 hours in 37°C with a concentration of 0.6 mM IPTG for CP5 and 1 mM for PPDK. The bacteria containing the PPDK plasmid also needed to be grown in TB medium while the CP5 containing bacteria could be grown in simple LB medium[8, 9].
Since an active protease would lyse our cells the CP5 gene contains an inactive and insoluble pro-enzyme that has an N-terminal pro-sequence that can be cut off by the enzyme itself. The purification of CP5 was supposed to be done in three distinct steps: denaturation, renaturation and activation. This strategy failed because the whole process itself was too costly as there were too many steps and the yield of the protein was too low. We could only see the same pro-enzyme band in the SDS gel after the final step, but we think that the most important step in the purification is the ratio between the protein and the refolding buffer because we found different methods of refolding where the ratio ranged from 1:100 to a 1:1000 [7, 8] and that is the only thing we could not check as we could not manage to concentrate the protein again from a volume this large.
Since we could not purify the active and soluble protein we had to find a way to stabilise the denatured protein in a buffer suitable for aptamer selection i.e. without urea or other strong denaturants. We tried out several compounds[10] with protein stabilising potential and discovered that denatured CP5 pro-enzyme is stabilised by CuCl2. unfortunately, the stabilising effect was not as big as we hoped and there was not enough of the protein in our soluble fraction to use for our downstream SELEX process.
Although we failed to produce the CP5 protein, we still had chosen another biomarker - pyruvate, phosphate dikinase (PPDK). The purification of this protein was supposed to be much simpler based on the literature[9], but we faced the same problems here too. Although we found some of our target protein in the soluble fraction, the amount was miniscule compared to what we needed to evolve the aptamers. It seemed like it also formed insoluble inclusion bodies just like the CP5, we hypothesise that it happens because of the extra amino acids on the pET-28(a+) backbone. We increased the solubility somewhat by losing the cells in the presence of a couple of detergents - Triton X-100 and NP-40 but the protein was still barely visible on a Western blot membrane.
We tried out the same stabilising strategy with PPDK too [10] and this time it worked perfectly, we found out that denatured PPDK can be transferred and stabilised to a buffer containing 0.375 M arginine through dialysis[11]. PPDK was then further purified through nickel affinity ch chromatography and used in the SELEX process.
SELEX
There are plenty of different ways to complete a SELEX in vitro evolution of aptamers using nitrocellulose, microfluidics, whole cells and other materials as the scaffolding for the biomarkers[12, 13], but we decided to use the basic SELEX protocols using magnetic beads[14]. A protein with a His-tag can be attached to the beads and after an incubation with the aptamer pool we can wash off the ones with weak interactions and do a PCR reaction by loading the beads directly to the PCR mixture to amplify the target aptamers. The selex process itself seemed to be successful. We did have to optimise the selection parameters a bit, the PCR reaction only worked when we substituted the TE buffer for water as the aptamer storage solvent because even miniscule amounts of EDTA did not let the Taq polymerase amplify the strands. The magnetic beads themselves also seemed to inhibit the multiplication process when it was done by Taq polymerase so we decided to compare different polymerases and settled on Phusion because it worked the best.
Emulsion PCR
We found creation of emulsion an easy task, but nonetheless few problems occured. First, version 1 emulsion showed irresistance for thermal cycling and micelles broke even after 15 cycles. For this we tried creating emulsions in colder conditions and by mixing for longer. None of these showed better results. Furthermore, comparison of products between ePCR and oPCR was done. In figure X different cycle count was used and on this basic data we can see that open PCR started generating non-specific fragments after 25 cycles and emulsion PCR lagged at overall production of fragments but in the end did not create same longer fragments as seen in oPCR.
ePCR v1
We observed produced micelles using fluorescent microscopy (400x Magnification) with purified GFP shown in figures X and X.
Micelles were stable at room temperature while observing them.
ePCR v2
We tested updated composition emulsion and it did not show any signals of breakage even after 50 PCR cycles. The main problem with this is when we want to check nonspecific PCR products in electrophoresis. It is not an easy task to break emulsion with neither 1-butanol, nor isopropanol. However when used in PCR purification kit the emulsion has gone from cloudy to clear from binding buffer and centrifugation at 20.000 rcf.
To recreate both versions of emulsions see instructions in our protocols and materials.
Observations
Distribution among PCR tubes by 50 µl leaves quite visible mineral oil smear on pipette tips. It is better to produce more of the overall mixture for higher yield. As per visual examination emulsion breaks even after 10 cycles of PCR which suggests that different emulsifiers should be used.
Recommendations for future usage
- Prepare 20% more overall volume to have desired final reaction coverage.
- Use ABIL EM 90 instead of Span 80 for better emulsion preservation during PCR. Keep in mind that using ABIL EM 90 will require additional materials for emulsion breakage.
- Break emulsions with a binding buffer from your PCR purification kit. To ensure breakage test your kit on sample.
Aptamer Sanger sequencing
For Sanger sequencing of aptamers 6th, 8th and 10th rounds of SELEX were selected. PCR products from each round were blunt-end ligated into pUC19 for transformation. Molar ratio of aptamers and vector was chosen as 50:1 (aptamers:vector) for more efficient multi insert ligation. Each round was plated on different LB medium plate with ampicillin. 50 colonies from each round were selected for colony PCR and delivered for further direct sequencing. Last round results were aligned by CLUSTAL multiple sequence alignment (MUSCLE 3.8) and with gathered data generated WebLogo with website from University of California, Berkeley [1, 2].
The results were filtered using Perl scripts from any unspecific fragments, and their frequency was calculated using local BLAST. Consequently, two sequences with the highest frequency are shown in Fig. X.
No. | Aptamer sequence | Count |
---|---|---|
1 | AGAGTCGGTCGATAGTACTATCGACCGACTCT | 8 |
2 | GAGTCGGTCGATAGTACTATCGACCGACTCT | 4 |
As we saw from sequencing results that aptamer No. 2 is a subsequence of aptamer No. 1. However they have different secondary and tertiary structures. For both of them structures are depicted in figures X and X. Secondary structure was folded using The UNAFold Web Servers mFold application at 20°C. Furthermore, tertiary structures were created using RNAComposer from Vienna formatting. We acknowledge that RNA structure is not the same as DNA, however in previous researches showed that composition of DNA and RNA is highly similar and thus 3D RNA structure can be used as DNA [3, 4, 5].
Furthermore we decided to check whether our structures are influenced by primer sequences used in SELEX. We added them to sequences as if they were extracted using PCR. Also secondary and tertiary structures were done using previous websites.
No. | Aptamer sequence | Count |
---|---|---|
1.2 | TGACATTGCCACTCTGAACCAGAGTCGGT CGATAGTACTATCGACCGACTCTACTATCGACCGACTCTGATC |
8 |
2.2 | TGACATTGCCACTCTGAACCGAGTCGGTC GATAGTACTATCGACCGACTCTACTATCGACCGACTCTGATC |
4 |
Aptamer NGS sequencing
In order to sequence our aptamers by NGS Illumina MiSeq platform we designed primers for extending aptamers with needed indexes and adapters. Using Illumina Experiment manager we created sample sheet containing crucial instrumental data. All used primers for indexing are uploaded to part registry are shown in table X. All 20 sequences have the same Tm for PCR.
No | 5' end | 3' end |
---|---|---|
1 | Seq_In_1.1 | Seq_In_2.1 |
2 | Seq_In_1.2 | Seq_In_2.2 |
3 | Seq_In_1.3 | Seq_In_2.3 |
4 | Seq_In_1.4 | Seq_In_2.4 |
5 | Seq_In_1.5 | Seq_In_2.5 |
6 | Seq_In_1.6 | Seq_In_2.6 |
7 | Seq_In_1.7 | Seq_In_2.7 |
8 | Seq_In_1.8 | Seq_In_2.8 |
9 | Seq_In_1.9 | Seq_In_2.9 |
10 | Seq_In_1.10 | Seq_In_2.10 |
PDA synthesis with aptamers
The first in PDA synthesis is 10,12-Tricosadiynoic acid (TCDA) ester activation with NHS. After that it can react with an amine group and form covalent bond. Overall synthesis method is described in protocols and materials.
Name | M (g/mol) |
---|---|
10,12-Tricosadiynoic acid (TCDA) (91445) | 346.55 |
10,12-pentacosadiynoic acid (PCDA) (76492) | 374.60 |
N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC-HCl) (E6383) | 191.70 |
Ethanolamine (411000) | 61.08 |
N-hydroxysuccinimide (NHS) (130672) | 115.09 |
Methylene chloride (Dichloromethane - DCM) | - |
Dimethyl-2-(dimethylphosphino)ethylphosphine (DMPE) | 150.14 |
After dissolving the final fatty acid and aptamer conjugated compounds mixture in chloroform PVDF membrane was dipped 3 times into it and dried between each immersion. Finally the membrane was dried thoroughly and placed under direct UV light (254 nm) for 1 minute. The end product is a blue colored PDA inside of PVDF.
Anti-HSA aptamer with PDA
In aptamer database we found a sequence for human serum albumin (HSA) and ordered it with amine modification on 5’ end of DNA. Overall sequence and secondary structure is shown in figure X.
It was tested in conjugation with PDA and showed positive results. Both negative control (non-native BSA) and distilled water did not show color change. From this we can say that the chosen anti-HSA aptamer is specific and suitable for diagnostic test as positive blood control.
Anti-PPDK aptamer with PDA
Results from Sanger sequencing suggested us to order specific aptamers with amine modified 5’ end for coupling with TCDA. Both aptamer and aptamer with primer sequences were coupled and polymerized. The reaction with pyruvate phosphate kinase solution showed positive results as well as reaction with control buffer and bovine serum albumin. No visual difference was seen.
For more detailed control reactions water and ethanol were chosen. Both of them showed positive results. Color developed on PDA by ethanol was different from those with water based solutions - a little bit on the darker side with a pinch of brown discoloration (figure X. spot 5).
In our case we think that evolutionized and sequenced aptamers that were synthesized for polymerization do not meet criteria needed for positive selection of PPDK. Further analysis of SELEX sequences should be done.
Overall, we think this type of aptamer conjugation to PDA is suitable for aptamer based diagnostic technology. It showed resistance to environmental humidity, temperature changes and exposure to sun rays. Because aptamers can be designed in many ways including in silico, detecting biomarkers could be easy.