Team:Tongji China/js/app.js

(function(e){function n(n){for(var i,o,r=n[0],l=n[1],c=n[2],m=0,d=[];m<r.length;m++)o=r[m],Object.prototype.hasOwnProperty.call(a,o)&&a[o]&&d.push(a[o][0]),a[o]=0;for(i in l)Object.prototype.hasOwnProperty.call(l,i)&&(e[i]=l[i]);h&&h(n);while(d.length)d.shift()();return s.push.apply(s,c||[]),t()}function t(){for(var e,n=0;n<s.length;n++){for(var t=s[n],i=!0,r=1;r<t.length;r++){var l=t[r];0!==a[l]&&(i=!1)}i&&(s.splice(n--,1),e=o(o.s=t[0]))}return e}var i={},a={app:0},s=[];function o(n){if(i[n])return i[n].exports;var t=i[n]={i:n,l:!1,exports:{}};return e[n].call(t.exports,t,t.exports,o),t.l=!0,t.exports}o.m=e,o.c=i,o.d=function(e,n,t){o.o(e,n)||Object.defineProperty(e,n,{enumerable:!0,get:t})},o.r=function(e){"undefined"!==typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},o.t=function(e,n){if(1&n&&(e=o(e)),8&n)return e;if(4&n&&"object"===typeof e&&e&&e.__esModule)return e;var t=Object.create(null);if(o.r(t),Object.defineProperty(t,"default",{enumerable:!0,value:e}),2&n&&"string"!=typeof e)for(var i in e)o.d(t,i,function(n){return e[n]}.bind(null,i));return t},o.n=function(e){var n=e&&e.__esModule?function(){return e["default"]}:function(){return e};return o.d(n,"a",n),n},o.o=function(e,n){return Object.prototype.hasOwnProperty.call(e,n)},o.p="/Team:Tongji_China/";var r=window["webpackJsonp"]=window["webpackJsonp"]||[],l=r.push.bind(r);r.push=n,r=r.slice();for(var c=0;c<r.length;c++)n(r[c]);var h=l;s.push([0,"chunk-vendors"]),t()})({0:function(e,n,t){e.exports=t("cd49")},"034f":function(e,n,t){"use strict";t("85ec")},"2e90":function(e,n,t){"use strict";t("f59d")},4352:function(e,n,t){"use strict";t("9085")},"563b":function(e,n,t){"use strict";t("ed1f")},"635a":function(e,n,t){"use strict";t("7bed")},"7bed":function(e,n,t){},"85ec":function(e,n,t){},9085:function(e,n,t){},cd49:function(e,n,t){"use strict";t.r(n);t("e260"),t("e6cf"),t("cca6"),t("a79d");var i=t("2b0e"),a=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-app",[t("SiteHeader"),t("v-main",[t("v-container",[t("router-view")],1)],1),t("SiteFooter")],1)},s=[],o=t("d4ec"),r=t("262e"),l=t("2caf"),c=t("9ab4"),h=t("2fe1"),m=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",[t("v-app-bar",{staticStyle:{top:"18px"},attrs:{fixed:"",app:"",height:"64",src:""}},[t("router-link",{staticClass:"d-flex",attrs:{to:"/"}},[t("Logo")],1),t("v-spacer"),e._l(e.items,(function(n,i){return[n.submenu?[t("v-menu",{key:i,attrs:{"offset-y":"",transition:"slide-y-transition",bottom:"","open-on-hover":""},scopedSlots:e._u([{key:"activator",fn:function(i){var a=i.on,s=i.attrs;return[t("v-btn",e._g(e._b({staticClass:"\n py-8\n submenubtn\n hidden-sm-and-down\n white--text\n font-weight-medium\n ",attrs:{plain:"",ripple:!1}},"v-btn",s,!1),a),[e._v(" "+e._s(n.title)+" "),t("v-icon",{staticClass:"mx-0",attrs:{right:"",small:""}},[e._v(" mdi-chevron-down ")])],1)]}}],null,!0)},[t("v-list",{attrs:{dense:""}},e._l(n.submenu,(function(n,i){return t("v-list-item",{key:i,attrs:{link:"",to:n.to}},[t("v-list-item-title",[e._v(e._s(n.title))])],1)})),1)],1)]:t("v-btn",{key:i,staticClass:"py-8 hidden-sm-and-down white--text font-weight-medium",attrs:{depressed:"",tile:"",plain:"",to:n.to}},[e._v(e._s(n.title))])]})),t("v-spacer")],2)],1)},d=[],p=t("bee2"),u=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-img",{attrs:{contain:"",src:"","max-width":"8em"}})},g=[],f=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return t}(i["a"]);f.id="Logo",f=Object(c["a"])([h["a"]],f);var b=f,w=b,y=t("2877"),v=t("6544"),T=t.n(v),C=t("adda"),x=Object(y["a"])(w,u,g,!1,null,null,null),A=x.exports;T()(x,{VImg:C["a"]});var k=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.clipped=!1,e.drawer=!1,e.items=[{title:"Home",to:"/"},{title:"Project",submenu:[{title:"Description",to:"/Description"},{title:"Result",to:"/Results"},{title:"Contribution",to:"/Contribution"}]},{title:"Lab",submenu:[{title:"Design",to:"/Design"},{title:"Engineering",to:"/Engineering"},{title:"Experiments Protocol",to:"/Experiments"},{title:"Notebook",to:"/Notebook"},{title:"Parts",to:"/Parts"},{title:"Proof Of Concept",to:"/Proof_Of_Concept"},{title:"Safety",to:"/Safety"}]},{title:"Human Practice",submenu:[{title:"Integrated human practice",to:"/Human_Practices"},{title:"Communication",to:"/Communication"},{title:"Implementation",to:"/Implementation"},{title:"Entrepreneurship",to:"/Entrepreneurship"}]},{title:"Models",to:"/Model"},{title:"Team",submenu:[{title:"Team",to:"/Team"},{title:"Attributions & Acknowledgements",to:"/Attributions"},{title:"Collaboration",to:"/Collaborations"},{title:"Partnership",to:"/Partnership"}]},{title:"Medal Criteria",to:"/Medal_Criteria"}],e}return Object(p["a"])(t,[{key:"changeThemeColor",value:function(){!0===this.$vuetify.theme.dark?this.$vuetify.theme.dark=!1:this.$vuetify.theme.dark=!0}}]),t}(i["a"]);k=Object(c["a"])([Object(h["a"])({components:{Logo:A}})],k);var S=k,j=S,E=(t("635a"),t("40dc")),_=t("8336"),P=t("132d"),z=t("8860"),O=t("da13"),B=t("5d23"),H=t("e449"),F=t("2fa4"),M=Object(y["a"])(j,m,d,!1,null,"4be193f2",null),R=M.exports;T()(M,{VAppBar:E["a"],VBtn:_["a"],VIcon:P["a"],VList:z["a"],VListItem:O["a"],VListItemTitle:B["a"],VMenu:H["a"],VSpacer:F["a"]});var D=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",[t("v-row",[t("v-col",[t("v-img",{attrs:{src:"",height:"15vh"}},[t("v-row",{staticClass:"white--text",attrs:{align:"center"}},[t("v-col",[t("span",[e._v("E-mail: 1950187@tongji.edu.cn")])]),t("v-col",{staticClass:"text-right"},[t("v-row",{attrs:{align:"center"}},[t("v-col",{staticClass:"col-6",attrs:{aligh:"right"}},[t("span",[e._v("WeChat official account:")])]),t("v-col",{attrs:{align:"left"}},[t("v-img",{staticClass:"mt-2",attrs:{contain:"",src:"","max-width":"13vh"}})],1)],1)],1)],1)],1)],1)],1),t("v-row",{attrs:{justify:"center"}},[t("v-col",{staticClass:"col-2 mx-4"},[t("v-row",[t("v-img",{attrs:{contain:"",src:""}})],1)],1),t("v-col",{staticClass:"col-2 mx-4"},[t("v-row",[t("v-img",{attrs:{contain:"",src:""}})],1)],1),t("v-col",{staticClass:"col-2 mx-4"},[t("v-row",[t("v-img",{attrs:{contain:"",src:""}})],1)],1),t("v-col",{staticClass:"col-2 mx-4"},[t("v-row",[t("v-img",{attrs:{contain:"",src:""}})],1)],1)],1),t("v-row",{attrs:{justify:"center",align:"center"}},[t("v-col",{staticClass:"col-4 mr-15"},[t("v-row",[t("v-img",{attrs:{contain:"",src:""}})],1),t("v-row",[t("v-img",{attrs:{contain:"",src:""}})],1)],1),t("v-col",{staticClass:"col-2 ml-5"},[t("v-img",{attrs:{contain:"",src:"","max-height":"15vh"}})],1),t("v-col",{staticClass:"col-2"},[t("v-img",{attrs:{contain:"",src:""}})],1)],1)],1)},I=[],L=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return t}(i["a"]);L.id="SiteFooter",L=Object(c["a"])([h["a"]],L);var N=L,q=N,W=t("62ad"),G=t("0fd9"),V=Object(y["a"])(q,D,I,!1,null,"080f748e",null),U=V.exports;T()(V,{VCol:W["a"],VImg:C["a"],VRow:G["a"]});var K=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return t}(i["a"]);K=Object(c["a"])([Object(h["a"])({components:{SiteHeader:R,SiteFooter:U}})],K);var J=K,$=J,Q=(t("034f"),t("7496")),Y=t("a523"),X=t("f6c4"),Z=Object(y["a"])($,a,s,!1,null,null,null),ee=Z.exports;T()(Z,{VApp:Q["a"],VContainer:Y["a"],VMain:X["a"]});var ne=t("8c4f"),te=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",{staticClass:"bkgrd"},[t("v-row",[t("v-col",{staticClass:"col-6 offset-1 mt-13"},[t("v-img",{attrs:{contain:"",src:""}},[t("div",{staticClass:"text-left text-primary food-wast"},[t("h2",[e._v("Food waste")]),t("p",[e._v("Food waste refers to perishable biomass household waste such as leftovers, expired food, flowers and greenery, and herbal medicine residues.")]),t("p",[e._v("Food waste is waste generated from residents' daily lives and activities such as food processing, whose main sources are household kitchens, restaurants, hotels, canteens, markets and other industries related to food processing.")])])])],1),t("v-col",{staticClass:"col-4"},[t("v-img",{attrs:{contain:"",src:""}})],1)],1),t("v-row",[t("v-col",{staticClass:"col-4 offset-1"},[t("v-img",{attrs:{contain:"",src:""}})],1),t("v-col",{staticClass:"col-6"},[t("v-img",{attrs:{contain:"",src:""}},[t("div",{staticClass:"text-left text-primary household"},[t("h2",[e._v("Household garbage sorting regulations")]),t("p",[e._v("The amount of food waste is increasing year by year after"),t("b",[e._v("  household garbage sorting regulations  ")]),e._v("were implemented in 2019. In 2020, it arrived at 9.6 thousand tons a day, with a 74% growth rate. While in 2021, it climbed to 10.3 thousand tons a day, 89% higher than that of 2019."),t("sup",[e._v("[1]")])])])])],1)],1),t("v-row",[t("v-col",{staticClass:"col-5 offset-1 mt-1"},[t("v-img",{attrs:{contain:"",src:""}},[t("div",{staticClass:"text-left text-primary food-wast"},[t("h2",[e._v("Problems behind garbage sorting")]),t("p",[e._v("With such a huge amount of food waste, the problems of odor caused by food waste have come into our view."),t("b",[e._v("  Unpleasant smells, health problems  ")]),e._v("and influence on"),t("b",[e._v("  downstream industries  ")]),e._v("are the three important ones which influence not only related people but also the downstream industries.")])])])],1),t("v-col",{staticClass:"col-5 mx-12"},[t("v-img",{attrs:{contain:"",src:""}})],1)],1),t("v-row",[t("v-col",{attrs:{align:"center"}},[t("v-img",{attrs:{contain:"",src:"","max-width":"80%",height:"15vh"}})],1)],1),t("v-row",[t("v-col",{attrs:{align:"center"}},[t("v-img",{attrs:{contain:"",src:"","max-width":"90%"}})],1)],1),t("v-row",[t("v-col",{attrs:{align:"center"}},[t("v-img",{attrs:{contain:"",src:"","max-width":"40%",height:"15vh"}})],1)],1),t("v-row",[t("v-col",{attrs:{align:"center"}},[t("v-img",{staticClass:"mr-4",attrs:{contain:"",src:"","max-width":"75%"}},[t("div",{ref:"how_we_do",staticClass:"text-left text-primary how-we-do"})])],1)],1),t("v-row",[t("v-col",{staticClass:"offset-1"},[t("div",{staticClass:"home-reference text-left"},[t("h2",[e._v("Reference")]),t("p",[e._v("[1] 上海市生态环境局.二〇一九年上海市固体废物污染环境防治信息公告[EB/OL].2020-06-10")])])])],1)],1)},ie=[],ae=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return Object(p["a"])(t,[{key:"mounted",value:function(){var e=this.$refs.how_we_do;e&&(e.innerHTML="

Since the implementation of household garbage sorting regulations in Shanghai, the amount of food waste has reached a peak. However, problems caused by odor like unpleasant smell and health problems, have aroused great attention everywhere.This year, Tongji_China launches the "LOOK!" project to solve the problem. We construct two kinds of bioengineered E.coli to absorb hydrogen sulfide and ammonia, which are the two main ingredients in the odor. One uses enzymes related to sulfide oxidazation(Sqr, Sdo, AprBA and Sat), converting hydrogen sulfide to sulfate, while the other uses enzymes AMO, HAO and NOD to convert ammonia to nitrate. Besides, a three-gear adjustable kill switch based on the concentration of H2S and NH3 is added to ensure biosafety. Also, we optimize our pathway by high throughput screening and machine learning. Besides, we take implementation into consideration and construct models to simulate the real environment. With such efforts, we hope to solve the problems the odor has brought to people and downstream industries.

")}}]),t}(i["a"]);ae.id="Home",ae=Object(c["a"])([h["a"]],ae);var se=ae,oe=se,re=(t("563b"),Object(y["a"])(oe,te,ie,!1,null,null,null)),le=re.exports;T()(re,{VCol:W["a"],VImg:C["a"],VRow:G["a"]});var ce=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"poc",staticClass:"text-left"})])],1)},he=[],me=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",{ref:"anchor",staticClass:"anchor"},[t("ul",e._l(e.anchors,(function(n,i){return t("li",{key:i,class:(i===e.curIdx?"active":"")+" indent-"+n.level,on:{click:function(t){return e.scroll(n.e,i)}}},[e._v(" "+e._s(n.content)+" ")])})),0)])},de=[],pe=(t("c740"),t("18a5"),t("d81d"),t("a630"),t("3ca3"),t("a9e3"),i["a"].extend({props:{ele:HTMLElement}})),ue=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e._ele=null,e.curIdx=0,e}return Object(p["a"])(t,[{key:"scroll",value:function(e,n){var t=e.offsetTop;window.scroll({top:t-50,behavior:"smooth"}),this.curIdx=n}},{key:"clean",value:function(){this._ele&&(this._ele.onscroll=null,this._ele=null)}},{key:"observe",value:function(e,n){var t=this;this._ele&&this.clean();var i=function(){var i=document.scrollingElement||e,a=i.scrollTop,s=n.findIndex((function(e){var n=e.e;return n.offsetTop-60>=a}))-1;if(s<0&&(s=n.length-1,n[s].e.offsetTop-60>a&&(s=0)),s!==t.curIdx){t.curIdx=s;var o=t.$refs.anchor,r=o.scrollTop,l=o.clientHeight,c=o.firstChild.children,h=c[s].offsetTop;Math.abs(h-(r+l/2))>50&&o.scroll({top:h-l/2,behavior:"smooth"})}};e.onscroll=i,this._ele=e}},{key:"anchors",get:function(){this.clean();var e=this.ele;if(e){var n=Array.from(e.querySelectorAll("h1[id],h2[id],h3[id],h4[id],h5[id]")).map((function(e){var n=Number(e.tagName[1]);return{id:e.id,content:e.textContent,level:n,e:e}}));return this.observe(document.body,n),n}return[]}},{key:"beforeDestory",value:function(){this.clean()}}]),t}(pe);ue.id="Anchor",ue=Object(c["a"])([h["a"]],ue);var ge=ue,fe=ge,be=(t("2e90"),Object(y["a"])(fe,me,de,!1,null,"76bf14d2",null)),we=be.exports,ye=t("0e54"),ve=t.n(ye),Te=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.poc;console.log(e),e&&(e.innerHTML=ve()('\n# Abstract\n\nSince the implementation of **household garbage sorting regulations** in Shanghai, the amount of food waste has reached a peak. However, **problems caused by odor** like unpleasant smell and health problems, have aroused great attention everywhere.This year, **Tongji_China** launches the **"LOOK!"** project to solve the problem. We construct two kinds of bioengineered E.coli to absorb **hydrogen sulfide** **and ammonia**, which are the two main ingredients in the odor. One uses enzymes related to sulfide oxidazation(**Sqr, Sdo, AprBA and Sat**), converting **hydrogen sulfide** to **sulfate**, while the other uses enzymes **AMO, HAO and NOD** to convert **ammonia** to **nitrate**. Besides, a **three-gear adjustable kill switch** based on the concentration of H2S and NH3 is added to ensure biosafety. Also, we **optimize our pathway** by high throughput screening and machine learning. Besides, we take implementation into consideration and construct models to **simulate the real environment**. With such efforts, we hope to solve the problems the odor has brought to people and downstream industries.\n\n# Inspiration\n\nSince **household garbage sorting regulations** were implemented in Shanghai, there have been many problems needed solving coming to people\'s view. Among them, **the odor of food waste** is one of the most common ones. We\'ve heard many complaints about the odor, especially in summer. For example, in our school canteen, we need to pour the rest into the food waste bin after having meals. But the odor from the bins makes us unwilling to approach it. This makes us wonder, can we solve the odor of food waste? And this is what **Tongji_China** has done this year——**LOOK！a little odor killer**.\n\n# Background\n\nThe **amount** of food waste is **increasing year by year** after household garbage sorting regulations were implemented in 2019. In 2020, it arrived at 9.6 thousand tons a day, with a 23.97% growth rate.While in 2021, it climbed to 10.3 thousand tons a day, 89% higher than that of 2019. [1]\n\n## Treatment paths for food waste\n\n\n\nThere\'s a complete treatment path for food waste in Shanghai.\n\n\n\n<img src="" alt="2-1湿垃圾处理流程" style="max-width:100%" />\n\n\n\nWith such a huge amount of food waste, the problems of odor caused by food waste have come into our view.\n\n## Unpleasant smell\n\nThere\'s no doubt that food waste is very smelly, especially in summer. After our online and offline research, we find that the unpleasant smell caused by food waste is very common. Waste treatment accounted for an average of 11.3% of all odor complaints in 2018-2020, making it the sector with the **highest number of odor complaints** in the last three years.\n\n<img src="" alt="2-2 投诉" style="max-width:100%" />\n\n\n\nIndustry distribution of odor complaints from 2018-2020[2]\n\nBesides,in the first season of 2018 only, there were **121 complaints** from residents nearby about the odor in Lao Gang District, a waste treatment centre in Shanghai.\n\n## Health problems\n\nBesides the unpleasant smell, the chemical substances in the odor may also lead to some **health problems** like respiratory, endocrine and nervous systems, and may be associated with the risk of cancer[3].Aatamila et al [4] found that odor from waste disposal centres may lead to a great impact on health symptoms such as shortness of breath, eye irritation, hoarseness, fever, and muscle pain.Gao et al [5] detected a total of 20 odorous substances in waste transfer stations, with a high proportion of emissions of benzene, toluene, methylene chloride, etc. The carcinogenic risk of 1,3-butadiene and benzene ranged from 10^{-6^ to 10^-4}.\n\n\n\n<img src="" alt="2-3 健康" style="max-width:30%" />\n\n\n\n## The Influence on downstream industries\n\nAccording to our human practices at **Tian Wei Environmental Company**, which focuses on recycling food waste, we have learned that the odor of food waste can have great influence on **downstream industries**. To make the best use of resources, most of the wet waste is used for **composting**. However, the odor of food waste makes the compost too stinky to use.\n\n\n\n<img src="" alt="2-4 堆肥" style="max-width:30%" />\n\n\n\n## Limitations of present odor elimination methods\n\nAfter learning about the problems the odor has brought, we have done some research to learn about present treatment methods.\n\n \n\n## Mechanism of odor gases generation\n\n(1) Generation of H₂S\n\n- Sulphur-containing organic substances (e.g. sulphur-containing amino acids, sulforaphane, etc.) in water are degraded by anaerobic bacteria to become hydrogen sulphide [6].\n\n- Reduction of sulphate in the presence of sulphate-reducing bacteria [7]\n\n(2) Generation of NH₃\n\n- Ammonification reaction: organic nitrogen - ammonia (deaminase)\n\n- N₂ in the environment is fixed to ammonia by some microbial nitrogen fixation\n\n# Goals & Methods\n\nIn order to eliminate the odor effectively and safely, our design is divided into the following four parts.\n\n## **Hydrogen sulfide oxidization module**\n\nIn order to remove hydrogen sulfide produced in food waste, we hope to oxidize **hydrogen sulfide** to **sulfate**, which is odorless, non-toxic and beneficial as an essential component in compost. We construct a hydrogen sulfide oxidation pathway in **E.coli** by expressing four enzymes related to **sulfur oxidation** from Acidithiobacillus spp.\n\n## Ammonia oxidization module\n\nFor ammonia processing, we chose **nitrate** as our final product after thorough considerations. To build up an efficient **ammonia oxidation** pathway in E.coli, we hope to express three enzymes from Ammonia-oxidizing bacteria: **AMO** , **HAO** and **NOD**[8]\n\n## Pathway optimization\n\nTo further improve the hydrogen sulfide and Ammonia oxidation efficiency of our bio-engineered bacteria, we have designed a high throughout strategy to optimize the expression level of these enzymes.\n\n## Kill switch\n\nTo ensure biosafety, we have designed a three-gear adjustable kill switch based on odor sensors[9], Dre recombinase system[10] and toxin-antitoxin system[11]. It can live under culture and working conditions. Also it dies when leaking to the environment.\n\n## Model\n\nWhen it comes to the application level, we’ve built several models to predict the application future of our project.\n\n### Model 1 :\n\nWe bulit a ODE model to predict whether our three-gear-adjustable kill switch can work as expected. We have also done some parameter analysis to find the possible improving direction. This model helped with our bio-safety considerations.\n\n### Model 2:\n\nWe established a cellular automation model to simulate the dynamics of engineered bacteria spread and odour degradation in practical application. We also simulated the application in different environment, seasons and compared different ways of implementation. This model offered a guide for the improvement and application of our project.\n\n# Reference:\n\n[1] 上海市生态环境局.二〇一九年上海市固体废物污染环境防治信息公告[EB/OL].2020-06-10\n\n[2] 生态环境部大气环境司.2018-2020年全国恶臭/异味污染投诉情况分析[EB/OL].2021-08-02\n\n[3] 方晶晶,章骅,吕凡,邵立明,何品晶.生活垃圾收运过程中恶臭暴露的健康风险评估[J].中国环境科学,2015,35(03):906-916.\n\n[4] Aatamila M, Verkasalo P K, Korhonen M J, et al. Odour annoyance and physical symptoms among residents living near waste treatment centres[J]. Environmental Research, 2011, 111(1): 164-170.\n\n[5] Gao S, Bai Z P, Wang X Y, et al. Cancer risk assessment of volatile organic compounds in an ornament market in Tianjin, China[C]//2012 International Conference on Biomedical Engineering and Biotechnology. IEEE, 2012: 1247-1250.\n\n[6] 任南琪,王爱杰,甄卫东.厌氧处理构筑物中SRB的生态学[J].哈尔滨建筑大学学报,2001(01):39-44.\n\n[7] 赵宇华,叶央芳,刘学东.硫酸盐还原菌及其影响因子[J].环境污染与防治,1997(05):41-43.\n\n[8] Kim, D., et al., *Transcriptomic Identification and Biochemical Characterization of HmpA, a Nitric Oxide Dioxygenase, Essential for Pathogenesis of Vibrio vulnificus.* Front Microbiol, 2019. 10: p. 2208.\n\n[9] Liu, H., et al., *Synthetic Gene Circuits Enable Escherichia coli To Use Endogenous H(2)S as a Signaling Molecule for Quorum Sensing.* ACS Synth Biol, 2019. 8(9): p. 2113-2120.\n\n[10] Anastassiadis, K., et al., *Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E. coli, mammalian cells and mice.* Dis Model Mech, 2009. 2(9-10): p. 508-15.\n\n[11] Simanshu, D.K., et al., *Structural basis of mRNA recognition and cleavage by toxin MazF and its regulation by antitoxin MazE in Bacillus subtilis.* Mol Cell, 2013. 52(3): p. 447-58.\n '),this.ele=e)}}]),t}(i["a"]);Te.id="Description",Te=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Te);var Ce=Te,xe=Ce,Ae=Object(y["a"])(xe,ce,he,!1,null,null,null),ke=Ae.exports;T()(Ae,{VCol:W["a"],VRow:G["a"]});var Se=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"result",staticClass:"text-left"})])],1)},je=[],Ee=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.result;console.log(e),e&&(e.innerHTML=ve()('\n# Result #\n\nThe experimental section of our project mainly includes three parts: hydrogen sulfide degradation, pathway optimization and kill switch. We have achieved certain phased results respectively.\n\n- **Hydrogen sulfide degradation**\n\nIn the experimental part of hydrogen sulfide oxidation, we verified the expression of mRNA and protein of the target gene, proved its ability to oxidize sulfide in liquid environment, and further verified its function in the simulated food waste environment\n\n- **Pathway optimization**\n\nWe believe that different enzymes expressed by different genes have different efficiencies, thus only four enzymes maintained in the right ratio will have the best effect of sulfur removal. Therefore, we decided to replace different promoters for different genes and combine them to select the optimal pair.\n\n- **Kill switch**\n\nTo prevent our engineered bacteria from leaking into the environment, we designed a H₂S sensitive three-gear kill switch to ensure this.\n\n\n\n## **Hydrogen sulfide degradation** #\n\n### **The mRNA expression level of the target gene was detected by RT-qPCR** #\n\nWe extracted RNA of our engineered bacteria and wild-type bacteria for RT qPCR experiment. The relative content of target mRNA in each group was calculated based on 16s gene of *E.coli*. The experimental results can prove that our engineering bacteria can transcribe the mRNA of the introduced gene normally. (There is no target gene in the wild type, the relative expression of engineering bacteria is very high and the difference is large)\n\n <img src="" alt="img" style="max-width:100%" />\n\nFigure 1. Result of RT-qPCR for four genes\n\n### **The expression level of the target protein was detected by SDS-PAGE** #\n\nWe first tried to introduce plasmids linked with 1/2/3/4 target genes into *E.coli* DH5α, and detected their protein expression levels. However, due to the low expression amount and the limitation of Spectrophotometry, we did not find significant differences between the engineered strain and the wild type protein strips.\n\n<img src="" alt="img" style="max-width:100%" />\n\nFigure 2. SDS-PAGE bands of four genes regulated by the promoter of J23110\n\n\nTherefore, four target genes were added with efficient T7 promoter respectively and introduced into *E.coli* BL21(DE3).Under the condition of IPTG induction, all proteins of strain containing target genes and wild-type strain were extracted. SDS-PAGE experiment and Coomassie brilliant blue staining showed that the expression of each target protein could be realized in *E.coli* BL21(DE3).\n\n<img src="" alt="img" style="max-width:100%" />\n\nFigure 3. SDS-PAGE bands of four genes regulated by T7 promoter\n\n\nWe had hoped to construct plasmids with T7 promoter for all four genes, and then test the protein expression, but the construction process was very difficult. Finally, due to the limited time, we connected the four genes, but only the SQR gene was regulated by the T7 promoter. In the staining results, only the SQR band was obvious, but it was speculated that the other proteins should be able to express normally.\n\n<img src="" alt="img" style="max-width:100%" />\n\nFigure 4. SDS-PAGE bands of S-S-A-S. (S-S-A-S: pET3a-T7-SQR-J23110-SDO-J23110-APR-J23110-SAT; WT: Wild Type; Mix: Positive mix of 4 target protein.)\n\n### **Protein function verification experiment**\n\nIn view of the the limiting capacity of our laboratory to detect the intermediates in the sulfide oxidation pathway, we mainly verified the function of our engineered bacteria from the oxidation level of sulfide and the generation level of sulfate.\n\n#### Characterization experiment of S^2- oxidation amount #\n\n- **Verification of test method:**\n\n We configured a series of sodium sulfide solutions with concentration gradient and tested them with detection reagents according to certain methods. The standard curve obtained is ideal. It can be considered that our detection method can accurately reflect the relative content of sulfide in the solution within this concentration range.\n\n\n\nFigure 5. standard curve of S^2-\n\n- **Sulfide oxidation in liquid environment**\n\n We put the engineered bacteria and wild-type bacteria into a certain concentration of sodium sulfide solution, take out the bacterial solution every 30 min to detect the residual sulfide concentration. The results show that our engineered bacteria can oxidize sulfide better. (because the bacteria have a certain adsorption effect on sulfide, the initial sulfur ion concentration of the two groups of added bacterial solution is lower than blank)\n\n  \n\nFigure 6. Concentration of S^2- in liquid environment with different bacteria. ( SSAS: pET3a-T7-SQR-J23110-SDO-J23110-APR-J23110-SAT； WT: Wild Type； BK: Blank )\n\n\n- **Hydrogen sulfide oxidation in simulated food waste environment**\n\n We have preliminarily confirmed that the engineering bacteria can effectively inhibit the production of hydrogen sulfide in egg liquid, but due to the limited time, it has not been accurately verified. Further experiments need to be designed to detect the ability and efficiency of engineering bacteria to oxidize hydrogen sulfide in wet waste environment.\n\n <img src="" alt="鸡蛋液" style="max-width:100%" />\n\n\nFigure 7. Existence of S^2- in egg liquid with different bacteria. ( SSAS: pET3a-T7-SQR-J23110-SDO-APR-SAT； WT: Wild Type）\n\n\n\n## Pathway optimization #\n\nWhat we have achieved\n\n* Strategy design\n* Promoters characterization\n* Mix promoter preparation and first round of assembly\n* Randomness validation\n\n##### Future expectation\n\n* Try to improve the multi-fragments homologous recombination efficiency\n\n* Perform sequencing, phenotyping on the correct clones\n* Collect data from phenotyping and train ANN model for prediction\n\nIn order to improve the hydrogen sulfide oxidation efficiency by making subtle control of enzymes concentration, we chose promoters with different strength in Anderson library^[1] (link: design的相应部分). Firstly, we validated their relative strength for model training **(Figure 8)**.\n\n<img src="" alt="p1" style="max-width:100%" />\n\nFigure 8 Promoter characterization\n\nNext, we designed a PCR strategy that promoters have different strength can be obtained in a single PCR reaction **(Figure 9)**. Genes in hydrogen sulfide oxidation pathway were also amplified with high fidelity PCR so that homologous arms can be added.\n\n<img src="" alt="p2" style="max-width:100%" />\n\nFigure 9 Amplifying promoters with different strength\n\nDue to the limitation of commercial recombinase, it is almost impossible to recombine four genes with their respective promoters in a single reaction, so we recombine SQR, SDO with their promoters, AprBA, SAT with their promoters, respectively for the first round. Plasmid backbone with ampicillin resistance gene was used. This reaction was not effective enough due to the limitation of recombinase at first , we had improved our homologous arms to get better efficiency **(Figure 10 left)**.\n\n<img src="" alt="p3" style="max-width:100%" />\n\nFigure 10 The first round of homologous recombination\n\nWe performed resistance screening to enrich recombined plasmids. Then random recombined promoter-SQR-promoter-SDO sequences and promoter-AprBA-promoter-SAT sequences, amplified and added with homologous arms for the next recombination reaction **(Figure 10 right)**.\n\n\nThen the promoter-SQR-promoter-SDO sequences and promoter-AprBA-promoter-SAT sequences were assembled with a backbone containing chloramphenicol resistance gene. We got multiple colonies after resistance screening. However, we found that it was hard to assemble these three large fragments. Two-fragments assembly (promoter-AprBA-promoter-SAT and backbone) happened in more than 50% of the colonies, which was not expected **(Figure 11)**. Because of the limited time, we have not solved this problem so far.\n\n<img src="" alt="p5" style="max-width:100%" />\n\nFigure 11 The second round of homologous recombination\n\n## Kill switch\n\n## 1.Plasmid Construction\n\nConsidering the accessibility of the template and the time limitation, we adopted the strategy of assembling the functional components separately obtained by gene synthesis. Considering plasmid incompatibility, we chose pACYC as the vector for this part, which has a different replication system from pET-3a. Plasmids were constructed by restriction enzyme digestion and ligation and In-Fusion. The construction process we designed is shown below.\n\n<img src="" alt="质粒构建流程" style="max-width:100%" />\n\nFigure 12. The initial plasmid construction flow chart\n\nUnfortunately, the synthesis of J23119-CstR-Pcstr-MazE -Dre encountered difficulty so that we couldn\'t obtain the sequence of J23119-CstR-Pcstr. Considering this part was very necessary for our work, we contacted Professor Huaiwei Liu from Shandong University based on literature and fortunately got his help. Using the plasmid he donated as a template, we successfully amplified the CstR-Pcstr sequence (Figure 3A) and used it for our plasmid construction.\n\n<img src="" alt="质粒构建流程-2" style="max-width:100%" />\n\nFigure 13. The modified plasmid construction flow chart\n\nWe successfully constructed the plasmid CstR-Pcstr-MazE -Dre and amplified CstR-Pcstr-MazE-Dre (Figure 3B).Then we cloned CstR-Pcstr-MazE-Dre to pACYC-rox-ter-rox-MazF.\n\n<img src="" alt="胶图" style="max-width:100%" />\n\nFigure 14. Agarose electrophoresis\n\nHowever, according to the sequencing results, we found that Pcstr was missing, probably due to the complexity of each block. Meanwhile, we found the terminator between the two rox sites was partly moved after we cultured the final plasmid. We assumed that it could be the leakage of Pcstr that turned on the expression of Dre, which then cut off the terminator. This means we need to optimize our design.\n\n## 2.Promoter optimization\n\nTo optimize the design of our kill switch, we tried to find a proper combination of the three key promoters, PR (Pcstr), PL (PlacI), and J23110, by testing their strength respectively first (Figure 4.).\n\n<img src="" alt="启动子表征" style="max-width:100%" />\n\nFigure 15. The strength of the three key promoters\n\nFrom our results, we found that the intensity of Pcstr is significantly higher than J23110, and PlacI is very lower than J23110. This may explain why we encountered the leakage of Pcstr —— the inhibition of the CstR may be too low to block Pcstr while the intensity of Pcstr is in a high level. Although this is not consistent with the literature, the facts tell us that it is. Considering the time limitation and the workload of changing different promoters to test the best combination, we constructed a [model](/Team:Tongji_China/Model) achieve this.\n\n## 2.CstR with Pcstr Characterization\n\nTo ensure appropriate concentration range of S^2- used for the characterization of pACYC-rox-ter-rox-MazF-CstR-Pcstr-MazE-Dre, we first characterized the function of CstR with Pcstr using pTrchis2A-CstR-Pcstr-mKate-CpSQR. The expression level regulated by Pcstr at different concentrations of S^2- was shown by the fluorescence intensity of mKate (/OD_{600 nm}).\n\nAt the beginning, bacteria cultured in 5 mL were treated with 0, 6.5, 13.0, 26.0 and 39.0 mg/L Na₂S (0, 20, 40, 80 and 120 mg/L Na₂S·9H₂O) respectively, and then the fluorescence intensity of mKate was measured with a microplate reader.[(See experiments protocol)](/Team:Tongji_China/Experiments)\n\n<img src="" alt="CstR表征" style="max-width:100%" />\n\nFigure 16. (A)The fluorescence intensity variation relative to the concentration of Na₂S; (B)the curve of fluorescence intensity relative to time; (C)the curve of OD_{600 nm} relative to time\n\nIt can be seen that the presence of S^2- at different concentrations has no significant effect on the growth of bacteria. However, with the increase of S^2-, the fluorescence intensity increases at first and then decreases, indicating that when S^2- is too high, the lifting effect on CstR inhibition is weakened. We hope to find out an appropriate concentration range in which the strength of Pcstr is positively correlated with the concentration of S^2-, which tells us that we need to reduce the concentration gradient and concentration range for further characterization.\n\nWe further used 0, 3.25, 6.50, 9.75, 13.00, 16.25 mg/L Na₂S (0, 10, 20, 30, 40 and 50 mg/L Na₂S·9H₂O) to treat 5 mL bacterial solution and then measured the fluorescence intensity of mKate using a microplate reader(Figure 6.).\n\n<img src="" alt="小梯度测试" style="max-width:100%" />\n\nFigure 17. The fluorescence intensity variation relative to the concentration of Na₂S with a smaller range\n\nIt can be seen from the figure that in a smaller concentration range, there is a positive correlation between fluorescence intensity and Na₂S concentration, visible to naked eyes, which implies that we can use data within this concentration range to guide our characterization experiments.\n\nBut unfortunately, as mentioned above, we encountered difficulties in constructing the final kill switch plasmid, thus the characterization of which failed to be carried out smoothly. Given this problem, we intend to build a [model](/Team:Tongji_China/Model) trying to settle it.\n\n## Reference\n\n[1] http://parts.igem.org/Promoters/Catalog/Anderson\n\n\n '),this.ele=e)}}]),t}(i["a"]);Ee.id="Result",Ee=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Ee);var _e=Ee,Pe=_e,ze=Object(y["a"])(Pe,Se,je,!1,null,null,null),Oe=ze.exports;T()(ze,{VCol:W["a"],VRow:G["a"]});var Be=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"contribution",staticClass:"text-left"})])],1)},He=[],Fe=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.contribution;e&&(e.innerHTML=ve()('\n\n# Contribution\n\n## 1. New data for existing parts\n\nIn order to improve the hydrogen sulfide oxidation efficiency by making subtle control of enzymes concentration, we chose promoters with different strength in Anderson library (BBa_J23100: http://parts.igem.org/Part:BBa_J23100). We validated their relative strength in E.coli(DH5α) for model training **(Figure 1)**. Our result shows a similar trend with previous characterization. However, we find that J23104 is a stronger promoter than J23100 and it shows bad repeatability in three replications while other promoters shows good repeatability. Characterization of J23104 in K. rhaeticus by KEYSTONE_A 2020 has a similar phenomenon.\n\n<img src="" alt="2.3.1" style="max-width:100%" />\n\nFigure 1 Characterization of promoters from the Anderson library\n\nWe also characterized two promoter P_lacI and P_cst in our kill switch(link: design kill switch) and compared their strength with promoters in the Anderson library. P_cst has a considerable strength with J23110 while PlacI is a weak promoter **(Figure 2)**.\n\n<img src="" alt="2.3.2" style="max-width:100%" />\n\n\n\nFigure 1 Characterization of Pcst and PlacI\n\n\n\n## 2. A guide for questionnaire design\n\n### *3 Steps on Making your Questionnaire more Effective and Scientific*\n\n\n\n#### Preface\n\nHave you considered whether the questionnaire will be able to reach your demands?\n\nHave you molded your subjects subliminally during the design?\n\nNeither highly regard nor underestimate the ability of your questionnaire. All of us should be down-to-earth, to receive a correct evaluation.\n\nThis year, Tongji_China wanted to collect people\'s opinions on the odor of wet waste in their lives and their knowledge of synthetic biology by handing out questionnaires. To do this, we visited Professor Ming Sun from the School of Political Science & International Relations, Tongji University. He introduced a few principles that need to be followed in the questionnaire design process to us. We also asked a student studying social work at the School of Philosophy and Law and Politics at Shanghai Normal University, who gave us more detailed comments on the wording of our questionnaire.\n\nWith this in mind, Tongji_China would like to organize and publicize these comments and principles to show our support to other teams in questionnaire design.\n\n\n\n#### Step 1 **Before you are determined to design the questionnaire, ask yourself,**\n\n##### **(1)What\'s the purpose of your questionnaire?**\n\nIt is important to consider why to design and distribute your questionnaires. At iGEM, it is also imperative to know how our project may affect society and what society can teach and improve our project. Under such circumstances, a questionnaire may be useful to evaluate it, if the questionnaire itself can work to the best of its ability.\n\n##### **(2) Have you got enough references, on your topic or design?**\n\nThe reference can be acquired from literature, interviews, field researches, and so on.\n\nAccording to our interview with Prof. Sun, the basic information we can acquire from questionnaires can be divided into three aspects: characteristics, attitudes and behaviors. The following is a table with examples.\n\n| Characteristics | Attitudes | Behaviors |\n| --------------------------------- | --------------------------------------------- | -------------------------------------------- |\n| Gender, age,level of education... | sense of well-being, sense of satisfaction... | Frequency of fitness, travel destinations... |\n\nThere are also a series of established questionnaire materials can be used as references, such as CGSS (Chinese General Social Survey), ISSP (International Social Survey Programme) and EASS (East Asia General Social Survey) and "Wanvol Methodology" (Chongqing University Press)\n\n\n\n#### Step 2 **When designning a questionnaire, ask yourself,**\n\n##### **(1) Have you ever considered subjects\' literacy, level of education and comprehension skills？**\n\nThe characterization of subjects determines our questionnaires\' verbal descriptions. We should choose plain and easy-understanding words and terms as much as possible. For example,\n\navoidance of professional terms and detailed descriptions can catch subjects\' attention and convey our intention more effectively. In addition, compared with online questionnaires, an offline questionnaire requires more simplicity.\n\nEven if the subjects are experts and academics, the concise wording allows them to quickly get to the point and understand our intentions.\n\nImages and symbols(such as arrows, bold, underlines and changing colors) can be useful in attract attention and improve the comprehension. The followings are what Tongji_China this year\'s applications.\n\n<img src="" style="max-width:100%" />\n\n<img src="" style="max-width:100%" />\n\n##### **(2) Are your verbal descriptions appropriate?**\n\nThe appropriateness in design not only emphasizes simplicity and ease for subjects to understand, but we should also pay attention to that a single question should focus on a single topic and there should be no overlap between each option, as this will affect the reliability of the results. **Here is a wrong example and the revised of it.**\n\n**Previous:**\n\nWe would like to know the subject’s participation in the waste disposal and the influence of garbage sorting policies.\n\n| Which of the following best describes your identity? |\n| ------------------------------------------------------------ |\n| (1)Shanghai resident |\n| (2)Non-shanghai resident, but are permanent residents of Shanghai who come to Shanghai for work or study |\n| (3)Workers in waste disposal industry |\n| (4) Others |\n\nHowever, setting choice(3) in this question is inappropriate since there may be overlaps between choice(1)(2) and (3), causing meaningless results.\n\n**After:**\n\nWe obtain sources of subjects through back-office geolocation analysis and replace the previous question with a single question to know their degree of participation towards waste disposal.\n\n| Are you engaged in waste disposal industry related work? |\n| ------------------------------------------------------------ |\n| (1) I work in a waste disposal industry. |\n| (2) I am not a worker related, but have participated in this kind of volunteer services before. |\n| (3) No relevant experiences. |\n\n##### **(3) Will you use any analytical or statistic skills?**\n\nBesides launching questionnaries, another work to do is to consider what to do with the raw data. For example, a Likert scale can be used to analysed the mental state and attitude of subjects. However, the Likert scale won\'t work in reliability analysis and validity analysis unless you apply three factors or sub-questions below one topic.\n\n\n\n#### Step 3 Befor**e handing out your questionnaires, ask yourself,**\n\n##### **(1) Have you ever considered the worst condition of subjcts?**\n\nWhen we hand out the questionnaires, there may be a series of bad conditions beyond our imaginations, including the public\'s willingness, patience and whether they will be influenced not to tell the truth. For us, the only thing we can do is to make sure that the designed questionnaires are unbiased and effective, as much as possible. The following examples show that we can implement questions with different levels of expression to examine whether people fill in the questions seriously.\n\neg2:\n\n| Please briefly rate the odor of wet waste in your daily life. | | | | | | | | | | |\n| ------------------------------------------------------------ | ---- | ---- | ---- | ---- | ---- | ---- | ---- | ---- | ---- | -------------- |\n| Almost no odor | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | Severe odorous |\n\neg3:\n\n| Which of the following three statements best describes your perception of the odor of wet waste? |\n| ------------------------------------------------------------ |\n| (1) Absolutely none. |\n| (2) It emits odor to some extent, but it\'s tolerable |\n| (3) The odor has effected my working efficieny or my mental state during work |\n| (4) The odor has affected my health (shortness of breath, eye irritation, hoarseness, fever and muscle aches) |\n\n##### **(2) Have you ever revised your questionnaires enough?**\n\nAccording to Prof. Sun, pre-launch is the most important step before we hand out questionnaires. With a small volume of subjects, we can review our questionnaires again with real results.\n\n\n\n '),this.ele=e)}}]),t}(i["a"]);Fe.id="Contribution",Fe=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Fe);var Me=Fe,Re=Me,De=Object(y["a"])(Re,Be,He,!1,null,null,null),Ie=De.exports;T()(De,{VCol:W["a"],VRow:G["a"]});var Le=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",[t("v-row",[t("v-col"),t("v-col",[t("v-slide-group",{attrs:{mandatory:""},model:{value:e.sectionNum,callback:function(n){e.sectionNum=n},expression:"sectionNum"}},e._l(e.sections,(function(n,i){return t("v-slide-item",{key:i,scopedSlots:e._u([{key:"default",fn:function(i){var a=i.active,s=i.toggle;return[t("v-btn",{staticClass:"mx-2",class:n.normalClass,attrs:{"input-value":a,"active-class":n.activeClass+" white--text",depressed:"",rounded:""},on:{click:s}},[e._v(e._s(n.title))])]}}],null,!0)})})),1)],1),t("v-col")],1),0===e.sectionNum?t("HPage"):1===e.sectionNum?t("APage"):2===e.sectionNum?t("OPage"):t("KPage")],1)},Ne=[],qe=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"h_md",staticClass:"text-left"})])],1)},We=[],Ge=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.h_md;e&&(e.innerHTML=ve()('\n\n# Hydrogen sulfide degradation\n\n## Selection of gene and plasmid construction\n\nAccording to the [background](/Team:Tongji_China/Design#background) description-background) we have researched, we found that hydrogen sulfide and ammonia are the two main odors that cause malodor in food waste ^[1], so we decided to convert these two malodor-emitting odors into non-toxic and odorless substances so that we could solve the problem through engineered bacteria.\nTwo main problems need to be solved.\n\n- What substances to convert the odors into\n- By what reaction pathway\n\nAfter our extensive literature review and intense discussions, the following technical routes were identified.\n\n1. ### Converse hydrogen sulfide into sulfate\n\n Hydrogen sulfide is a strongly reducing substance, so it is natural to think that it can be oxidized to deal with it. By reviewing the literature, we found that there are sulfur treatment pathways in some sulfur bacteria (see Figure 1. below) ^[2], and we can refer to this to design our treatment pathway.\n\n <img src="" alt="S cellular pathway" style="max-width:100%" />\n\n Figure 1. The updated model of sulfur oxidation in A. ferrooxidans. OMP, outer-membrane proteins; TQO, thiosulfate quinone oxidoreductase; TSD, thiosulfate dehydrogenase; TetH, tetrathionate hydrolase; SQR, sulfide: quinone oxidoreductase; SDO, sulfur dioxygenase; HDR, Hdr-like complex; SAT, ATP sulfurylase; bd,bo3, terminal oxidases; QH2, quinol pool; NADH, NADH dehydrogenase complex I.\n\n Through further investigation we found that sulfite is cytotoxic, singlet sulfur is produced slowly under aerobic conditions, and the large accumulation of GSSH and H₂S_n is toxic and causes the expression of reductase in E. coli, thus requiring conversion downstream. Taking into account, we selected sulfate as our end product, which has no major effect on both bacteria and the environment at low doses and is odorless itself.\n\n2. ### Specific metabolic pathways\n\n As Figure 2. below, we introduced a plasmid containing four genes into the bacteria to convert hydrogen sulfide to sulfate through a four-step reaction.\n\n<img src="" alt="S通路设计图" style="max-width:100%" />\n\nFigure 2. The hydrogen sulfide degradation pathway\n\n#### The introduction of the four genes\n\n- ##### SQR\n\n Sulfide: quinone oxidoreductase, is an ancient flavoprotein of the disulfide oxidoreductase family that is present in nearly all domains of life. SQRs were first found in sulfide trophic bacteria, later SQR-like enzymes were found in the mitochondria of some fungi, as well as in all animal species whose genomes have been sequenced. Several SQRs have been purified and characterized by biochemical methods. They are considered to be integral monotopic membrane proteins, associating with the membrane through amphipathic helices. The monomeric molecular mass of the enzyme is around 50 kDa. The enzyme usually harbors a covalently-bound FAD cofactor in each monomer. However, FAD can also be non-covalently bound as in the SQR of A. ferrooxidans and some other organisms.\n SQR: Some articles reported the heterologous expression of SQR gene in E. coli, and we refer to its sequence ^[3,4].\n\n- ##### SDO\n\n sulfur dioxygenase, was purified from A. ferrooxidans AP19-3, which could catalyze the oxidation of S0 to sulfite in the presence of reduced glutathione (GSH) by using Fe3+ or molecular oxygen as electron acceptor. The GSH-dependent SDO is a homodimer and the molecular mass of each subunit is approximately 23 kDa.\n SDO: An article reported the expression of SDO gene in E. coli, and we refer to its sequence ^[5].\n\n- ##### AprBA and SAT\n\n The APS pathway consists of an APS reductase (AprBA) and an ATP sulfurylase (SAT). These enzymes are involved in the dissimilatory sulfate reduction pathway in sulfate-reducing prokaryotes. SAT utilizes ATP and sulfate to generate APS which is further converted to AMP and sulfite by AprBA.\n AprBA and SAT: AprBA gene was cloned and successfully expressed in E. coli, and we refer to the sequences of AprBA and SAT ^[6,7].\n\n## Characterization of hydrogen sulfide treatment\n\nWe plan to verify the gene expression efficiency at the DNA, RNA, and protein levels and to test the ability of our bacteria to convert sulfide to sulfate in an aqueous solution.\n\n### DNA level\n\nSince the plasmid is complicated, we synthesized two plasmids, pET-SQR and pET-SDO-APR-SAT, which were assembled into the plasmid containing four genes after getting them.\n\n### RNA level\n\nWe hope to extract bacterial RNA, reverse transcribe it and then subject it to qPCR to detect gene expression. After reviewing the literature, we selected the E. coli ’s 16s gene as the internal reference gene. The primers for each gene are as follows：\n\n| Gene | 16s | SQR | SDO | Aprba | SAT |\n| ------ | ------------------------------------------------------------ | ------------------------------------------------------------ | ------------------------------------------------------------ | ------------------------------------------------------------ | :----------------------------------------------------------: |\n| Primer | 16SrRNA_ecoli_F：
CTGGAACTGAGACACGGTCC
16SrRNA_ecoli_R:
GGTGCTTCTTCTGCGGGTAA |sqr-qpcr_F:
tttatcgccttgccccagttga
sqr-qpcr_R:
ctcatagaagggctcggagaca|sdo-qpcr_F:
accgaaaccagcacctacac
sdo-qpcr_R:
ccgatccagtatgcgcagta|aprba-qpcr_F:
aacatgcgccctggatagag
aprba-qpcr_R:
gctccactgtcccgtattcc|sat-qpcr_F:
gcgccacccatttcatcatc
sat-qpcr_R:
acgcatactcgggcagaaaa|\n\nTable 1. The primer sequences for each genes\n\n### Protein level\n\nTo detect protein expression, SDS-PAGE electrophoresis was performed on bacteria after lysis.\n\n### Sulfide treatment\n\nTo verify the ability of the bacteria to convert sulfide, we want to directly detect the change of hydrogen sulfide concentration. In practice, the engineered bacteria will convert hydrogen sulfide in a liquid environment. Considering the difficulty of operation and testing, we decided to first simulate the treatment environment of hydrogen sulfide dissolved in water by adding sodium sulfide in the aqueous environment. On this basis, we create a gas-liquid coexistence environment in a certain volume container, Hydrogen sulfide is directly added to the gas for verification. We put the engineered bacteria in the reaction solution, and test the sulfide ion concentration and sulfate concentration in the liquid at different times to test the ability of our engineered bacteria to process hydrogen sulfide. For the gas-liquid coexistence system, we plan to directly extract the gas from the container to detect the concentration of hydrogen sulfide. There are many methods to detect sulfide and sulfate, according to the actual condition of our laboratory, we chose the most suitable colorimetric method ([see protocol](/Team:Tongji_China/Experiments)) of sulfide and sulfate detection for details). The method for detecting the concentration of hydrogen sulfide in the gas is to use an air pump and a detection tube for the concentration of hydrogen sulfide. This is the method selected after communicating with Professor Lv of the School of Environment.\n\n## References\n\n1. 郭晓琪, 吕永, and 覃卫星, *广州市垃圾转运站恶臭物质氨和硫化氢的含量测定.* 环境卫生工程, 2009. **17**(S1): p. 81-83+86.\n\n2. Wang, R., et al., *Sulfur Oxidation in the Acidophilic Autotrophic Acidithiobacillus spp.* Frontiers in Microbiology, 2019. **9**.\n\n3. Wakai, S., et al., *Purification and characterization of sulfide : quinone oxidoreductase from an acidophilic iron-oxidizing bacterium, acidithiobacillus ferrooxidans.* Bioscience Biotechnology and Biochemistry, 2007. **71**(11): p. 2735-2742.\n4. Zhang, Y. and J.H. Weiner, *Characterization of the kinetics and electron paramagnetic resonance spectroscopic properties of Acidithiobacillus ferrooxidans sulfide:quinone oxidoreductase (SQR).* Archives of Biochemistry and Biophysics, 2014. **564**: p. 110-119.\n\n5. Wang, H., et al., *Identification and characterization of an ETHE1-like sulfur dioxygenase in extremely acidophilic Acidithiobacillus spp.* Applied Microbiology and Biotechnology, 2014. **98**(17): p. 7511-7522.\n\n6. Valdes, J., et al., *Acidithiobacillus ferrooxidans metabolism: from genome sequence to industrial applications.* Bmc Genomics, 2008. **9**.\n\n7. Zheng, C.L., et al., *Characterization and Reconstitute of a Fe4S4 Adenosine 5 \'-Phosphosulfate Reductase from Acidithiobacillus ferrooxidans.* Current Microbiology, 2009. **58**(6): p. 586-592.\n\n\n '),this.ele=e)}}]),t}(i["a"]);Ge.id="Hydrogen",Ge=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Ge);var Ve=Ge,Ue=Ve,Ke=(t("4352"),Object(y["a"])(Ue,qe,We,!1,null,null,null)),Je=Ke.exports;T()(Ke,{VCol:W["a"],VRow:G["a"]});var $e=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"a_md",staticClass:"text-left"})])],1)},Qe=[],Ye=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.a_md;e&&(e.innerHTML=ve()('\n# **Ammonia degradation**\n\nAmmonia is also one of the main substances in the odor when wet garbage corrupting. To efficiently remove odors and make this process also beneficial to the subsequent compost utilization, we designed a degradation pathway in conjunction with the nitrogen metabolism pathway of microorganisms. ^[1]\n\n<img src="" alt="NH3通路" style="max-width:100%" />\n\nFigure 1. Microbial transformations of nitrogen compounds ^[1]\n\nBased on three principles of destination efficiency, resource utilization, and difficulty in pathway construction, we chose to oxidize ammonia to hydroxylamine, then to nitric oxide, and finally to nitrate, which is the nitrogen element flow direction that fits our goals. In this process, the three enzymes AMO, HAO and NOD are required to play their roles in sequence.\n\n<img src="" alt="NH3降解设计图" style="max-width:100%" />\n\nFigure 2. Overview of ammonia degradation pathway\n\nAs for the chassis, we also chose E. coli as a platform to test the feasibility of the pathway, and plan to optimize the selection of the chassis in the follow-up process.\n\nAmmonia is a nitrogen source favored by E. coli. ^[2] After E. coli absorbs ammonia in an aerobic environment, AMO can oxidize the ammonia into hydroxylamine. AMO has three subunits, of which amoA-amoB plays a major role in catalytic oxidation.\n\nSince the oxidation product hydroxylamine is cytotoxic to E. coli ^[3], it is necessary to further oxidize hydroxylamine to nitric oxide in time. The enzyme used in this step is HAO, which not only detoxifies E. coli, but also provides electrons to AMO when it oxidizes the hydroxylamine produced by AMO. ^[4]\n\nAt this time, the nitric oxide produced by oxidation will be further oxidized to nitrate by NOD (Nitric oxide dioxygenase), which plays an important role in the utilization of wet garbage compost. NOD activity was produced by the flavohemoglobin. When nitric oxide is present, flavohemoglobin exhibits nitric oxide dioxygenase activity. ^[5]\n\nAt this point, after the catalysis of three enzymes, the ammonia produced by the decay of wet garbage is finally oxidized into nitrate.\n\n## References\n\n1. Kuypers, M.M.M., H.K. Marchant, and B. Kartal, *The microbial nitrogen-cycling network.* Nat Rev Microbiol, 2018. **16**(5): p. 263-276.\n\n2. Reitzer, L., *Nitrogen assimilation and global regulation in Escherichia coli.* Annu Rev Microbiol, 2003. **57**: p. 155-76.\n\n3. Crossman, L.C., et al., *Heterologous expression of heterotrophic nitrification genes.* Microbiology-Sgm, 1997. **143**: p. 3775-3783.\n\n4. Sayavedrasoto, L.A., N.G. Hommes, and D.J. Arp, *Characterization of the Gene Encoding Hydroxylamine Oxidoreductase in Nitrosomonas-Europaea.* Journal of Bacteriology, 1994. **176**(2): p. 504-510.\n\n5. Gardner, P.R., et al., *Nitric oxide dioxygenase: An enzymic function for flavohemoglobin.* Proceedings of the National Academy of Sciences of the United States of America, 1998. **95**(18): p. 10378-10383.\n\n '),this.ele=e)}}]),t}(i["a"]);Ye.id="Ammonia",Ye=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Ye);var Xe=Ye,Ze=Xe,en=Object(y["a"])(Ze,$e,Qe,!1,null,null,null),nn=en.exports;T()(en,{VCol:W["a"],VRow:G["a"]});var tn=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"o_md",staticClass:"text-left"})])],1)},an=[],sn=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.o_md;e&&(e.innerHTML=ve()('\n## Optimization\n\nIn order to improve the hydrogen sulfide oxidation efficiency of our bio-engineered bacteria, we hope to further optimize the Sqr-Sdo-AprBA-Sat pathway. Increasing the enzyme concentration of the rate-limiting step can be helpful but the rate-limiting step is hard to identify in our case. High concentrations of all the four enzymes in our pathway can cause a metabolic burden to bacteria, and might also lead to the accumulation of toxic intermediate products^[1]. Considering all the factors above, we hope to optimize our pathway by making subtle control of enzyme concentration.\n\nThe enzyme concentration could be regulated by the copy number of the enzyme-encoding gene, the transcription efficiency (promoter and terminator), translation efficiency (RBS) and the degradation rate of mRNA and protein. Optimizing microorganisms for chemical production via metabolic engineering through high-strength promoters has been seen with large strain engineering efforts such as rewiring the yeast Saccharomyces cerevisiae for industrial-level heterologous artemisinin production^{[2, 3]}. Since there are a lot of available promoter libraries in iGEM parts, we decided to optimize enzyme concentration by regulating promoter strength.\n\n<img src="" alt="p1" style="max-width:100%" />\n\nFigure 1. Different ways of pathway optimization\n\nHowever, to experimentally study all possible combinations of promoters with different expression levels of enzymes can be expensive and time-consuming. Luckily, in past decades, more tools have been developed to solve this problem^[4]. Here we design a strategy, combing combinatorial random library and machine-learning, to optimize the heterologous Sqr-Sdo-AprBA-Sat pathway in E.coli efficiently. Our strategy is shown below. A random combinatorial library of plasmids, with enzymes of different expression levels, will be constructed by Gibson assembly and pre-screened according to their sulfide-degrading efficiency. Data of degradation efficiency, the growth rate of these pre-screened strains will be collected and the ANN model will then be applied to predict the optimized combination.\n\n<img src="" alt="p2" style="max-width:100%" />\n\nFigure 2. Optimization strategy\n\n[1]. Xu, P., et al., *Improving Metabolic Pathway Efficiency by Statistical Model-Based Multivariate Regulatory Metabolic Engineering.* ACS Synth Biol, 2017. **6**(1): p. 148-158.\n\n[2]. Paddon, C.J., et al., *High-level semi-synthetic production of the potent antimalarial artemisinin.* Nature, 2013. **496**(7446): p. 528-32.\n\n[3]. Deaner, M. and H.S. Alper, *Promoter and Terminator Discovery and Engineering.* Adv Biochem Eng Biotechnol, 2018. **162**: p. 21-44.\n\n[4]. Zhou, Y., et al., *MiYA, an efficient machine-learning workflow in conjunction with the YeastFab assembly strategy for combinatorial optimization of heterologous metabolic pathways in Saccharomyces cerevisiae.* Metab Eng, 2018. **47**: p. 294-302.\n '),this.ele=e)}}]),t}(i["a"]);sn.id="Optimization",sn=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],sn);var on=sn,rn=on,ln=Object(y["a"])(rn,tn,an,!1,null,null,null),cn=ln.exports;T()(ln,{VCol:W["a"],VRow:G["a"]});var hn=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"k_md",staticClass:"text-left"})])],1)},mn=[],dn=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.k_md;e&&(e.innerHTML=ve()('\n\n# The three-gear kill switch\n\nBiosafety has always been an important part in iGEM. To prevent our engineered bacteria from leaking into the environment, we designed a H₂S sensitive three-gear kill switch to ensure this. H₂S is an important factor in the working environment of our engineered bacteria, so we chose to use H₂S concentration to control the on-off of the kill switch. By searching for the biosensors of various gas molecules, we found a HS_nH-sensing biosensor (the product of SQR oxidized H₂S happens to be HS_nH) -- a gene regulator, CstR, which can sense HS_nH and turn on the expression of the downstream genes (Figure 1.)^[1].\n\n

\n<img src="" alt="文献插图" style="max-width:100%" />\n

\n\nFigure 1. the schematic presentation of CstR PR(Pcstr): the promoter which CstR can combine with and inhibit; PL: the constitutive promoter which regulate the expression of CstR\n\nIf we design a two-gear switch, namely, the switch is off when H₂S concentration is high and on when H₂S concentration is low, then we need to maintain high concentration of H₂S in the culture environment, but this is obviously not realistic. Therefore, we designed a three-gear kill switch based on the Dre/rox recombinant enzyme system ^[2](referring to the work of [the Edinburgh UG in 2017](https://2017.igem.org/Team:Edinburgh_UG)) and the MazEF toxin-antitoxin system^[3], which can achieve more flexible regulation of the survival of our engineered bacteria. (Figure 2.)\n\n<img src="" alt="自杀开关设计图" style="max-width:100%" />\n\nFigure 2. The design of our three-gear kill switch\n\nUnder the culture condition, H₂S concentration is not high enough to turn on any of the three pathways, so the bacteria will grow normally. When the concentration of H₂S is high, H₂S will remove the inhibition of CstR on the downstream gene expression by combining with it, then Dre will be expressed, and the terminator before MazF will be removed, resulting in the expression of MazF toxin. Meanwhile, due to the expression of the antitoxin MazE, the bacteria will not die. When working bacteria leak into the environment, H₂S concentration in the environment will return to the normal (low) level, the inhibition of CstR will not be removed, and MazE will no longer be expressed. At this time, because MazF has been expressed, a large amount of MazF will kill the bacteria over time. (Figure 3.)\n\n<img src="" alt="kill switch-2" style="max-width:100%" />\n\nFigure 3. The work circuit of our kill switch\n\n<img src="" alt="kill switch 动画" style="max-width:100%" />\n\n## References\n\n1. Liu, H., et al., *Synthetic Gene Circuits Enable Escherichia coli To Use Endogenous H(2)S as a Signaling Molecule for Quorum Sensing.* ACS Synth Biol, 2019. **8**(9): p. 2113-2120.\n\n2. Anastassiadis, K., et al., *Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E-coli, mammalian cells and mice.* Disease Models & Mechanisms, 2009. **2**(9-10): p. 508-515.\n\n3. Simanshu, D.K., et al., *Structural Basis of mRNA Recognition and Cleavage by Toxin MazF and Its Regulation by Antitoxin MazE in Bacillus subtilis.* Molecular Cell, 2013. **52**(3): p. 447-458.\n\n\n\n '),this.ele=e)}}]),t}(i["a"]);dn.id="Optimization",dn=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],dn);var pn=dn,un=pn,gn=Object(y["a"])(un,hn,mn,!1,null,null,null),fn=gn.exports;T()(gn,{VCol:W["a"],VRow:G["a"]});var bn=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.sectionNum=0,e.sections=[{title:"Hydrogen sulfide degradation",normalClass:"light-blue lighten-4",activeClass:"light-blue darken-3"},{title:"Ammonia degradation",normalClass:"amber lighten-4",activeClass:"amber darken-3"},{title:"Optimization",normalClass:"light-green lighten-4",activeClass:"light-green darken-1"},{title:"Kill Switch",normalClass:"lime lighten-4",activeClass:"lime darken-2"}],e}return t}(i["a"]);bn.id="Design",bn=Object(c["a"])([Object(h["a"])({components:{HPage:Je,APage:nn,OPage:cn,KPage:fn}})],bn);var wn=bn,yn=wn,vn=t("7efd"),Tn=t("9dbe"),Cn=Object(y["a"])(yn,Le,Ne,!1,null,null,null),xn=Cn.exports;T()(Cn,{VBtn:_["a"],VCol:W["a"],VRow:G["a"],VSlideGroup:vn["a"],VSlideItem:Tn["a"]});var An=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"engi",staticClass:"text-left"})])],1)},kn=[],Sn=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.engi;console.log(e),e&&(e.innerHTML=ve()('\n# Engineering #\n\n<img src="" alt="截屏2021-10-21 下午11.48.45" style="max-width:50%" />\n\n# Hydrogen sulfide degradation pathway\n\n## Design: Realization of hydrogen sulfide degradation pathway #\n\n 1. End product selection \nWe selected **sulfate**, which is non-toxic and harmless to bacteria in the working environment and has little impact on the environment, we believe it is an ideal end product for degradation.\n\n 2. Target gene selection \nWe selected four genes: **SQR**, **SDO**, **AprBA** and **SAT**(**figure 1**), which can achieve the purpose of converting sulfide to sulfate.\n\n<img src="" alt="设计图" style="max-width:100%" />\n\nFigure 1.pathway that convert sulfide to sulfate \n\n## Build: Construction of complete plasmid #\n\nWe disassembled the main part of the plasmid into two plasmids for synthesis, then added the missing parts and spliced the two plasmids together to obtain a complete plasmid with four genes. After that, we transformed it into *E. coli* DH5α for testing.\n\n<img src="" alt="S通路质粒插图-1" style="max-width:100%" />\n\nFigure 2.Construct plasmid with four genes \n\n## Test:not satisfying #\n\nWe performed **qPCR**, **SDS-PAGE electrophoresis**, detected changes in sulfide concentration to test the efficiency of gene expression and the actual effect of **hydrogen sulfide removal**, but the results were **not satisfying**.\n\n## Improve:optimization of promoter #\n\nWe revisited our design in the hope of finding the reasons for the experimental failure.\n\n 1. No bands in SDS-PAGE \n\nSDS-PAGE showed that the protein expression of our engineered bacteria isn’t difference from wild type bacteria, (**figure 3**)so we thought that maybe **our promoter was not strong enough**, resulting in too little protein expression to show the specific bands. Therefore, we decided to switch to a stronger **T7 promoter** and transformed the plasmid into *E.coli* BL21(DE3) to improve the protein expression.\n\n<img src="" alt="figure 2" style="max-width:100%" />\n\nFigure 3.SDS-PAGE of pET3a-SQR-SDO-AprBA-SAT \n\n2. Inefficiency of sulfide convert \n\nWe believe that different enzymes expressed by different genes have different efficiencies, thus only four enzymes **maintained in the right ratio** will have the best effect of sulfur removal. If one enzyme effect is outstanding, it will lead to product accumulation and the intermediate products may affect the bacteria. In the contrary, if one enzyme efficiency is too low, it will lead to a decrease in the speed of the whole processing pathway.\nIn addition, considering that our plasmids are relatively large, large amount of expression will cause a **great load on the growth of bacteria**. Thus, choosing the right promoter strength is important.\n\nTherefore, we decided to **replace different promoters for different genes and combine them to select the optimal pair**. Due to the variety of promoters, it was difficult to construct all of the plasmid. So we decided to realize this idea by [constructing a random promoter libraries](/Team:Tongji_China/Results) to find the best promoter pairing.\n\n\n\n\n\n## Design: new plasmids #\n\n1. We reconstructed four plasmids containing each of our four genes with **T7 promoter**. We also used **SDS-PAGE** to detect protein expression and test the efficiency of sulfide removal.\n\n <img src="" alt="S通路质粒插图-2" style="max-width:100%" />\n\n Figure 4. T7-SQR/T7-SDO/T7-AprBA/T7-SAT \n\n <img src="" alt="figure 3" style="max-width:100%" />\n\n Figure 5. SDS-PAGE bands \n\n2. We reconstructed the plasmid containing the four genes and **replaced the promoter of SQR with T7**, detected the protein expression using the SDS-PAGE, and carried out the experimental test of sulfide removal.\n\n <img src="" alt="S通路质粒图谱-3" style="max-width:100%" />\n\n Figure 6. T7-SQR-J23110-SDO-APR-SAT \n\n <img src="" alt="figure 4" style="max-width:100%" />\n\n Figure 7. Concentration of sulfide SASS:T7-SQR-J23110-SDO-APR-SAT;BK:blank;WT:wild type\n\n <img src="" alt="figure 4" style="max-width:100%" />\n\n Figure 6. SDS-PAGE bands SASS:T7-SQR-J23110-SDO-APR-SAT;Mix: Put the protein of four plasmids which include four genes with T7 promoter respectively\n\n3. We construct a promoter library based on this, hoping to optimize the pairing of promoters and genes.\n\n# The three-gear kill switch\n\n## Design\n\nBiosafety has always been an important part in iGEM. To prevent our engineered bacteria from leaking into the environment, we designed a H₂S sensitive three-gear kill switch to ensure this. H₂S is an important factor in the working environment of our engineered bacteria, so we chose to use H₂S concentration to control the on-off of the kill switch. By searching for the biosensors of various gas molecules, we found a HS_nH-sensing biosensor (the product of SQR oxidized H₂S happens to be HS_nH) -- a gene regulator, CstR, which can sense HS_nH and turn on the expression of the downstream genes ^[1]. \n\nIf we design a two-gear switch, namely, the switch is off when H₂S concentration is high and on when H₂S concentration is low, then we need to maintain high concentration of H₂S in the culture environment, but this is obviously not realistic. Therefore, we designed a three-gear kill switch based on the Dre/rox recombinant enzyme system ^[2](referring to the work of [the Edinburgh UG in 2017](https://2017.igem.org/Team:Edinburgh_UG)) and the MazEF toxin-antitoxin system^[3], which can achieve more flexible regulation of the survival of our engineered bacteria. (Figure 7.)\n\n<img src="" alt="自杀开关设计图" style="max-width:100%" />\n\nFigure 7. The design of our three-gear kill switch PR(Pcstr): the promoter which CstR can combine with and inhibit; PL: the constitutive promoter which regulate the expression of CstR\n\n**Expected effects:**\n\nUnder the culture condition, H₂S concentration is not high enough to turn on any of the three pathways, so the bacteria will grow normally. When the concentration of H₂S is high, H₂S will remove the inhibition of CstR on the downstream gene expression by combining with it, then Dre will be expressed, and the terminator before MazF will be removed, resulting in the expression of MazF toxin. Meanwhile, due to the expression of the antitoxin MazE, the bacteria will not die. When working bacteria leak into the environment, H₂S concentration in the environment will return to the normal (low) level, the inhibition of CstR will not be removed, and MazE will no longer be expressed. At this time, because MazF has been expressed, a large amount of MazF will kill the bacteria over time. (Figure 8.)\n\n<img src="" alt="kill switch-2" style="max-width:100%" />\n\nFigure 8. The work circuit of our kill switch \n\n**<img src="" alt="kill switch 动画" style="max-width:100%" />**\n\n **How to build**:\n\nConsidering the accessibility of the template and the time limitation, we adopted the strategy of assembling the functional components separately obtained by gene synthesis. Considering plasmid incompatibility, we chose pACYC as the vector for this part, which has a different replication system from pET-3a. Plasmids were constructed by restriction enzyme digestion and ligation and In-Fusion. The construction process we designed is shown below.\n\n<img src="" alt="质粒构建流程" style="max-width:100%" />\n\nFigure 9. The initial plasmid construction flow chart \n\n## Build\n\nUnfortunately, the synthesis of J23119-CstR-Pcstr-MazE-Dre encountered difficulty so that we couldn\'t obtain the sequence of J23119-CstR-Pcstr. Considering this part was very necessary for our work, we contacted Professor Huaiwei Liu from Shandong University based on literature and fortunately got his help. So we modified our plasmid construction. Using the plasmid(pACYC-rox-ter-rox-MazF-CstR-Pcstr-MazE-Dre) he donated as a template, we successfully amplified the CstR-Pcstr sequence(Figure 11A) and used it for our latter construction.\n\n<img src="" alt="质粒构建流程-2" style="max-width:100%" />\n\nFigure 10. The modified plasmid construction flow chart \n\nWe successfully constructed the plasmid CstR-Pcstr-MazE-Dre and amplified CstR-Pcstr-MazE-Dre(Figure 11B).Then we cloned CstR-Pcstr-MazE-Dre to pACYC-rox-ter-rox-MazF.\n\n<img src="" alt="胶图" style="max-width:100%" />\n\nFigure 11. Agarose electrophoresis \n\nHowever, according to the sequencing results, we found that Pcstr was missing (not found in the PCR product). We speculated that probably due to the complexity of Pcstr, it was moved by the leaky Dre or other enzymes after transformation. Meanwhile, we found the terminator between the two rox sites was partly moved after we cultured the final plasmid. \nFor this situation, We assumed that it could be the leakage of Pcstr that turned on the expression of Dre, which then cut off the terminator. This means we need to optimize our design. But this may prove that our Dre can cut off the sequence between rox sites correctly. If our assumption is right, namely the deletion only appears after the transformation and culture of bacteria, we can presume that the build is successful to an extent, but cannot work as expected.\n\n## Test\n\n### 1.promoter strength testing\n\nTo verify our assumption and optimize our design, we tried to find a proper combination of the three key promoters, PR(Pcstr), PL(PlacI), and J23110, by testing their strength respectively first(Figure 12.).\n\n<img src="" alt="启动子表征" style="max-width:100%" />\n\nFigure 12. The strength of the three key promoters \n\nFrom our results, we found that the intensity of Pcstr is significantly higher than J23110, and PlacI is very lower than J23110. This may explain why we encountered the leakage of Pcstr —— the inhibition of the CstR may be too low to block Pcstr while the intensity of Pcstr is at a high level. Although this is not consistent with the literature, the facts tell us that it is. \nAt the same time, we also tested a series of promoters and compared them（Figure 13.）.\n\n<img src="" alt="不同启动子" style="max-width:100%" />\n\nFigure 13. Characterization of promoters \n\n### 2.CstR with Pcstr Characterization \n\nTo ensure appropriate concentration range of S^2- used for the characterization of pACYC-rox-ter-rox-MazF-CstR-Pcstr-MazE-Dre, we first characterized the function of CstR with Pcstr using pTrchis2A-CstR-Pcstr-mKate-CpSQR. The expression level regulated by Pcstr at different concentrations of S^2- was shown by the fluorescence intensity of mKate(/OD_{600 nm}).\n\nAt the beginning, bacteria cultured in 5 mL were treated with 0, 6.5, 13.0, 26.0 and 39.0 mg/L Na₂S (0, 20, 40, 80 and 120 mg/L Na₂S·9H₂O) respectively, and then the fluorescence intensity of mKate was measured with a microplate reader(Figure 14.).\n\n<img src="" alt="CstR表征-update" style="max-width:100%" />\n\nFigure 14. The preliminary characterization of Pcstr (A)The fluorescence intensity variation relative to the concentration of Na₂S; (B)The photo of the bacteria solution treated by gradient concentrations of Na₂S; (C)The curve of fluorescence intensity relative to time; (D)The curve of OD_{600 nm} relative to time\n\nIt can be seen that the presence of S^2- at different concentrations has no significant effect on the growth of bacteria. However, with the increase of S^2-, the fluorescence intensity increases at first and then decreases, indicating that when S^2- is too high, the lifting effect on CstR inhibition is weakened. We hope to find out an appropriate concentration range in which the strength of Pcstr is positively correlated with the concentration of S^2-, which tells us that we need to reduce the concentration gradient and concentration range for further characterization. \n\nWe further used 0, 3.25, 6.50, 9.75, 13.00, 16.25 mg/L Na₂S (0, 10, 20, 30, 40 and 50 mg/L Na₂S·9H₂O) to treat 5 mL bacterial solution and then measured the fluorescence intensity of mKate using a microplate reader(Figure 15.).\n\n<img src="" alt="小梯度测试-update" style="max-width:100%" />\n\nFigure 15. The further characterization of Pcstr The fluorescence intensity variation relative to the concentration of Na₂S with a smaller range\n\nIt can be seen from the figure that in a smaller concentration range, there is a positive correlation between fluorescence intensity and Na₂S concentration, visible to naked eyes, which implies that we can use data within this concentration range to guide our characterization experiments.\n\n## Learn\n\nFrom our results, we learnt that the promoter optimization was a necessity to our design, and CstR with Pcstr could react positively to S^2- as expected but the range needed to be tested.\n\n## Design\n\nWe tended to change different promoters to test the best combination. But considering the time limitation and the heavy workload, we tried to construct a <a href="/Team:Tongji_China/Model">model</a> to simulate the process.\n\n## References\n\n1. Liu, H., et al., *Synthetic Gene Circuits Enable Escherichia coli To Use Endogenous H(2)S as a Signaling Molecule for Quorum Sensing.* ACS Synth Biol, 2019. **8**(9): p. 2113-2120.\n\n2. Anastassiadis, K., et al., *Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E-coli, mammalian cells and mice.* Disease Models & Mechanisms, 2009. **2**(9-10): p. 508-515.\n\n3. Simanshu, D.K., et al., *Structural Basis of mRNA Recognition and Cleavage by Toxin MazF and Its Regulation by Antitoxin MazE in Bacillus subtilis.* Molecular Cell, 2013. **52**(3): p. 447-458.\n '),this.ele=e)}}]),t}(i["a"]);Sn.id="Engineering",Sn=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Sn);var jn=Sn,En=jn,_n=Object(y["a"])(En,An,kn,!1,null,null,null),Pn=_n.exports;T()(_n,{VCol:W["a"],VRow:G["a"]});var zn=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"exp",staticClass:"text-left"})])],1)},On=[],Bn=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.exp;e&&(e.innerHTML=ve()("\n# Experiments Protocol\n\n## 1.**Fundamental Protocols**\n\n### **1.1 Liquid LB medium（Taking 1000 milliliters for example）**\n\n1. Prepare mixture as the following inside a conical flask.\n\n| **Components** | **Volume or mass** |\n| -------------- | ------------------ |\n| LB Broth | 25g |\n| ddH2O | 1000 mL |\n\n2. Then sterilize at 121℃ in an autoclave.\n\nNote: For selective medium, after the temperature drops below 60℃, add the corresponding antibiotic and adjust to its working concentration.\n\n### **1.2 Solid LB medium (Taking 1000 milliliters (nearly 50 dishes) for example)**\n\n1. Prepare mixture as the following inside a conical flask.\n\n| **Components** | **Volume or mass** |\n| -------------- | ------------------ |\n| Agar | 15 g |\n| LB Broth | 25g |\n| ddH2O | 1000 mL |\n\n2. Then sterilize at 121℃ in an autoclave.\n\nNote: For selective medium, after the temperature drops below 60℃ and before the medium solidifies, add the corresponding antibiotic and adjust to its working concentration .\n\n### 1.3 **Standard PCR (Taking 25 microliters for example)**\n\n1. On the ice, add all components in a PCR tube, making up to 25 µl volume reaction.\n\n| Components | Volume or mass |\n| ------------------------------------------------------------ | -------------- |\n| Template | 5-50 ng |\n| Forward primer(10μM) | 1 μL |\n| Reverse primer(10μM) | 1 μL |\n| 2 × Phanta® Master Mix
(bought from Vazyme, Number: P511-01) | 12.5 μL |\n| ddH2O | Up to 25 μL |\n\n2. Gently mix the PCR reactions and centrifuge briefly.\n3. Transfer the PCR tubes to a thermocycler.\n\nPCR program:\n\n| **Step** | **Temperature** | **Time** |\n| ------------------------ | ------------------------------------------ | ----------------------------------------------- |\n| Initial denaturalization | 95℃ | 30 s |\n| 25~35 cycles | 95℃ | 15 s |\n| \\ | Annealing temperature
depending on primer | 15 s |\n| \\ | 72℃ | Determined by the length
of amplified fragments |\n| Final Extension | 72℃ | 5 min |\n| Hold | 10℃ | ∞ |\n\n### 1.4 **1% Agarose Gel Electrophoresis（Taking 30 milliliters for example）**\n\n1. Prepare the bed in which the gel will polymerize and the comb which is suitable.\n2. Weigh 0.3 g of agarose.\n3. Add 30 mL of 1X TAE.\n4. Heat up the solution until the agarose is completely dissolved.\n5. Add 30 µL of Gel-Red SAFE DNA Gel Stain (1000*) to the solution and mix sufficiently.\n6. Pour the solution into the bed and clear all its bubbles with a tip, and then place the comb rightly and tightly.\n7. Wait for its solidification.\n8. Mix the samples with 6X DNA Loading Buffer in a 5:1 ratio. Inject the right amounts of samples into the wells, as well as DNA marker with appropriate molecular weight into the fit well.\n\n### 1.5 **DpnI Restriction Enzyme Digestion (Taking 25 microliters for example)**\n\n1. Add all the components on ice.\n\n| Components | Volume or mass |\n| ------------------------------------------ | -------------- |\n| PCR products | 25 μL |\n| DpnI
(Bought from NEB, number:#R0176V) | 0.5 μL |\n\n2. Mix gently and incubate for 1-2 hours at 37°C.\n\nNote: Incubation time varies along the total volume of the reaction.\n\n### 1.6 **Gel DNA Extraction and Purification (FastPure® Gel DNA Extraction Mini Kit)**\n\n1. After completion of DNA electrophoresis, excise band containing the target DNA fragments quickly under the ultraviolet lamp with scalpel. Weigh the gel slice in a tube (by measuring the weight difference of an empty centrifuge tube and the centrifuge tube with gel slice).\n2. Add equal volume Buffer GDP. Water bath at 55℃ for 7 to 10 min, adjust the time appropriately according to the size of the gel to ensure it dissolve completely. Mix upside down twice during the water bath to accelerate the dissolution.\n3. Centrifuge briefly to collect droplets on the tube wall. Place the FastPure DNA Mini Columns-G in a Collection Tubes, and transfer the solution (less than 700μL) to the FastPure DNA Mini Columns-G and centrifuge at 12,000 x g for 60 seconds.\n\nNote: Place the FastPure DNA Mini Columns-G in the collection tube if the volume of the solution is more than 700μL, transfer the remaining solution to the adsorption column, and centrifuge again at 12,000 x g for 60 seconds.\n\n1. Discard the filtrate and place the FastPure DNA Mini Columns-G in the collection tube. Add 300μL Buffer GDP to the FastPure DNA Mini Columns-G, and then keep still for 1 min. Centrifuge at 12,000 x g for 60 seconds.\n2. Discard the filtrate and place the adsorption column in the collection tube. Add 700μL Buffer GW (Confirm absolute ethanol has been added) to the FastPure DNA Mini Columns-G. Centrifuge at 12,000 x g for 60 seconds.\n\nNote:Adding Buffer GW along the FastPure DNA Mini Columns-G wall helps to flush the salt adhering to the tube wall completely.\n\n1. Repeat step 5.\n2. Discard the filtrate and place the FastPure DNA Mini Columns-G in the collection tube. Centrifuge at 12,000 x g for 2 min.\n3. Place the FastPure DNA Mini Columns-G in a 1.5 mL sterilized centrifuge tube, then add 20 ddH2O to the center of the FastPure DNA Mini Columns-G, place it for 2 min. Centrifuge at 12000xg for 1 min.\n\nNote:Re-added the obtained solution to the FastPure DNA Mini Columns-G so as to attain a higher yield.\n\n1. Discard the FastPure DNA Mini Columns-G and detect the concentration of DNA solution by Nanodrop spectrophotometer, then store it at -20℃ to prevent DNA degradation.\n\n### 1.7 **Two-fragment DNA homologous recombination (Vazyme ClonExpress® II One Step Cloning Kit)**\n\n1. Obtain linear vectors and inserts by PCR.\n2. Purify PCR products, and then detect concentration.\n3. The optimum cloning vector usage and insert fragment usage for ClonExpress® II recombination reaction system is 0.03 pmol and 0.06 pmol, respectively. According to this introduction,the corresponding DNA quality can be roughly calculated by following formulas.\n\nOptimal cloning vectors usage= [0.02* Base pairs number of cloning vectors] ng;\n\nOptimal inserts usage= [0.04* Base pairs number of inserts] ng.\n\nNote:Linear cloning vectors should be used between 50 and 200 ng; insert amplification products should be used between 10 and 200 ng. Select the lowest/highest amount directly when the optimal amount of DNA used exceeds this range by using the above formula.\n\n1. Arrange the following reaction systems on ice.\n\n| Components | Volume |\n| ---------------- | ------------ |\n| Linear vectors | X μL |\n| Inserts | Y μL |\n| 5 X CE Ⅱ Buffer | 4 μL |\n| Exnase Ⅱ | 2 μL |\n| ddH2O | Up to 20 μL |\n\nNote: The values of X and Y are calculated according to the formula of Step 3.\n\n2. Use a pipette to gently mix (do not shake fiercely), and centrifuge briefly to collect the reaction liquid to the bottom of the tube.\n3. React at 37℃ for 30 min, and then cool on ice.\n\n### 1.8 **Multi-fragment DNA homologous recombination (ClonExpress® MultiS One Step Cloning Kit)**\n\n1. Obtain linear vectors and inserts by PCR.\n2. Purify PCR products, then detect concentration.\n3. The optimal DNA usage for the ClonExpress® MultiS recombination reaction system is 0.03 pmol for each fragment (including linearized vector). According to this introduction,the corresponding DNA quality can be roughly calculated by the following formula.\n\nOptimal usage per fragment= [0.02*Base pairs of DNA fragment] ng.\n\nNote: Linear cloning vectors should be used between 50 and 200 ng. Select the lowest/highest amount directly when the optimal amount of DNA used exceeds this range by using the above formula. The amount of each insert should be greater than 10 ng. Use 10 ng directly when using the above formula to calculate the optimum amount of use below this value.\n\n1. Arrange the following reaction systems on ice.\n\n| Components | Volume |\n| ---------------------- | ------------ |\n| Linear vectors | X μL |\n| All inserted fragments | Y1-Yn μL |\n| 5* CE MultiS Buffer | 4 μL |\n| Exnase MultiS | 2 μL |\n| ddH2O | Up to 20 μL |\n\nNote: The values of X and Y are calculated according to the formula of Step 3.\n\n2. Use a pipette to gently suck and mix (do not shake fiercely), and centrifuge briefly to collect the reaction liquid to the bottom of the tube.\n3. React at 37℃ for 30 min, and then cool on ice immediately.\n\n### 1.9 **Bacterial Transformation**\n\n1. Add 10 μL of recombination product into 100 μL competent cell, mix gently, and then put tube on the ice for 30 min.\n2. Heat shock for 45 s at 42℃.\n3. Ice bath for 2 min.\n4. Add 900 μL antibiotic-free LB medium into the tube, 220 rpm, 37°C for 45 min, resuscitate the cell.\n5. Preheat the LB solid medium plate with corresponding antibiotics in a 37℃ incubator.\n6. Centrifuge at 8,000 rpm for 1 min and discard 900 μL supernatant.\n7. Suspend the bacteria with the remaining medium, coat the plate containing the correct resistance with a sterile coating rod gently.\n8. Inverted the culture dish in incubator at 37℃ overnight.\n\n### **1.10 Colony PCR (Taking** **10** **microliters for example)**\n\n1. On ice, add all components in a PCR tube, making up to 10 µl volume reaction.\n\n| Components | Volume or Mass |\n| --------------------------------- | -------------- |\n| Template* | 1ul |\n| F primer (10 μM) | 1 μL |\n| R primer (10 μM) | 1 μL |\n| Taq PCR Master MIX (2x, blue dye) | 5 μL |\n| ddH2O | Up to 10 μL |\n\n*Pick the colony and put it into 10ul LB medium. Take 1 ul as the template for PCR.\n\n2. Gently mix the PCR reactions and centrifuge briefly.\n3. Transfer the PCR tubes to a thermocycler.\n\nColony PCR program:\n\n| **Step** | **Temperature** | **Time** |\n| ------------------------ | ----------------------------------------- | ----------------------------------------------- |\n| Initial denaturalization | 95℃ | 30 s |\n| 25~35 cycles | 95℃ | 15 s |\n| \\ | Annealing temperature
depending on primer | 15 s |\n| \\ | 72℃ | Determined by the length
of amplified fragments |\n| Final Extension | 72℃ | 5 min |\n| Hold | 10℃ | ∞ |\n\n### 1.11 **Bacterial Glycerol Stock**\n\n1. In the clean bench, put 500 μL of bacterial overnight culture into the cryovial and add 500 μL of 40% glycerol. Mix it well.\n2. Store at -20 ℃.\n\n### **1.12 Plasmid Extraction (Vazyme FastPure® Plasmid Mini Kit)**\n\n1. Take 1 to 5 mL of overnight bacteria culture (12 to 16 h), add it into centrifuge tube (self-prepared), and centrifuge at 10,000 x g for 1 min. Discard the supernatant and pour it upside down on the absorbent paper to absorb the residual culture.\n2. Add 250μL Buffer P1 (confirm RNase A has been added) to the centrifuge tube with the bacterial sediment left, and suspend bacterial cells by vortex.\n\nNote: Complete resuspension of bacteria is critical to yield, and no bacterial clumps should be seen after resuspension.\n\n3. Add 250μL Buffer P2 and mix gently by inverting the tube 10 times.\n\nNote: Mix gently upside down. Vortex can cause genomic DNA breakage, resulting in the mixing of genomic DNA fragments in the extracted plasmid. At this time the solution became viscous and transparent, indicating that the bacteria had fully lysed. Do not take longer than 5 minutes to avoid plasmid damage.\n\n4. Add 350μL Buffer P3 and mix gently by inverting the tube 10 times to neutralize Buffer P2 completely. White flocculent precipitation should occur at this time. Centrifuge at 13,000 x g for 10 min.\n\nNote: Invert and blend immediately after adding Buffer P3, to prevent local precipitation from affecting the neutralization effect. Centrifuge again if there is still white precipitate in the supernatant.\n\n1. Place the FastPure® DNA Mini Column in a Collection Tube 2 ml collection tube. Transfer the supernatant in step 4 to the FastPure® DNA Mini Column carefully, taking care not to suck the precipitate. Then centrifuge at 13,000 x g for 60 seconds. Remove the waste from the collection tube and put the FastPure® DNA Mini Column back into the collection tube.\n2. Add 500 μL Buffer PW1 to the FastPure® DNA Mini Column. Centrifuge at 13,000 x g for 60 seconds. Discard the waste liquid and put the FastPure® DNA Mini Column back into the collection tube.\n\nNote: This step is optional. Take this step if the host bacteria are end A+ and omit it if the host bacteria are end A-.\n\n1. Add 600 μL Buffer PW2 (confirm it has been diluted with absolute ethanol) to the FastPure® DNA Mini Column. Centrifuge at 13,000 x g for 60 seconds. Discard the waste.\n2. Repeat step 7.\n3. Dry the FastPure® DNA Mini Column by centrifugation at 13,000 x g for 1 min, in order to remove the residual rinse from the FastPure® DNA Mini Column completely.\n4. Placed the FastPure® DNA Mini Column in a new sterilized 1.5 mL centrifuge tube. Add 30 to 100 μL Elution Buffer to the center of the membrane of the FastPure® DNA Mini Column. Place at room temperature for 2 min and centrifuge at 13,000x g for 1 min to elute DNA.\n\nNote: Preheating Elution Buffer to 55℃ can improve elution efficiency, in addition, re-add the obtained solution to the FastPure® DNA Mini Column and centrifuge again as step 10 can also improve elution efficiency.\n\n1. Discard the FastPure® DNA Mini Column and detect the concentration of DNA solution by Nanodrop spectrophotometer, then store it at -20℃ to prevent DNA degradation.\n\n\n\n## 2. Characterization\n\n### 2.1 Sulphate Test\n\n1. Centrifuge 1ml of the bacterial solution\n\n2. Add 52ul of hydrochloric acid\n\n3. Heat and boil to 500-800ul\n\n4. Add 50ul of barium chromate suspension (mix and add, be sure to shake well, the precipitation is generated more quickly and rapidly)\n\n5. Heat and boil\n\n6. Drop ammonia until completely discoloured, then add one more drop\n\n7. Transfer the liquid to a 1.5ml centrifuge tube and refill with distilled water to 1ml\n\n8. Centrifuge the supernatant (gently, the precipitate will disperse very easily)\n\n9. Measure absorbance at 420nm\n\n\n### 2.2 Configuration of Barium Chromate Suspension\n\n1. Take 0.835g of barium chromate, add water to 50ml, and heat.\n\n2. Wash 5 times with distilled water, 50ml each time, take the last washing solution and add sulphate to observe whether there is any precipitate (no precipitate can be washed again)\n\n### 2.3 The Promoter Repressed by CstR\n\n1. Transform the plasmid pTrchis2A-CstR-Pcstr-mKate-CpSQR into E. coli DH5α competent cells.\n2. The engineered bacteria are cultured in 25 mL LB-ampicillin (50 ng/µl) medium overnight at 37℃, 220rpm to the OD_{600 nm} is 0.4~0.5.\n3. Equally divide the culture into 15mL centrifuge tubes, which is 5mL respectively. Centrifuge them at 4000rpm for 5 minutes. Discard the liquid.\n4. Resuspend the bacteria with LB-ampicillin (50 ng/µl) .\n5. Add Na₂S·9H₂O to the LB-ampicillin, and make the final Na₂S·9H₂O concentration are 0 mg/L, 1 mg/L, 2 mg/L, 3 mg/L, 4 mg/L respectively.\n6. Collect 100 μL of all groups in the 96-well plate every 6 hours，and measure the OD_{600 nm} and the fluorescence density of mKate（Subjected to 588 nm excitation. Emission intensity at 633 nm was recorded and standardized to per OD_{600 nm}）\n\n### 2.4 The Functional Characterization of Kill Switch System:\n\n#### 2.4.1 Transform the plasmids pACYC-CstR-Dre-MazE-MazF and pET-Sqr-Sdo-AprBA-Sat into E. coli BL21(DE3) competent cells\n\n1. The engineered bacteria are cultured in 25 mL LB-CmR &Amp medium overnight at 37℃, 220rpm to the OD600nm is 0.4~0.5.\n\n2. Equally divide the culture into 15mL centrifuge tubes, which is 5mL respectively. Centrifuge them at 4000rpm for 5 minutes. Discard the liquid.\n\n3. Resuspend the bacteria with LB-CmR & Amp\n\n4. Add Na₂S·9H₂O to the LB-ampicillin, and make the final Na₂S·9H₂O concentration are 0 mg/L, 1 mg/L, 2 mg/L, 3 mg/L, 4 mg/L respectively.\n\n5. Collect 100 μL of all groups in the 96-well plate every 6 hours，and measure the OD600nm\n\n6. Dilute all of the samples to 107 times and then spread them on solid LB-CmR & Amp medium separately. Count the number of colonies in 5 cm ² per plate after cultured for 24 hours at 37℃ .Three repicas are tested in each group.\n\n\n\n### 2.5 The Functional Characterization of Hydrogen Sulfide Oxidation in Liquid Environment\n\n#### 2.5.1 **Reagents Preparation**\n\n200 mL 2% glucose：4 g glucose + 200 mL dH2O\n\n1 mol/L Dilute sulfuric acid\n\n1 mol/L Sodium sulfide solution\n\nAnhydrous calcium chloride\n\nBlue litmus paper\n\nDetection reagent I\n\nDetection reagent II\n\n#### 2.5.2 **Preparation of hydrogen sulfide gas**\n\n1. Add dilute sulfuric acid dropwise to the sodium sulfide solution, and pass the generated gas through a drying tube filled with anhydrous calcium chloride to remove water\n\n2. Collect the dried gas with a 200ml gas collection bag\n\n#### 2.5.3 **Removal and detection of hydrogen sulfide gas**\n\n1. The strains were cultured in 20mL medium at 37 ℃ for 10 h；\n2. Add 200 μL 100mM IPTG；contimue to develop for 4 h；\n3. Take 20 mL medium，centrifuge at 4000 rpm for 5min，abandon supernatant. Add 2 mL 2% glucose to wash off the residual medium，centrifuge at 4000 rpm for 5min，abandon supernatant.\n4. Add 12 mL 2% glucose ，Adjust OD600 in each tube with the aid of microplate reader；\n5. Take 10 mL resuspended bacterial solution, use a syringe to inject 0.2ml of hydrogen sulfide gas above the liquid surface；\n6. Put the test tube in a shaker and shake at 37 degrees Celsius for two hours\n7. After thoroughly shaking the liquid in the test tube, suck up 750 ul of bacterial liquid, add 25 μL Detection reagent I and II to the remaining liquid，centrifuge at 8000 rpm for 2 min；\n8. After all groups are completely colored, take 200 μL for each tube and measure at 665nm.\n\n### 2.6 The Functional Characterization of **Sulfur Ion Oxidation in Liquid Environment**\n\n#### 2.6.1 **Reagents** **Preparation**\n\n300 mL 2% glucose：6 g glucose + 300 mL dH2O\n\n10 mL 100 mM Na2S：0.24 g Na2S·9 H2O + 10 mL dH20\n\nglucose & Na2S Mixed liquid：100 mL 2% glucose + 200 μL 100 mM Na2S\n\nDetection reagent I\n\nDetection reagent II\n\n#### 2.6.2 **operation**\n\n1. The strains were cultured in 20mL medium at 37 ℃ for 10 h；\n\n2. Add 200 μL 100mM TPTG；contimue to develop for 4 h；\n\n3. Take 15 mL medium，centrifuge at 4000 rpm for 5min，abandon supernatant. add 2 mL 2% glucose to wash off the residual medium，centrifuge at 4000 rpm for 5min，abandon supernatant.\n\n4. Add 8 mL 2% glucose ，Adjust OD600 in each tube with the aid of microplate reader；\n\n5. Take 7.5 mL resuspended bacterial solution, add 7.5 mL glucose & Na2S Mixed liquid；\n\n6. Divide the bacterial solution into 2 ml / tube, each group into 7 tubes;\n\n7. Put the sub packed bacterial solution into the shaking table and take a group every 30 minutes to detect sulfur ions;\n\n8. After taking out the bacterial solution, centrifuge at 8000 rpm for 5 min, take 1.3 ml of supernatant and put it into 4 ℃ to be sent to teacher Lv fan's Laboratory for anion detection;\n\n9. Add 25 μL Detection reagent I and II to the remaining liquid，centrifuge at 8000 rpm for 2 min；\n\n10. After all groups are completely colored, take 200 μL for each tube to measure od665.\n\n### 2.7 SDS-PAGE\n\n#### 2.7.1 **Reagents** **Preparation**\n\n1×SDS loading buffer\n\n100 mM IPTG ：0.2383 g IPTG + 10 mL ddH2O\n\nMarker：EpiZyme WJ 103\n\nCBB Fast Staining Solution\n\n#### 2.7.2 **Protein Extraction**\n\n1. The strains were cultured in 5mL medium at 37 ℃，220rpm；\n\n2. After developing for 11 h，add 50 μL 100 mM IPTG；Continue to develop for 4 h\n\n3. Take 0.5 mL medium，centrifuge at 4000 rpm for 5min，abandon supernatant；\n\n4. Add 100 μL 1×SDS loading buffer to resuspended cells；\n\n5. Cell lysis by ultrasound；\n\n6. Heating at 95 ℃ for 10min；\n\n7. Centrifuge at 12,000 rpm，4℃ for 15min，take the supernatant。\n\n#### 2.7.3 Sample loading\n\n1. Protein sample： 10 μL extracted protein\n\n2. marker：EpiZyme WJ 1035μL+1×SDS 5 μL\n\n3. Blank holes：10 μL 1×SDS\n\n#### 2.7.4 Set the program\n\n1. Run at 80V till the strips move to the junction of separated gel and concentrated gel；Then run at 120V till the end；\n\n\n#### 2.7.5 **CBB Fast Staining**\n\n1. Take out the gel，heat in clear water in microwave oven to boil for 60s，put on shaking table at 50 rpm for 5 min；\n\n2. Remove the waste liquid and add the dye to immerse the gel，heat in microwave oven to boil for 60s，put on shaking table at 50 rpm for 5 min；\n\n3. Recover the dye solution and immerse the gel with clean water，heat in microwave oven to boil for 60s，put on shaking table at 50 rpm for 5 min；repeat untill the background is Colorless.\n\n ### 2.8 RT-qPCR\n\n#### 2.8.1 **Reagents**\n\n#### For **RNA Extraction**\n\nRNA isolater Total RNA Extraction Reagent\n\nIsopropyl alcohol\n\nchloroform\n\n75% ethanol\n\nddH2O\n\n#### **For RT-qPCR：**\n\nTaKaRa PrimeScriptTMRT reagent Kit with gDNA Eraser\n\niTaq™ Universal SYBR® Green Supermix\n\n#### 2.8.2 **Operation**\n\n#### (1) **RNA Extraction**\n\n1. The strains were cultured in 5mL medium at 37 ℃ for 14 h；\n2. Take 3 mL medium，centrifuge at 4000 rpm for 5min，abandon supernatant；\n3. Add 1 mL RNA iso to resuspended cells，transfer into 1.5 ml EP tube and stand on ice for 5min;\n4. Centrifuge at 12,000 rpm，4℃ for 15min，transfer the supernatant into a new 1.5 ml EP tube；\n5. Add 200 μL CHCl3，vibrate for 15s，stand on ice for 10min；\n6. Centrifuge at 12,000 rpm，4℃ for 15min，take 400 μL supernatant and add 400 μL Isopropyl alcohol；store at -80℃ for 40min；\n7. Centrifuge at 12,000 rpm，4℃ for 15min；abandon supernatant，add 1 mL 75% ethanol to the sediment，Centrifuge at 12,000 rpm，4℃ for 5min；abandon supernatant；\n8. add 1 mL 75% ethanol to the sediment again，Centrifuge at 12,000 rpm，4℃ for 5min；abandon supernatant；\n9. Centrifuge at 12,000 rpm，4℃ for 2min，siphon off the residual ethanol，place the sample in an ultra-clean platform to dry for 10min；\n10. Add 20 μL dH2O to dissolve RNA\n\n#### (2) Reaction System\n\n| Reagents | Dosage |\n| --------------------------- | ---------------- |\n| 5× PrimeScript Buffer | 2μL |\n| PrimeScript RT Enzyme Mix I | 0.5μL |\n| Oligo dt Primer | 0.5μL |\n| Random 6 mers | 0.5μL |\n| RNA | 500ng |\n| ddH2O | Make up to 10 μL |\n\n#### (3) **RT-PCR** program：\n\n| Temperature | Time |\n| ----------- | ----- |\n| 37℃ | 15min |\n| 85℃ | 15s |\n| 4℃ | ∞ |\n\n#### (4) qPCR reaction system;\n\n| Reagents | Dosage |\n| ------------------------------------ | ------ |\n| cDNA | 2μL |\n| iTaq™ Universal SYBR® Green Supermix | 5μL |\n| Forward Primer | 0.1μL |\n| Reverse Primer | 0.1μL |\n| H2O | 2.8μL |\n\n#### (5) qPCR program\n\n| Step | Temperature | Time |\n| ------------------ | ----------- | ---------- |\n| 1 | 95℃ | 20s |\n| 2 | 95℃ | 10s |\n| 3 | 60℃ | 20s |\n| 4 | 68℃ | 5s |\n| 5：back to step2 | | 35 cycles |\n| 6 | 95℃ | 1 min |\n| 7 | 60℃ | 30s |\n| 8 | 95℃ | 30s |\n\n### **2.9 Characterization of promoter strength**\n\n1. Transfer promoter-mRFP plasmid to BL21(DE3) or DH5α, coat plates and select monoclonal colony.\n\n2. Culture the bacteria from monoclonal colony in Amp LB medium overnight.\n\n3. Adjust the bacteria concentration using Amp LB to OD600=0.4. Culture in 37 ℃ 220 rpm till OD600=0.7.\n\n4. Inoculate the bacterial solution into a 96-well plate in the manner of 100 μL/well, with 3 groups of parallel. Measure the OD600 and fluorescence intensity (excitation: 535nm. Emission: 620 nm) of the plates by the Microplate spectrophotometer.\n\n5. Calculate the relative fluorescence.\n\n### 2.10 **Random library construction**\n\n#### 2.10.1 Promoter library construction\n\n1. Mix promoter templates with equal molar quantities ( 10 ng each). Make sure the added volume is larger than 1 μl. Dilute the mixed templates to 5-50ng.\n\n2. Perform standard PCR.\n\n3. Purify PCR product by gel extraction kit and measure concentration of PCR product by Nanodrop.\n\n#### **2.10.2 Gene CDS preparation**\n\n1. Perform standard PCR with high fidelity enzyme.\n\n2. Purify PCR product by gel extraction kit and measure concentration of PCR product by Nanodrop.\n\n#### **2.10.3 Five sequences recombination**\n\n1. Preform five sequences assembly using Vazyme ClonExpress® II One Step Cloning Kit, according to instructions.\n\n2. Transfer the recombination product to DH5α and culture with CmR LB (chloramphenicol resistant backbone) overnight.\n\n3. Perform plasmid extraction using Vazyme FastPure® Plasmid Mini Kit, according to instructions.\n\n4. Perform standard PCR with high fidelity enzyme, using the mixed plasmids. Purify PCR product (2300bp and 2700 bp in this case) with gel extraction kit.\n\n#### **2.10.4 Three sequences recombination**\n\n1. Preform three sequences assembly using Vazyme ClonExpress® II One Step Cloning Kit, according to instructions.\n\n2. Transfer the recombination product to BL21 and coat plates (ampicillin resistance). Select monoclonal for colony PCR and further study.\n\n\n "),this.ele=e)}}]),t}(i["a"]);Bn.id="Exp",Bn=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Bn);var Hn=Bn,Fn=Hn,Mn=Object(y["a"])(Fn,zn,On,!1,null,null,null),Rn=Mn.exports;T()(Mn,{VCol:W["a"],VRow:G["a"]});var Dn=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"notebook",staticClass:"text-left"})])],1)},In=[],Ln=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.notebook;console.log(e),e&&(e.innerHTML=ve()("\n\n# Notebook\n\nOur experiments can be mainly divided into three parts——hydrogen sulfide oxidization module, pathway optimization and kill switch, which are done in parallel. You can see what we have done by week below.\n\n## **Week 1**: 7.18-7.24\n\n### Hydrogen sulfide oxidization module\n\nPick monoclonal\n\n### Pathway optimization\n\nHaven't started yet\n\n### Kill switch\n\nHaven't started yet\n\n\n\n## **Week 2**: 7.25-7.31\n\n### Hydrogen sulfide oxidization module\n\nAddition of terminator to plasmid pET3α-SQR\n\n### Pathway optimization\n\nHaven't started yet\n\n### Kill switch\n\nHaven't started yet\n\n\n\n## **Week 3**: 8.1-8.7\n\n### Hydrogen sulfide oxidization module\n\nAdd terminator to plasmid pET3α-SQR\n\n### Pathway optimization\n\nHaven't started yet\n\n### Kill switch\n\nHaven't started yet\n\n\n\n## **Week 4**: 8.8-8.14\n\n### Hydrogen sulfide oxidization module\n\nAdd terminator to plasmid pET3α-SDO-APR-SAT\n\n### Pathway optimization\n\n- Prepared plasmids containing promoters with different strength from Anderson library.\n\n- Prepared promoters and genes sequences for homologous recombination.\n\n### Kill switch\n\nObtained the synthesized plasmid pACYC-rox-ter-rox-MazF\n\n\n\n## **Week 5**: 8.15-8.21\n\n### Hydrogen sulfide oxidization module\n\n- SDS and qPCR pre-experiments\n\n- Construction of pET3α-SQR-SDO-APR-SAT plasmid\n\n### Pathway optimization\n\n- Performed the first-round and second-round assembly.\n\n- Tested solid medium containing sulfide.\n\n### Kill switch\n\nB1006 was successfully connected to pACYC-rox-ter-rox-MazF\n\n\n\n## **Week 6**: 8.22-8.28\n\n### Hydrogen sulfide oxidization module\n\n- Construction of pET3α-SQR-APR, pET3α-SQR-SDO-APR plasmids\n\n- Characterization of plasmids with sulfide treatment\n\n### Pathway optimization\n\n- Prepared promoters sequences for homologous recombination.\n\n- Performed the second-round assembly.\n\n### Kill switch\n\nMazF was replaced with mRFP in pACYC-rox-ter-rox-MazF for later possible characterizations\n\n\n\n## **Week 7**: 8.29-9.4\n\n### Hydrogen sulfide oxidization module\n\n- Construction of four plasmids: pET28a-T7-SQR, pET28a-T7-SDO, pET28a-T7-APR, pET28a-T7-SAT\n\n- The mRNA level of the target gene was detected to prove that the target gene can be transcribed normally.\n- The protein level of the target gene was detected. The band of the target protein could not be found by Coomassie brilliant blue staining. It was speculated that the expression was not high, and the target protein could not be distinguished from other proteins expressed by E. coli itself by ordinary staining.\n\n### Pathway optimization\n\n- Improved the library construction strategy, using plasmids backbone with different resistance gene in the first and second round respectively to decrease background.\n- Performed colony PCR on the library.\n\n### Kill switch\n\nAmplified rox-ter-rox-MazF and assemble it to pET-28a（+），but failed,because of the deletion caused by PCR.\n\n\n\n## **Week 8**: 9.5-9.11\n\n### Hydrogen sulfide oxidization module\n\n- Construction of plasmids with T7 promoter for all four genes\n\n- The accuracy of sulfur ion detection kit was verified and the standard curve was drawn\n- The ability of engineering bacteria to oxidize sulfur ions in sulfur ion culture medium was tried, and the experimental results were poor. It was found that the existence of LB medium would affect the change of sulfur ion concentration. Subsequent experiments were prepared to transfer the bacteria to glucose solution to verify its function\n- In this attempt to verify the protein expression, it is found that the E. coli strain used is wrong, and the plasmid will be transferred to the appropriate strain to try again\n\n### Pathway optimization\n\n- Improved the primers for promoters. Prepared promoters sequences.\n\n- Promoters characterization.\n\n- Performed first-round assembly and sequencing.\n\n### Kill switch\n\nAssembled lacI with the promoter repressed by it to pACYC-rox-ter-rox-MazF\n\n\n\n## **Week 9**: 9.12-9.18\n\n### Hydrogen sulfide oxidization module\n\n- Constructed four plasmids with T7 promoter\n\n- The plasmid was transferred into BL21 strain. The results of protein electrophoresis showed that the four target proteins could be expressed normally in E. coli\n- New protein function verification methods have been tried, but no effective characterization scheme has been found.\n\n### Pathway optimization\n\n- Promoters characterization.\n\n- Improved the library construction strategy to get more specific PCR product for the second-round assembly.\n\n### Kill switch\n\n- Used the restriction enzymes to get the rox-ter-rox-MazF fragment and cloned it into\n\npET-28a（+）but failed\n\n- Obtained the plasmid pTrchis2A-CstR-Pcstr-mKate-CpSQR（pTrchis2A-lacI-cstR-trc-op2-op1-op2-mkate-Cpsqr） which contains the CstR and the promoter regulated by it from Professor Liu in Shandong University\n- Obtained the synthesized plasmid pKMV-Dre-MazE from the BGI\n- B1006 was successfully connected to pKMV-Dre-MazE\n\n\n\n## **Week 10**: 9.19-9.25\n\n### Hydrogen sulfide oxidization module\n\nConstruct plasmids with T7 promoter in all four genes\n\n### Pathway optimization\n\n- Constructed the J23119-B0034-mRFP-B1006 plasmid.\n\n- Improved the homologous arms to get higher recombination efficiency.\n\n- Prepared promoters and genes sequences for homologous recombination.\n\n- Modeling:\n\n - Literature research on different machine learning model.\n\n - Tested the ANN model.\n\n### Kill switch\n\nCharacterization of pTrchis2A-lacI-cstR-trc-op2-op1-op2-mkate-CnSqr to observe the function of the CstR\n\n\n\n## **Week 11**: 9.16-10.2\n\n### Hydrogen sulfide oxidization module\n\n- Constructed pET3α-T7-SQR-J23119-SDO-APR-SAT plasmid\n\n- A better characterization system was found and the experimental conditions were further improved\n- Combined with the new characterization scheme, the standard curve of sulfur ion detection was improved\n\n### Pathway optimization\n\n- Performed the first-round and second-round assembly.\n\n- Performed colony PCR and sequencing on the library.\n\n- Tested the pre-screen method in 96-wells plate.\n\n### Kill switch\n\n- Amplified the CstR-Pcstr from pTrchis2A-lacI-cstR-trc-op2-op1-op2-mkate-CpSqr and constructed the plasmid pKMV-CstR-Pcstr-Dre-MazE\n\n\n- Went on the characterization of pTrchis2A-lacI-cstR-trc-op2-op1-op2-mkate-CpSqr\n\n\n\n## **Week 12**: 10.3-10.9\n\n### Hydrogen sulfide oxidization module\n\n- Replace the promoter of HrtR gene on Heme-GFP plasmid with J23100, J23110, J23116\n\n- The ability of engineering bacteria to oxidize sulfur ions in liquid environment was repeatedly verified\n\n- The ability of simulated engineering bacteria to oxidize hydrogen sulfide in food waste environment was verified\n\n### Pathway optimization\n\n- Constructed the ODE model.\n\n- Constructed the cellular automation model.\n\n### Kill switch\n\n- Constructed the plasmid pACYC-rox-ter-rox-MazF-CstR-Pcstr-Dre-MazE but there was a deletion in Pcstr.\n\n- Constructed the plasmids of mRFP connected with Pcstr, PlacI and J23110 respectively，and characterized the strength of them.\n\n## Week 13: 10.10-10.16\n\n### Hydrogen sulfide oxidization module\n\n* Proved that it is feasible to add hydrogen sulfide gas to the gas-liquid coexistence system, and the detection method and results are reasonable and repeatable\n* The ability of engineering bacteria to oxidize sulfur ions in gas-liquid coexistence environment was initially verified\n\n\n "),this.ele=e)}}]),t}(i["a"]);Ln.id="Notebook",Ln=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Ln);var Nn=Ln,qn=Nn,Wn=Object(y["a"])(qn,Dn,In,!1,null,null,null),Gn=Wn.exports;T()(Wn,{VCol:W["a"],VRow:G["a"]});var Vn=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-1"}),t("v-col",{staticClass:"col-10"},[t("div",{ref:"parts",staticClass:"text-left"})])],1)},Un=[],Kn=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.parts;e&&(e.innerHTML=ve()("\n| Basic Parts | Description |\n| ------------------------------------------------------- | ------------------------------------------------------------ |\n| [BBa_K3823001](http://parts.igem.org/Part:BBa_K3823001) | SQR(Sulfide: Quinone Oxidoreductase) from Acidithiobacillus spp. |\n| [BBa_K3823002](http://parts.igem.org/Part:BBa_K3823002) | SDO(sulfur dioxygenase) from Acidithiobacillus spp. |\n| [BBa_K3823003](http://parts.igem.org/Part:BBa_K3823003) | AprBA(APS reductase) from Acidithiobacillus spp. |\n| [BBa_K3823004](http://parts.igem.org/Part:BBa_K3823004) | SAT(ATP sulfurylase) from Acidithiobacillus spp. |\n| [BBa_K3823006](http://parts.igem.org/Part:BBa_K3823006) | CstR，A transcription factor sensing hydrogen sulfide |\n| [BBa_K3823008](http://parts.igem.org/Part:BBa_K3823008) | Pcstr: an artificial hydrogen sulfide sensitive promoter with binding sequences of CstR |\n| [BBa_K3823011](http://parts.igem.org/Part:BBa_K3823011) | Sqr from C. pinatubonensis |\n\n\n
\n
\n
\n\n| Composite Parts | Description |\n| ------------------------------------------------------------ | ------------------------------------------------------------ |\n| [BBa_K3823009](http://parts.igem.org/Part:BBa_K3823009) | SQR-SDO-AprBA-SAT |\n| [BBa_K3823014]([Part:BBa K3823014 - parts.igem.org](http://parts.igem.org/Part:BBa_K3823014)) | T7-SQR-J23110-SDO-AprBA-SAT |\n| [BBa_K3823012](http://parts.igem.org/Part:BBa_K3823012) | hydrogen sulfide sensitive, three-gear adjustable kill switch |\n| [BBa_K3823010](http://parts.igem.org/Part:BBa_K3823010) | MazE antitoxin and Dre recombinase regulated by a hydrogen sulfide switch |\n\n "))}}]),t}(i["a"]);Kn.id="Parts",Kn=Object(c["a"])([h["a"]],Kn);var Jn=Kn,$n=Jn,Qn=Object(y["a"])($n,Vn,Un,!1,null,null,null),Yn=Qn.exports;T()(Qn,{VCol:W["a"],VRow:G["a"]});var Xn=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"poc",staticClass:"text-left"})])],1)},Zn=[],et=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.poc;console.log(e),e&&(e.innerHTML=ve()('\nOur experiment has preliminarily proved the possibility of using engineered bacteria to remove sulfide ion in liquid and hydrogen sulfide in gas-liquid coexistence environment to reduce odor. However, this is not enough to indicate that our engineered bacteria can be effective in the actual application environment. As in the actual use process, in addition to temperature, humidity, solution osmotic pressure and other conditions will change. And more importantly, our engineered bacteria will have to face competition with indigenous bacteria, which will bring great challenges to our engineered bacteria to function according to their primary settings.\n\n\n\n## Basic verification\n\nThrough RT-qPCR experiment and SDS-PAGE experiment, we preliminarily verified that the four genes can be transcribed and translated normally in E. coli.\n\nWe configured a series of sodium sulfide solutions with concentration gradient and tested them with detection reagents according to certain methods. The standard curve obtained is ideal. It can be considered that our detection method can accurately reflect the relative content of sulfide in the solution within this concentration range.\n\n(More relative experiment details can be found in [result](/Team:Tongji_China/Results).\n\n##**Protein function verification**\n\nIn view of the the limiting capacity of our laboratory to detect the intermediates in the sulfide oxidation pathway, we mainly verified the function of our engineered bacteria from the oxidation level of sulfide and the generation level of sulfate.\n\n###**1. Sulfide oxidation in liquid environment**\n\nWe put the engineered bacteria and wild-type bacteria into a certain concentration of sodium sulfide solution, take out the bacterial solution every 30 min to detect the residual sulfide concentration. The results show that our engineered bacteria can oxidize sulfide better. (because the bacteria have a certain adsorption effect on sulfide, the initial sulfur ion concentration of the two groups of added bacterial solution is lower than blank)\n\n<img src="" alt="-163449635323611" style="max-width:100%" />\n\nFigure 2. Concentration of S^2- in liquid environment with different bacteria. ( SSAS: pET3a-T7-SQR-J23110-SDO-J23110-APR-J23110-SAT； WT: Wild Type； BK: Blank )\n\n### **2. Sulfide oxidation in gas-liquid coexistence environment**\n\nSince it is hydrogen sulfide gas that causes the sense of smell and damages people’s health in the actual situation, we are desire to further simulate the situation where hydrogen sulfide gas already exists and there is a solution equilibrium between liquid and gas phase. One difficulty of gas reaction is to establish a reasonable reaction system and detection plan. We refer to the previously successful experimental system of sulfur ion removal in a liquid environment, and inject an appropriate amount of hydrogen sulfide gas into the gas in the closed centrifuge tube, and test the concentration of sulfide ions in the liquid. In view of the fact that the solution is not saturated at this time, the concentration of sulfide ions in the solution can reflect the amount of residual sulfide ions in the entire system. \n\nIt can be observed that the residual sulfide ions in the system with engineered bacteria are less, while the sulfide ions in the system inoculated with wild-type strains are relatively more, indicating that our engineered bacteria also show a certain degree of hydrogen sulfide treatment ability in a gas-liquid coexistence environment. However, it is worth pointing out that the difference between the engineered bacteria and the wild type is not quite obvious, which is the part we will continue to explore and improve in the future.\n\n(More relative experiment details can be found in [result](/Team:Tongji_China/Results).\n\n### **3. Hydrogen sulfide oxidation in simulated food waste environment**\n\nIn order to test whether our engineered bacteria can work efficiently in a more complex and competitive environment, we built an easy-to-operate reaction system that can well simulate the actual wet waste composting process.In this system, we was pleasantly surprised to discover our engineered bacteria still work. \nAlthough there are still many conditions that need to be explored and continuously improved, we have every reason to believe that our design will be able to fully achieve our expected goals-like\'LOOK! ’(Little Odor Killer) works the same. After reading this, you may be very curious about how we did the proof of concept. Let us use 5 ‘H’ （How）to satisfy your curiosity.\n\n- #### **How do we conduct proof-of-concept experiments?**\n\nConstructing a reasonable reaction system is the first step in the proof of concept. We use eggs to represent the wet garbage mixture, and directly put our engineered bacteria in the egg liquid, simulating the process of putting the bacteria in the wet garbage in the actual application scenario. We put each reaction system in an incubator for fermentation, and measure the hydrogen sulfide removal ability of engineering bacteria by detecting the sulfide ion concentration in the mixture after a period of time.\n\n- #### **How do we check the experimental results and what kind of results have been obtained?**\n\nAs a bacterial agent with hydrogen sulfide treatment capability, our engineered bacteria can theoretically not only reduce the odor of wet garbage before it been released to the environment, but also effectively control the hydrogen sulfide gas that has been produced and diffused in wet garbage. In practical applications, the former is more fundamental, while the latter is more targeted. However, in the laboratory inspection process, taking into account the gas diffusion properties, the former method can be used to more accurately check the hydrogen sulfide processing capacity of the engineering bacteria in the reaction system. It is not difficult to understand that after the same time of cultivation, the group inoculated with wild-type strains should contain more hydrogen sulfide or sulfide ions than the group inoculated with engineered bacteria.\nThe experimental results perfectly meet this expectation. From the figure, we can clearly see that the group inoculated with wild-type strains showed a darker blue color in the methylene blue reaction, indicating that the system contained more sulfide ions. However, due to time constraints, we did not have time to repeat this experiment many times, which is what we need to further improve in our follow-up work.\n\n<img src="" alt="鸡蛋液-16346659014661" style="max-width:100%" />\n\nFigure 4. Existence of S^2- in egg liquid with different bacteria. ( SSSAS: pET3a-T7-SQR-J23110-SDO-J23110-APR-J23110-SAT; WT: Wild Type）\n\n- #### How do the eggs simulate the wet garbage environment and make the verification process easy to operate and repeatable?\n\nAs we mentioned in the [description](/Team:Tongji_China/Description) page, the main contributors to odorous gases in wet garbage are hydrogen sulfide and ammonia, and the main source of the former is sulfur-containing amino acids in wet garbage. As a kind of high-protein content, cheap and easy-to-obtain food, eggs are a very good source of sulfur-containing amino acids, which can well represent high-protein foods that contribute hydrogen sulfide gas in wet garbage. Moreover, the egg liquid is easy to mix and transfer, which can ensure the uniformity and consistency of the composition of each group in the experiment as much as possible, making our experimental results more reliable and reproducible.\nIn order to make the composition of the bacteria in the reaction system at the beginning of the experiment as consistent as possible in the real life situation, we obtained egg liquid and placed it in the daily life area for a few minutes, and then inoculated the engineered bacteria or the wild-type strain for subsequent steps.\n\n- #### How should we put engineering bacteria?\n\nAs we said, putting our engineered bacteria at different times can have different effects. Early injection can more effectively reduce hydrogen sulfide overflow, while after the odor is generated, a certain odor will inevitably be emitted. However, the factors that need to be considered for these two methods of use are also various. For the former, we need to consider more about whether our engineered bacteria can settle in the wet garbage, multiply and play a role in the composting process; while for the latter, we can use the engineered bacteria when they are cultivated to a good states, which is relatively more flexible. \nDeciding how to use the bacterial agent needs to integrate various factors. In addition to the efficiency of treating odor, the ease of use, cost, safety, etc. must also be considered. The experimental results of our proof-of-concept can give a preliminary indication of the treatment efficiency under the two delivery methods, especially in the case of the inoculant at the beginning of wet waste composting, and provide guidance for our hardware design and actual use.\n\n- #### How will the experiment and project design of the proof-of-concept part be further improved?\n\nAlthough we have obtained preliminary but expected results, further repeated verification is essential. On this basis, the optimization of reaction methods, reaction conditions, detection methods, etc. all need to be further carried out. For example, we will try to add other wet garbage to the reaction system to more realistically simulate the actual situation. In addition, different delivery methods, factors affecting processing efficiency, etc., are all we strongly hope to explore further.\n\n\n\n '),this.ele=e)}}]),t}(i["a"]);et.id="POC",et=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],et);var nt=et,tt=nt,it=Object(y["a"])(tt,Xn,Zn,!1,null,null,null),at=it.exports;T()(it,{VCol:W["a"],VRow:G["a"]});var st=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"safety",staticClass:"text-left"})])],1)},ot=[],rt=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.safety;console.log(e),e&&(e.innerHTML=ve()('\n\n# Safety\n\nTeam Tongji_China obeys the **safety policy of iGEM 2021**. All the experiments were done in the Open Laboratory of Innovation Practice for College Students. All the equipment and devices belonged to **bio-safety level 1**, and reagent cabinet was equipped for storing hazardous reagents.\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:50%" />\n\nOur laboratory\n\nWe have established detailed **laboratory safety rules**, which were revised by our advisors, instructor and PI. All the team members taking part in experiments were required to obey the laboratory safety rules.\n\n<img src="" style="max-width:100%" />\n\nStudents are learning about safety training\n\nBefore the experiments began, all the members were required to attend to the **safety training** of the school. Advisors and instructor also imparted proper experimental operations of equipment (such as PCR amplifier, clean bench and autoclave) and reagents (such as NaOH and nucleic acid dye). All the equipment in the lab would be regularly checked. All the experiments must be done when there are more than two people.\n\n<img src="" style="max-width:100%" />\n\nStudents are doing experiments in the clean bench\n\nDuring the stage of project design, the usage of pathogenic bacteria would be avoided. Bacterium-polluted wastes were stored separate from other experimental wastes and would be sterilized before abandoning, to avoid GMO leak to the environment.\n\n## Project safety\n\nOur project in iGEM 2021 is trying to solve odor problems caused by food waste. We construct two kinds of bioengineered E.coli to absorb H2S and NH3, which are the two main ingredients in the odor. Given that the targets we are dealing with have a close relationship with people, we \'ve considered thoroughly the safety of our project.\n\n#### Chassis organism：*Escherichia coli* TOP10,*Escherichia coli DH5alpha and Escherichia coli BL21(DE3)*\n\nAll the E.coli strains we used in experiments belong to risk group 1, namely do not cause disease in healthy adult humans.\n\n#### Chemicals:\n\nThe expression of our plasmids needs some harmful chemicals like H2S and Na2S. But we\'ve conducted a series of protective actions like wearing masks. Also, the concentration of the chemicals won\'t be too high to do harm to people\'s health.\n\n#### Killing switch\n\n#### Kill switch\n\nIn order to avoid the leakage of our bioengineered bacteria into the environment, we\'ve designed a three-gear adjustable kill switch. Since H₂S is an important variable in the working environment of our engineered bacteria, we chose H₂S concentration to control the on-off of the kill switch. After reading literature, we chose CstR, a gene regulator, to be the biosensor. CstR can detect the concentration of HS_nH,the oxidization product of H₂S by SQR, and adjust the expression of downstream genes.\n\nHowever, if there\'s only CstR to adjust the living conditions of our bacteria, we have to cultivate them with high concentration of H₂S. Therefore, we designed a three-gear kill switch based on the Dre/rox recombinant enzyme system ^[1](referring to the work of [the Edinburgh UG in 2017](https://2017.igem.org/Team:Edinburgh_UG)) and the MazEF toxin-antitoxin system^[2], which can achieve more flexible regulation of the survival of our engineered bacteria. (Figure 2.)\n\nUnder cultural conditions, none of the pathway can be activated. When the bioengineered bacteria are put into work, high density of hydrogen sulfide in the environment induces the expression of Dre recombinase and MazE (antitoxin), followed by terminator removal and MazF (toxin) expression. Once our bioengineered bacteria leak to the environment, low density of hydrogen sulfide inhibits MazE (antitoxin) expression. Without the rescue of MazE(antitoxin), bioengineered bacteria will be killed by the accumulation of MazF (toxin). In this way ,we succeed in adjusting the survival and death of the bacteria by adjusting the concentration of H₂S. (Figure 3.)\n\n## References\n\n2. Anastassiadis, K., et al., *Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E-coli, mammalian cells and mice.* Disease Models & Mechanisms, 2009. **2**(9-10): p. 508-515.\n\n3. Simanshu, D.K., et al., *Structural Basis of mRNA Recognition and Cleavage by Toxin MazF and Its Regulation by Antitoxin MazE in Bacillus subtilis.* Molecular Cell, 2013. **52**(3): p. 447-458.\n '),this.ele=e)}}]),t}(i["a"]);rt.id="Safety",rt=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],rt);var lt=rt,ct=lt,ht=Object(y["a"])(ct,st,ot,!1,null,null,null),mt=ht.exports;T()(ht,{VCol:W["a"],VRow:G["a"]});var dt=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"hp",staticClass:"text-left"})])],1)},pt=[],ut=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.hp;console.log(e),e&&(e.innerHTML=ve()('\n# Human Practice\n\n<img src="" alt="Where do we get the inspiration_" style="max-width:100%" />\n\nThe inspiration for our project comes from a detail in our life. In our school canteen, students need to **pour the left** into food waste bins. However, the odor coming from food waste bins makes students unwilling to come near them, leading to spilling the left. It not only increases the **safety risks** but also **adds burden** to people who work in school canteens. On the other hand, those people have to stay near food waste bins for a long time, the odor from food waste may **do harm to their health**. Therefore, we realize that **the odor of food waste** is a problem to be solved after the implementation of waste sorting regulations.\n\n\n\n<img src="" alt="What’s our values_" style="max-width:100%" />\n\n\n\n## Our Values:\n\nTongji_China has always been with a **people-oriented attitude**. Besides, the object we are dealing with, food waste, has a close relationship with our lives. Therefore, we take the opinions from **residents and people who work in related fields in different stages of our project** into our consideration. On the other hand, Shanghai, as the financial center of China, is facing the problem of rubbish siege, so the problem of waste sorting cannot be delayed. Given the environmental problems of food waste will bring, we pay much attention to the **environmental influence** our project will result in. Briefly, based on **people-oriented and environment-friendly** attitude, we have carried out a series of human practice that will influence our design meanwhile.\n\n<img src="" alt="6.1-1 overview" style="max-width:100%" />\n\n## Understand the problem\n\nBefore our design, we have conducted a thorough series of human practices to learn about our project completely. Therefore, we designed a questionnaire and made field trips to the different stages of food waste treatment.\n\n<img src="" alt="6.1-2湿垃圾处理方式" style="max-width:100%" />\n\n### A questionnaire\n\nIn order to learn about the harm of food waste odor on different people, we\'ve designed different questionnaires for different people. However, as our team members all major in biotechnology, it\'s hard for us to design a scientific questionnaire. Therefore, we turned to Professor Sun Ming for help.\n\n<img src="" alt="6.1-3" style="max-width:100%" />\n\nDuring our talk with Professor Sun Ming, we learned some basic rules to obey in designing questionnaire [(To learn more)](/Team:Tongji_China/Contribution). Therefore we made some changes to the questionnaire according to our research objectives and targets. For example, as our research targets were mostly residents and people who work in related fields, we set some pictures in it to make targets understand more easily. Besides, we tried our best to describe professional vocabulary in an easy-to-understand language. Most importantly, we always put ourselves in others\' shoes and avoid any vague expression.\n\n<embed src="https://static.igem.org/mediawiki/2021/e/e2/T--Tongji_China--Human_Practices-Public_Oriented_Social_Survey-10.20.pdf" width="100%" height="875" \n type="application/pdf">\n\n### The whole process of food waste treatment\n\nIn order to learn about the **whole process** of food waste treatment, we visited different places from the **emergence of food waste, transfer and treatment**. In this way we wanted to find out **what influence the odor of food waste would have on people in different stages** as well as **present odor treatment methods**.\n\n<img src="" alt="6.1-25" style="max-width:100%" />\n\n#### Front-end\n\nWe realize that there are many different places where the odor of food waste emerges. Therefore, we did some field trips to a **neighborhood**, a **school** and a **food market**, exploring people\'s ideas on food waste in different places.\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:49%" />\n\n<img src="" style="max-width:49%" />\n\n#### Middle-end:\n\n<img src="" alt="6.1-7" style="max-width:100%" />\n\nWe went to **Tian Wei Environmental Company** in Min Hang District that is responsible for the concentrated treatment of food waste in Hong Mei Street. The staff here told us that in the middle end of food waste treatment like waste transfer stations, there is some odor because of the **huge amount of food waste**. Also in our field trips, we found that despite the **plant extraction**, the **unpleasant smell of food waste can\'t be covered thoroughly**, making a huge influence on the workers. Besides, food waste is fermented to produce fertilizer **in high temperature**, where the organic components in plant extraction may react the odor gases and **form more odorous substances**.\n\n\n\n#### Tail-end:\n\nBecause of the COVID-2019, we didn\'t have the chance to visit a waste treatment plant. Luckily, our friend team, CPU_CHINA happened to visit one in Nanjing. Therefore, we asked them to collect some information of odor treatment methods in factory.\n\n<img src="" alt="6.1-8" style="max-width:100%" />\n\nAccording to their research, we found that as the amount of odor in factory is very large, there has been a complete collect of odor treatment methods. Here are some typical methods.\n\n| Type | Method |\n| ---------- | --------------------------------------------------------- |\n| Physical | Absorb by activated carbon, etc. |\n| | Increase ventilation |\n| Chemical | Burn |\n| | React with chemical substances |\n| Biological | Inhibit the generation of odor gases |\n| | React with related bacteria catalyzed by specific enzymes |\n\n\n\n### What have we learned?\n\nIn our questionnaire, we define that most of people consider the odor of food waste to be a question ,which makes our project meaningful. Besides, we collect people\'s idea on eliminating odor by synthesis biology and find that people are worrying about the safety. Therefore we design a kill switch to reduce their concern. (To learn more) Also, we found that people with different education levels have different understanding of synthesis biology. Therefore we designed different activities for different ages of people.(To learn more)\n\nIn the field trips to different stages of food waste treatment, we realized that the odor of food waste **in the front and middle end tended to be neglected** because of the **small volume**. Meanwhile, it can **influence related practitioners to some extent**. Therefore, we determined the **application scenarios** to be **front and middle end** which is of small volume.\n\nPresent odor treatment methods\n\n| Stage | Odor treatment methods | Problems |\n| ---------- | --------------------------------------------------------- | ------------------------------------------------------ |\n| Front-end | Clean and transport in time | High cost |\n| | Wear masks | Inconvenience, especially in summer |\n| Middle-end | In-situ processing | Difficult to cover costs |\n| | Plant extraction | Unknown in components and unsteady in high temperature |\n| Tail-end | Absorb by activated carbon, etc | Limited to large volume |\n| | Increase ventilation | |\n| | Burn | |\n| | React with chemical substances | |\n| | Inhibit the generation of odor gases by bacteria | |\n| | React with related bacteria catalyzed by specific enzymes | Low efficiency, difficult to cultivate and command |\n\n\n\n## Define the solution\n\n<img src="" style="max-width:100%" />\n\nAfter having a thorough understanding of our project, we determined the application scenarios to be front and middle end. Then we started to brainstorm on how to solve the problem. Then we turned to **synthesis biology**, however, we realized that we needed to reflect upon our project from the view of **philosophy and morality**. Therefore, we invited **Professor Xinhua Lu** from College of Humanities in Tongji University to give us a lecture themed on **\'Philosophy vs Synthesis biology, human beings and rubbish in biosphere\'**. The lecture has attracted over 50 participants online and offline.\n\n<img src="" alt="6.1-9" style="max-width:100%" />\n\n<img src="" alt="6.1-10" style="max-width:100%" />\n\n<img src="" alt="6.1-11" style="max-width:100%" />\n\n### What have we learned?\n\nDuring the heated talk ,we\'ve learned that we need to find out the **influence of food waste on human beings** from the perspective of symbiosis between waste and humans. Also,we need to **care for and develop life through arts and literature**. Therefore, we take compost of food waste into our consideration when coming to selecting final products.\n\n\n\n## Ideate & design:\n\nAfter learning about people\'s opinions on eliminating odor of food waste by synthesis biology, we began to ideate and design our project.\n\n<img src="" alt="6.1-13" style="max-width:100%" />\n\n\n\n### Selection of odor gases and final products\n\nAs we all know,there are many complex components in odor gases therefore we need to select the gases we want to treat and the final products.\n\nTo do that, we\'ve read huge amounts of literature and visited one of the authors, **Professor Lv Fan** from School of Environmental Science and Engineering in Tongji University. She told us that the gases in odor can be divided into **organic and inorganic ones**, like H₂S, NH₃ and alkene. She advised us to pay attention to **H₂S and NH₃** whose sniffing thresholds are low.\n\n<img src="" alt="6.1-14" style="max-width:100%" />\n\nWe know that the aim of implementation of garbage sorting in Shanghai is to make full use of waste resources, therefore we must take it into consideration when selecting final products. We came to **Tian Wei Environmental Company** and the staff there told us that if we want to treat H₂S and NH₃, we can transform them into **SO₄^2- and NO₃^-** which are **helpful in composting**.\n\n\n\n<img src="" alt="6.1-15" style="max-width:100%" />\n\n### Pathway design\n\nAfter determining the gases and final products, we started our design which is divided into three parts: **hydrogen sulfide degradation, pathway optimization and kill switch**.[(To learn more)](/Team:Tongji_China/Design) To ensure biosafety, we\'ve designed a kill switch consisting of **odor sensors, Dre recombinase system and toxin-antitoxin system**. We needed to synthesize CstR and a promoter promoted by CstR while we had problems in synthesizing the fragment, which influenced the process of our project. After reading some related literature, we found that **Professor Huaiwei Liu from Shandong University** had done some related experiments before. So we talked about our situation with him by e-mail and got the **plasmid PL1-CstR-PR3-mKatessrA** from him,which is helpful for constructing our kill switch.\n\n### What have we learned?\n\nWe have conducted a huge amount of human practices when ideating and designing our project. We\'ve **defined the odor gases and final products** after visiting Professor Fan Lv and Tian Wei Environmental Company and had **a rough frame of our processing path**. Besides, when we are designing our project, we got the **key plasmid of kill switch** from Professor Huaiwei Liu from Shandong University.\n\n\n\n## Application & evaluation\n\nAs the project progresses, we began to take application and evaluation of our bacteria into consideration, therefore we turned to some specialists for help.\n\n\n\n<img src="" alt="6.1-18" style="max-width:100%" />\n\n### Efficiency of degrading H₂S in gases and liquid\n\n#### Characterization in liquid forms\n\nAfter constructing the plasimid we needed, we began to [characterize](/Team:Tongji_China/Results) our plasimids. In the characterization of hydrogen sulfide degradation, we adopted **Methylene blue spectrophotometric method**, but the results were not steady. Therefore we turned to **Professor ZhanYun Guo** from School of Life Science and Technology in Tongji University for help. He told us that **S^2- may be easily oxidized by oxygen** in the air, so when we are experimenting ,we can establish an **acidic environment** and add some **reductive substances** like Vitamin C. Besides, he gave us some **reduced glutathione** as positive reference substances.\n\n<img src="" />\n
\n\n<img src="" alt="6.1-30" style="max-width:49%" />\n\n<img src="" alt="6.1-31" style="max-width:49%" />\n\n#### Characterization in gas forms\n\nBesides, we want to test the efficiency of degrading H₂S in gas form. However, there isn\'t High Performance Gas Chromatograph in our lab to detect the concentration of gases. Therefore, we turned to **Professor Fan Lv** from Tongji University for help and she was willing to make us **use the instrument** in her lab and we finished the **construction of reaction device** under her guidance.\n\n<img src="" alt="6.1-27" style="max-width:50%" />\n\n### Application\n\nNot only do we want our project to work successfully in the laboratory, but furthermore we want to be able to apply it in real life, which requires us to consider some **practical applications**. We approached **Professors Leng Ye, Guo Zhanyun, Du Changsheng, Zhang Mengjie and Zhang Jing** from Tongji University to discuss the application aspects of our project. They pointed out the need to consider the **final form of application, the hardware design, the activity of the enzyme activity in the application scenario**, etc. They also suggested that we needed to consider the **rate at which the gas enters the engineered bacteria and how to accelerate this rate**, etc. This gave us more food for thought on the application level.\n\n\n\n### Hardware\n\nWhen it comes to the **carrier of our bacteria**, we turned to **Professor Xinping Zeng** for help. She recommended **biochar** to us. First of all, **food waste itself can convert into biochar**, which utilizes food waste in maximum. Besides, biochar can **absorb and enrich gases** in the food waste at the same time, which improve the efficiency of odor treatment. Last but not least, biochar provides a **relatively independent environment for bacteria** to survive from the complex food waste bins.\n\n\n\n### What have we learned?\n\nThrough the human practices in application and evaluation, we have a deeper understanding of the application aspects of our project. When we are testing the degrading efficiency of our bacteria, we asked for help from **Professor Zhanyun Guo** and **Professor Fan Lv** and learned about the **improvement of our characterization experiments** and got access to **devices for testing gas concentration**.\n\nWhen it comes to the application future for our project, we asked for advice from professors in our school and consulted Professor Xinping Zeng for advice in hardware. Then we made a [model](/Team:Tongji_China/Model) to simulate the dynamics of engineered bacteria spread and odor degradation in practical application.\n\n<img src="" alt="6.1-27" style="max-width:100%" />\n\n## Summary\n\nOur human practices can influence our project too. To **understand the problem**, we conducted a **questionnaire** to collect **people’s ideas** on food waste thus proving our project to be **meaningful**. Besides, we visited different places of the **food waste treatment process**, learning about present deodorizing methods and **opinions from people of related areas** and define our **application scenarios** to be front and middle end. To **define the solution**, we wanted to reflect the **morality problems of our project**, therefore, we held a **lecture between science and philosophy** and realized that we should utilize food waste fully which helps us in **selecting final products**. To **ideate and design the project**, we consulted some specialists to select the **target odor and final products**. Also we got help in **constructing plasmids**. To **apply and evaluate our project**, we improved our **characterization experiments** with professional help. Besides, we got advice for **hardware** from a specialist. \n '),this.ele=e)}}]),t}(i["a"]);ut.id="Integrated",ut=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],ut);var gt=ut,ft=gt,bt=Object(y["a"])(ft,dt,pt,!1,null,null,null),wt=bt.exports;T()(bt,{VCol:W["a"],VRow:G["a"]});var yt=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"edu",staticClass:"text-left"})])],1)},vt=[],Tt=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.edu;console.log(e),e&&(e.innerHTML=ve()('\n\n# Education & Public Engagement\n\n Education and Public Engagement is a vital part in iGEM. By educating the public about the concept of synthetic biology, we could collect public feedback towards science and more groups would be able to participate in synthetic biology as well, which may get rid of people\'s **prejudice towards science**. At the same time, we think that a new perspective or a new position, such as **interdisciplinary** and communications between **industry and academia**, can promote the development of synthetic biology better. As a result, spreading the concept of synthetic biology to all ages as much as possible is of great importance. In the work of Tongji_China, our education and popularization cover **primary, secondary, and university students as well as other social groups.**\n\n## Pupils & Middle School Students\n\nFor lower age groups, such as pupils and middle school students, building and **keeping their interests** towards biology ought to be put on the top priority. After that, they may receive and explore knowledge better.\n\n### Online Games: \'Synthesis of Biology\'\n\nAt the beginning of 2021, a small game called \'Synthesis of a Watermelon\' became a meme nationwide. Its similarity towards ancient games such as \'2048\' and Tetris was not the only reason that accounted for the popularity of ‘Watermelon Synthesis’ . The circle fruits were set to be scrollable, which resulted in many uncontrollable and interesting consequences. Under such circumstances, many people were strongly obsessed with this game and some stayed up late till synthesizing the watermelon successfully.\n\n<img src="" alt="微信图片_20211015183444" style="max-width:40%" />\n\n<img src="" alt="微信图片_20211015183441" style="max-width:40%" />\n\nBased on the popularity of \'Synthesis of a Watermelon\', members of Tongji_China thought it could be a good opportunity to communicate general knowledge of biology. The colorful pictures and the rolling contacts in the game can attract pupils\' attention, which may also lead their attention to relevant knowledge. We painted relevant icons, combined with open-source codes and introduced the following five aspects to the public:\n\n**\'Synthesis of Insulin\'**: Based on the central principle of gene expression, the game gives a general introduction of how the insulin is synthesized.\n\n**\'Synthesis of Man-made Meat\'**: Take an protein product as an example. We would like to show the basic process of product design.\n\n**\'Synthesis of Biosphere\'**: According to the volume, the life system can be shown from micro to macro when you play this module.\n\n**\'Synthesis of the Lovely\'**: Seven Interesting animals are shown in this module.\n\n**\'Synthesis of Dodo\'**: Due to the change of living conditions, several species are in survival crisis. In this module, some of them are shown according to the level of endangerment they are faced.\n\n<img src="" alt="微信图片_20211015183431" style="max-width:100%" />\n\n### Science Popularization Activities at Shanghai Minhang District Youth Science and Technology Centre\n\nIn a bid to promote biology to lower age groups, this year, members from Tongji_China came to the Youth Centre located at Minhang District, Shanghai. Over twenty students from biology community joined in this science popularization activity, which was called **\'Into the micro-world\'**.\n\nJust as its name implies, we popularized the concept of biology on a micro-scale during the activities. Bacteria and fungus were introduced through slides and the operation of microscopes. At the same time, the concept of genes, law of segregation and law of independent assortment were primarily interpreted through games. With such efforts, the concept of synthetic biology was tactfully integrated as well, which showed the probability of how techniques like gene editing could be devoted to the health and progress of human society.\n\n<img src="" alt="显微观察指导" style="max-width:49%" />\n\n<img src="" alt="分子部分互动（wyj）" style="max-width:49%" />\n\n It was also worth mentioning that our science communication activity also participated in the **ICIII (Into China, Into iGEM)**, a large inter-university and inter-city event organised by NAU_China and CPU_China. More information can be found on the *collaboration* page.\n\n## Senior high school students: The Seeding Program\n\nSenior high school students are those who master some theoretical knowledge in basic principles and get some practice as well. We hope to introduce **the concept of synthetic biology and the basic experimental methods** to them, which can provide a new perspective in the development of some principles and majors.\n\nAs a traditional enrollment activity in Tongji University, \'The Seeding Program\' aims at excellent Grade 11 students nationwide to provide them with the opportunity and platform to know about their future major and college life. This year, members from Tongji_China again participated in this program. By giving online lectures on college lives, synthetic biology and the current iGEM project, we not only showed how to make an idea from brainstorming to the ground, but also shared the college lives as senior schoolmates. The popularization of iGEM and synthetic biology has also been added into the literature, making the program a unique way to communicate science.\n\n<img src="" alt="苗圃计划2" style="max-width:100%" />\n\n## College Students: Talk Between Synthetic Biology and Philosophy\n\nFor college students, we would like to convey **the thought of interdisciplinary** in iGEM to those energetic and promising. This is helpful to further expand the audience of synthetic biology. On the other hand, interdisciplinary offers great opportunities for the emergence of inspiration and innovation. Particularly, how to prove the science valuable and how to understand **the feedback of science to society** are emphasized during the talk between philosophy and natural science.\n\nFor the following questions and other ones related to synthetic biology, we were honored to invite Professor **Lu Xinhua** from College of Humanities, Tongji University to make a speech about \'**Philosophy against Synthetic Biology: Human Beings and their Garbage in the Biosphere**\'.\n\n<img src="" alt="哲学讲座" style="max-width:50%" />\n\n**How do we look upon ourselves in nature when we master the ability in gene editing therapy?**\n\n**May human become a new \'God\' or coexist with nature?**\n\n**How do we look upon the relationship between humans and genetically modified creatures?**\n\nAs a newborn discipline in the area of natural science, synthetic biology, itself involves techniques that can achieve our goals after we modify genes. On the other hand, we should think over the philosophical and ethical it may incur. Professor Lu launched a series of interesting and thoughtful prospectives, which aroused heated and further discussions between interdisciplinary students and teachers. Particularly, Professor **Wang Chunguang** and **Guo Guangpu** from College of Life Science and Technology talked further about whether gene editing therapy had made humans \'cross the border\', whether the philosophy should tell the science to quit, and the concept of transhumanism.\n\n<img src="" alt="哲学讲座2" style="max-width:100%" />\n\n
\n
\n\nBesides, we also held a publicity to students from different majors. We collaborated with SJTU-BioX-Shanghai to give a lecture on synthesis biology and projects of us two teams.\n\n## Science and the Public\n\n### Social Media: A New Way to Science Communication\n\nWith the development of the new media, information sharing has become more convenient and efficient. In China, the WeChat Public Platform is one of the most influential ‘we media’ platforms, the users of which involve all age groups and industries, which made science communication and education popularization **easier and low-barrier**. We took advantage of the capability of the internet to expand our audience through Wechat. We have posted a number of tweets on the platform by our team account, including **synthetic biology introduction, project introduction and popularized scientific knowledge**, etc. Through these tweets, numerous people can know more about synthetic biology. At the same time, after communications with enterprises, the public and the cooperative partners in relevant areas, the tweets that we have posted can help to broaden our minds and optimize our design.\n\n<img src="" alt="638d2eb5-65d4-424f-8072-a70a5de9fa82" style="max-width:100%" />\n\n<img src="" alt="896b7015-308b-429c-b921-af443f62a2d4" style="max-width:100%" />\n\n## Questionnaires: Further expand our target group\n\nSocial media indeed is one of the significant ways to communicate and share information. However, they are groups that the WeChat Public Platform cannot reach, such as the groups who do not use smart devices often due to their job. The people who engage in the waste disposal industry are just people of that group. If we want to confirm how practical our project is, interviewing people of that kind is quite important.\n\n<img src="" alt="image (1)" style="max-width:40%" />\n\n<img src="" alt="image" style="max-width:40%" />\n\nBased on the background of our investigation, members of Tongji_China invited several individual laborers and environmental workers to complete questionnaires, which made our project meaningful and more people may be aware of the concept of synthetic biology.\n\nFor **biological products** designed by synthetic biology and **the concept of synthetic biology** we collected feedback from the public, especially those who work in waste disposal industry. The results are as follows:\n\n\n\n%7C Knowledge of basic concepts of synthetic biology | Completely Unknown | Heard of Concept | I have read several related news report and scientific articles | I am a research/production staff in related fields |\n| :----------------------------------------------: | :----------------: | :--------------: | :----------------------------------------------------------: | :------------------------------------------------: |\n| Genetic Engineering | 15.96% | 32.62% | 36.88% | 14.54% |\n| Bio-engineered Bacteria | 36.52% | 30.14% | 18.79% | 14.54% |\n| Biosafety | 26.24% | 28.37% | 32.98% | 12.41% |\n| Synthetic Biology | 31.91% | 33.33% | 20.57% | 14.18% |\n\nMore result of questionnaires can be found in [**Human Practice**](/Team:Tongji_China/Human_Practices).\n\n\n '),this.ele=e)}}]),t}(i["a"]);Tt.id="Education",Tt=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Tt);var Ct=Tt,xt=Ct,At=Object(y["a"])(xt,yt,vt,!1,null,null,null),kt=At.exports;T()(At,{VCol:W["a"],VRow:G["a"]});var St=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"mddiv",staticClass:"text-left"})])],1)},jt=[],Et=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.mddiv;console.log(e),e&&(e.innerHTML=ve()('\n# Implementation\n\nWe not only want to prove that our project works in laboratory ,but we also want to go further and prove that it can be used in real life, which requires us to consider questions about the practical application.\n\n## 1. Application scenario\n\nAfter our preliminary human practice, we found that the front and middle ends of food waste treatment have not formed a scientific and systematic deodorisation method due to the small volume, so we set our application scenario as the front and middle ends of wet waste treatment, like food waste bins, waste transfer stations, etc. We envision that our biological product will be distributed to our target group in the form of lyophilised powders. They can pour and spread them directly onto the wet waste pile when required, and that our product will be able to effectively detect the concentration of hydrogen sulfide and Ammonia in the environment.\n\nBesides, since food waste is very valuable resource for us to use, we want to utilize it fully. Therefore we have partnership with SJTang and explored the possibility that producing hydrogen while eliminating H₂S by co-cultivating our bacteria.\n\n## 2. End users\n\nOnce we had identified our application scenario, we targeted our audience at residents, students, and workers involved in related waste treatment. We envision that our biological product will be distributed to our target group in the form of lyophilised powders. They can pour and spread them directly onto the wet waste pile when required, and that our product will be able to effectively detect the concentration of hydrogen sulfide and Ammonia in the environment and begin to deodorise the odor as the environment warms up and a certain change in water and oxygen concentration. A questionnaire was set up to find out how receptive they were to the use of synthetic biology as a means of deodorisation, and the results showed that 45.39% of our audience said they would be willing to try synthetic biology, while there were still concerns about safety and other issues.\n\n## 3. Safety\n\nIt works based on the concentration of H₂S and NH₃ which consists of odor sensors, Dre recombinase system and toxin-antitoxin system. Under cultural conditions, none of the pathway can be activated. When the bio-engineered bacteria are put into work, high density of hydrogen sulfide in the environment induces the expression of Dre recombinase and MazF (antitoxin), followed by terminator removal and MazE (toxin) expression. Once our bio-engineered bacteria leak to the environment, low density of hydrogen sulfide inhibits MazF (antitoxin) expression. Without the rescue of MazF(antitoxin), bio-engineered bacteria will be killed by the accumulation of MazE (toxin). In this way ,we succeed in adjusting the survival and death of the bacteria by adjusting the concentration of H₂S and NH₃. [(To learn more)](/Team:Tongji_China/Design)\n\n## 4. Efficiency\n\nBesides safety, the complex situations in real life make us consider whether our engineered bacteria still work in real environment. In order to understand this problem, we consult much literature, ask for help from specialists and try cooperation with other teams.\n\n### 4.1 Initial validation of efficiency\n\nWe first simulated a hydrogen sulphide-producing wet waste environment using egg liquor, to which we added our engineered bacterial broth in a mixed culture. The results of the incubation showed that the wild-type egg solution tested significantly positive for sulphur ions after incubation, while the egg solution with our engineered bacteria tested negative for sulphur ions. The results provide preliminary evidence of the potential of using engineered bacteria to inhibit the production of hydrogen sulfide.\n\n### 4.2 More work to promote the efficiency：Living conditions\n\nThere are very many other bacteria in the food waste bins and they have to live in an anaerobic state.In the further composting process, food waste will be treated in high temperature. This series of harsh survival environments made us realize that our bio-engineered bacteria is difficult to survive in this scenario. After communicating with Professor Xinping Zeng, we intend to provide a relatively stable living environment for the engineered bacteria in the form of biochar to avoid competition with other bacteria. In addition we will further consider how to improve the survival of the engineered bacteria under extreme conditions such as anaerobic high temperatures.\n\nBesides, this year we have a solid partnership with FAFU-CHINA, whose project aimed at generating linalool by yeast. Therefore, we tried to cultivate our bio-engineered bacteria together with their yeast. They made a model to predict the living conditions of our microorganism.[(To learn more)](https://2021.igem.org/Team:Tongji_China/Partnership)\n\n### 4.3 More work to promote the efficiency：modeling Work efficiency\n\nDuring our interaction with the professors in our school, they suggested to us that the practical application would require a combination of the rate of gas production and the rate of gas\'s diffusion into E. coli. Therefore we established a cellular automation model to simulate the dynamics of engineered bacteria spread and odor degradation in practical application. We also simulated the application in different environment, seasons and compared different ways of implementation. [(To learn more)](https://2021.igem.org/Team:Tongji_China/Model)\n\n<img src="" alt="6.3-1" style="max-width:100%" />\n\n\n### 5.Other challenges needed to be considered\n\n### **5.1 Simulation of real environments: Interaction of engineered and native bacteria**\n\nIn the modelling work we have completed this year, we have simulated the propagation and odour degradation kinetics of engineered bacteria in practical applications by building a cellular automation model and modelling how this is achieved in different environments and seasons. However, this work is purely conceptual and we will also need to add experiments on the efficiency of our engineered bacteria for deodorisation in field use. It will be a challenge to establish the experimental site and the scale of the experiments in the subsequent work. We will work with the School of Environmental Studies at Tongji University and our team of friends to discuss and collaborate further.\n\n### **5.2 Simulation of real environments: Deodorisation efficiency of engineered bacteria in relation to the type of food waste deposited**\n\nIn the work we have already completed this year, we predicted the results of our engineered bacteria co-culture application with yeast, and we also realised that the biochar form could provide a relatively stable environment for the engineered bacteria to live in, avoiding competition with other bacteria. However, the question remains as to how to increase the deodorisation efficiency of our engineered bacteria in a real environment and the effect on indigenous bacteria. Further work is needed on the effect of indigenous bacteria species in wet waste on engineered bacteria, and it remains a challenge for us as to how many environmental simulations we can go through to achieve appreciable application results.\n\n### **5.2 Ethics and Marketing in the promotion**\n\nThrough our work in education and science communication, we have developed a broader concept of synthetic biology for different age groups. However, the implementation of any new technology or product needs to be researched as thoroughly as possible. As we move forward, we hope to bring together government, industry and education as much as possible, and to develop more innovative models of dissemination. For more information see future section in Entrepreneurship.\n\n '),this.ele=e)}}]),t}(i["a"]);Et.id="Implementation",Et=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Et);var _t=Et,Pt=_t,zt=Object(y["a"])(Pt,St,jt,!1,null,null,null),Ot=zt.exports;T()(zt,{VCol:W["a"],VRow:G["a"]});var Bt=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"mddiv",staticClass:"text-left"})])],1)},Ht=[],Ft=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.mddiv;console.log(e),e&&(e.innerHTML=ve()('\n## Entrepreneurship\n\n### Overview:\n\nWith the growing amount of food waste and the associated odor and health and psychological problems, this year, Tongji_China launched the "LOOK" project. The biological products containing the concept of our \'LOOK\' project will be able to absorb **hydrogen sulfide** and **ammonia** with two kinds of bioengineered E.coli. One uses enzymes related to sulfide oxidization(**Sqr, Sdo, AprBA and Sat**), converting hydrogen sulfide to sulfate, while the other uses enzymes **AMO, HAO and NOD** to convert ammonia to nitrate. Besides, a three-gear adjustable **kill switch** based on the concentration of H2S and NH3 is added to ensure biosafety. Also, we optimize our pathway by high throughput screening and machine learning. With such efforts, we hope to solve the problems the odor has brought to people and downstream industries.\n\n<img src="" alt="6.4.1" style="max-width:100%" />\n\n### Establishment of application scenario and target customers\n\nTo make our project not only limited to a laboratory result, but more likely to improve the current odor problem in food waste through production. The first thing we had to do was to identify our target customers. Our preliminary HP research showed that for **large food waste treatment plants**, the odor problem can be scientifically and systematically controlled and managed due to their high level of **automation**. Besides, **the initial sorting and compacting** is done during the transfer process.\n\n<img src="" alt="6.3.1" style="max-width:100%" />\n\nHowever, the food waste before centralised transfer (which we would like to refer to as the front-end and mid-end of food waste treatment), due to its small volume, inevitably requires a combination of human supervision and simple food waste transfer. The oversights emerged can lead to a **disconnect between food waste deposition and transfer**, resulting in odor problems. (Figure 1) We have identified the **possible scenarios** for the use of our own bioproducts as community waste bins, public waste bins and regional waste transfer stations and the **target customers** as residents, students, and workers involved in related waste treatment.\n\n### SWOT Analysis\n\nSWOT analysis can be used for strategic analysis and to establish market competitiveness. If we want to enter the market with our biological products, it is crucial to research the market environment and establish a position, for which we have done a SWOT analysis.\n\n| **Strengths** | **Weaknesses** |\n| ------------------------------------------------------------ | ------------------------------------------------------------ |\n| Low cost, easy to use and portable, low environmental impact. | lack of research on the use and preservation effects between time/environment and the target consumers is not firmly established. |\n| **Opportunities** | **Threats** |\n| The market for specific applications is at a blank stage, there are no competitors yet, and the application and acceptance of biologics is generally positive. | The existence of similar or similar deodorant products in different areas makes us difficult to insert the concept. |\n\n### Competitive analysis of similar products\n\nAs we have stated in \'Treats\' part in the previou SWOT analysis, there are a series of deodorant products in the market. It can be roughly divided into three aspects. We will further analyze their characteristics in working and the examples of its commercial forms.\n\n| **The General Treatment Method** | **Characteristics in Working Principles** |\n| -------------------------------- | ------------------------------------------------------------ |\n| Physical Treatment | Absorption(activated carbon, zeolite, silica gel, etc) and Dilution(by oxygen, etc) |\n| Chemical Treatment | Botanical extracts，deodorizers |\n| Biological Treatment | Suppression at source |\n\nTo gain a better understanding of how deodorant products are marketed, we looked primarily at Taobao, the largest shopping platform in Asia. This also prepared us for the further development of our own sales format.\n\n<img src="" alt="6.3.2" style="max-width:100%" />\n\nAn Odor treatment plant, which mainly treats odor **physically**, has an average price of 3000RMB. It is often not considered in households, communal bins and other places that generate small volumes of food waste.\n\n<img src="" alt="6.3.3" style="max-width:100%" />\n\n<img src="" alt="6.3.4" style="max-width:100%" />\n\nThese deodorant products in colorful packaging are often worked by **chemical methods**. Plant extract deodorants are the main deodorizing product of choice in the market today because of their low price and wide range of applications. The plant extract is processed into spray, fragrance and balm to use. It achieves the deodorizing effect by covering the odor with fragrance and can meet the deodorizing needs of small volumes such as households for its portability. However, its deodorizing efficiency is not high, and more often the overpowering fragrance can cause uncomfort (such as dry eyes, tingling nose and other allergy symptoms) to people.\n\n<img src="" alt="6.3.5" style="max-width:100%" />\n\nDeodorants of this kind enrich the culture of **photosynthetic fungi, lactic acid bacteria, actinomycetes, yeasts, acetic acid bacteria**, and other microbial groups that can use odor as a nutrient metabolite. They are used frequently in highly polluted areas such as farms and chemical plants for their extremely low price (30 RMB/50 kg), however, their ingredients are often kept secret，which may increase risks to biosecurity. The complexity of the strains tends to destroy the original vegetation production system, and it remains to be seen whether the **disinfectant and germicide** they claim to add will exacerbate the side effects of deodorization.\n\n| The Characteristic of Current Commercial Products | What our biological products can make up |\n| ------------------------------------------------------------ | ------------------------------------------------------------ |\n| Mostly found in **large wet waste treatment plants** (e.g. Shanghai Laogang solid waste site, etc.) with high construction costs. | Our biological products have **low prices** and are easy to use and portable. |\n| It is mostly used in the **family** in different forms such as fragrance, essence, oil and perfume, and also in the form of spray in **factories**. It is one of many ways to deodorize garbage | Our biological products\' working concentration are **controlled** by the concentration of ions in the environment. There won\'t be too much fragrance to make consumers feel uncomfortable. |\n| It is mostly used in large farms and sewage treatment plants, mostly concentrated in the livestock and chemical industries. Products of this kind works with **a** **biologically active enzyme complex: s**pecific microorganisms (**photosynthetic bacteria, lactic acid bacteria**, etc.) are domesticated, inoculated and enriched to form an active fermentation broth, from which the active enzymes are purified. | Our bio-engineered bacteria with three gear kill switch can **minimizes** the environmental impact of deodorization without destroying the ecosystem of the **original population**. |\n\n### Future\n\nTo further validate the potential of our engineered bacteria for downstream production and application, we will use a combination of **modeling and quantitative characterization** in the laboratory to establish a time-dependent profile of hydrogen sulfide concentration in the environment to demonstrate the deodorization capacity of the engineered bacteria. Our results will also be submitted to an impartial scientific commercial organization for validation, resulting in **an** **assessment of deodorization against national pollutant emission standards**.\n\nIn response to **public concern and uncertainty** about biological products, we believe that we can work with the Shanghai Greening Administration, the Shanghai Citizen\'s Street Experience Centre, Shanghai Tianwei Environmental Technology Co Ltd and Tongji University Student Union to enhance the dissemination of synthetic biology concepts and biologics, and to propose more innovative promotion models.\n\nAt the same time, we felt the need to conduct a more detailed and targeted interview, as our previous questionnaires confirmed that odor does have an impact on people\'s health and quality of life, especially in the wet waste industry. With the proven ability of our engineered bacteria to work, we hope to be able to **conduct a pre-placement of our biological product with industry** to solve some potential problems in practical application and make improvements in time.\n\n '),this.ele=e)}}]),t}(i["a"]);Ft.id="Entrepreneurship",Ft=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Ft);var Mt=Ft,Rt=Mt,Dt=Object(y["a"])(Rt,Bt,Ht,!1,null,null,null),It=Dt.exports;T()(Dt,{VCol:W["a"],VRow:G["a"]});var Lt=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",[t("v-row",[t("v-col"),t("v-col",[t("v-slide-group",{attrs:{mandatory:""},model:{value:e.sectionNum,callback:function(n){e.sectionNum=n},expression:"sectionNum"}},e._l(e.sections,(function(n,i){return t("v-slide-item",{key:i,scopedSlots:e._u([{key:"default",fn:function(i){var a=i.active,s=i.toggle;return[t("v-btn",{staticClass:"mx-2",class:n.normalClass,attrs:{"input-value":a,"active-class":n.activeClass+" white--text",depressed:"",rounded:""},on:{click:s}},[e._v(e._s(n.title))])]}}],null,!0)})})),1)],1),t("v-col")],1),0===e.sectionNum?t("CA"):t("ODE")],1)},Nt=[],qt=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"poc",staticClass:"text-left"})])],1)},Wt=[],Gt=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.poc;console.log(e),e&&(e.innerHTML=ve()('\n# Cellular Automation Model\n\n## Abstract\n\nThe goal of our project \'LOOK!\' is to control the the odour released by kitchen waste, mainly in its front-end processing. In order to guide the implementation of our odour processing bacteria, we built a cellular automaton model to simulate the process of bio-engineered bacteria release and odour degradation.\n\nBased on this model, we can determine the general optimized release strategy, generate different strategies for different use cases and find efficient ways to improve our project.\n\n## 1. Background\n\n### 1.1 About our project\n\nSince the implementation of household garbage sorting regulations in Shanghai, the amount of food waste has reached a peak. However, problems caused by odor like unpleasant smell and health problems, have aroused great attention everywhere. We construct two kinds of bioengineered E.coli to absorb hydrogen sulfide and ammonia, which are the two main [ingredients in the odor](/Team:Tongji_China/Description).\n\nBy developing this model, we hope to achieve these following goals which can contribute to our project design, biosafety consideration and implementation.\n\n**Goal 1**: To find the factors which have the largest effect on odour degradation rate and offer a guidance for engineered bacteria design.\n\n**Goal 2**: To compare different ways of application and offer a guidance for hardware design.\n\n**Goal 3**: To find the optimized spraying strategy in different cases.\n\n**Goal 4**: To find the optimized strength and threshold of kill switch, considering both bio-safety and degradation efficiency.\n\n### 1.2 About cellular automation model\n\nCellular automation (CA) are discrete, abstract computational systems that have proved useful both as general models of complexity and as more specific representations of non-linear dynamics in a variety of scientific fields^[1]. Considering the aggregation of bacteria and the complexity of its working environment, the cellular automaton can meet our needs. In terms of algorithm complexity and accuracy, the cellular automaton also performs better than the partial differential equation.\n\n## 2. Establishment of the basic model\n\n### 2.1 Dynamics of engineered bacteria population\n\nTo describe the population growth of engineered bacteria after they are released into working environment (e.g. dustbin, garbage carrying vehicles), we use a modified logistic growth model to quantify the bacterial growth. The population change in a discrete time is determined by a environmental limitaion factor (**K**), intrinsic rate of increase(**r**) and the current population quantity(**N**).\n\n$V_{grow}=r\ast N\ast \frac{K-N}{K}$\n\nEquation 2.1.1 The growth model. K represents the environmental capacity, r represents the intrinsic rate of increase and N0 represent the current population quantity\n\nConsidering the spread of engineered bacteria in the working environment, we set a rule to quantify this process. The bacteria cluster has a possibility to migrate from a spot with higher population density to a spot with lower population density.\n\n$V_{spread}=bp\ast (N_{neibour}-N_{centre})$\n\nEquation 2.1.2 The bacterial spread model. bp is a constant related to the transfer ability of the bacteria and N represents population quantity.\n\nTo ensure bio-safety, we design a kill switch which is able to kill the bacteria once they are released into the external environment. This process is determined by the density of odour. We suppose that when the odour is controlled under a low concentration in the working environment, the kill switch might partly open and affect the bacterial population. This is described by the following equation.\n\n$ifC<th:V_{suicide}=d\ast N\ast \frac{th-C}{th}$\n\nEquation 2.1.3 The suicide model. th is the odour threshold when the kill switch is pulled on. d is the maximum death rate when the kill switch is pulled on. C is the odour concentration. \n\nTo sum up, the bacteria dynamics can be described as the equation below.\n\n$V_{bac}=V_{grow}+V_{spread}-V_{suicide}$\n\n Equation 2.1.4 Dynamics of the bio-engineered bacteria population\n\n<img src="" style="max-width:100%" />\n\nFigure 2.1 Bacterial dynamics\n\n\n\n### 2.2 Dynamics of odour production and degradation\n\nOdour production from catabolism of some kinds of bacteria is an continuous process. Here we use a linear function of time to describe odour production, assuming steady odour production rate in a period of time.\n\n$V_{pro}=p$\n\n Equation 2.2.1 Odour production\n\n\nIn term of odour degradation, we use the Michaelis-Menten equation to describe the apparent degradation reaction undertaked by bio-engineered bacteria, instead of describing series of complex enzymatic reactions. The maximum reaction rate is determined by the odour processing ability of engineered bacteria(f) and engineered bacteria concentration(N).\n\n$V_{de}=\frac{V_{max.de}\ast C}{K_{m,de}+C}$\n\n$V_{max,de}=f\ast N$\n\nEquation 2.2.2, 2.2.3 Odour degradation model. Vmax represents the maximum reaction rate. C represents odour concentration. Km represents Michaelis constant. f represent the odour processing ability of engineered bacteria.\n\nConsidering the free expansion of odour, we use the below rule to describe the process of gas diffusion from high concentration to low concentration.\n\n$V_{max,de}=f\ast N$\n\n\nEquation 2.2.4 The odour diffusion model. bps is a constant related to the diffusion ability of gas and C represents odour concentration.\n\nTo sum up, the odour dynamics can be described as the equation below.\n\n$V_s=V_{pro}-V_{de}+V_{diff}$\n\n Equation 2.2.5 Dynamics of odour production and degradation\n\n<img src="" style="max-width:100%" />\n\nFigure 2.2 Odour dynamics\n\n\n\n### 2.3 cellular automation setting\n\nThere are different ways to set lattice(cells in the map), identify neighbours and set boundary in cellular automation model.\n\nSquare lattice is simple, intuitional and easy to code, so it\'s chosen in our model. Moore Neighbour is also used for better intuitiveness in the simulation of bacteria spread and odour diffusion.\n\nDue to the limitation of computing power, it\'s difficult to create a large map with high precision. Periodic boundary, which enable a two-dimensional surface to form a topological circle, is used in our model so that we can simulation a larger space.\n\n<img src="" style="max-width:100%" />\n\nFigure 2.3 CA setting\n\n\n\n## 3. Parameters and model validation\n\n### 3.1 Initiate parameters setting\n\nTo set the initiate value of these parameters, firstly we take hydrogen sulfide as our targeted odour. we did literature research, essential experiment, human practise and modelling. The original data we got was converted to fit in our model better. Parameters we used and their initiate values are listed below.\n\n| Parameter | Description | Value | Units | Source |\n| --------- | ------------------------------------------------------------ | ------- | -------------------- | ------------------------------------------------------------ |\n| K | Environment capacity(different from the logistic model) | 0.05 | OD
(1 OD = 10⁸ CFU) | we assume that the maximum bacteria number can reach 1 OD in a single 1 cm² square |\n| r | Intrinsic growth coefficient | 0.01 | S^-1 | [2] |\n| bp | Bacteria spread coefficient | 0.05 | S^-1 | [3] |\n| bps | Odour spread coefficient | 0.5 | S^-1 | \\ |\n| d | Bacteria suicide coefficient | 0.5 | S^-1 | our ODE model **(link: ODE model)** |\n| K_m,de | Km of hydrogen sulfide degradation reaction, catalysed by bio-engineered bacteria | 500 | μg/L | \\ |\n| f | Odour degradation coefficient | 600 | S^-1OD^-1 | our experiment data **(link: result)** |\n| p | Odour production rate | 10 | μg/L/min | [4] |\n| th | Odour concentration threshold when the kill switch turns on | 7 | μg/L | [5] |\n| N₀ | Initiate number of engineered bacteria in each cell | 0.5 | OD | usual concentration of bacterium agents **(link hp)** |\n| n | Initiate number of engineered bacteria clusters in the map | 200 | \\ | usual concentration of bacterium agents **(link hp)** |\n| t | simulation time | 60 | min | \\ |\n| s | simulation space | 100*100 | mm² | \\ |\n\n### 3.2 Model validation\n\nWe simulate the dynamic change of bio-engineered bacteria and odour for 60 minutes (60 iterations) in the 100*100 map. We use heatmaps to better visualize this process (Figure 3.2.1).\n\n<img src="" alt="4.1.4" style="max-width:100%" />\n\nThe bacteria-time curve and odour-time curve are calculated using the average value of each cell. The bacteria population grows slowly at the beginning and reach a plateau after a rapid growth phase. For odour concentration, there are slightly increase at the beginning. However, it soon gets in to a rapid degradation phase and keeps in low concentration in the end. The trend of our simulation curve **(Figure 3.2.2,a,b)** is consistent with a published experiment data^[6] **(Figure 3.2.2,c,d)** , implying that our model has the ability to uncover rules in real environment to some degree.\n\n<img src="" style="max-width:100%" />\n\nFigure 3.2.2 Simulation curve of bacteria and odour concentration. The experiment data comes from Zheng *et. al.*, 2011, Proceedings of the Chinese Society for Environmental Sciences conference. \n\n\n\n## 4. Problem solving\n\n### 4.1 Sensitivity analysis\n\n###### **Goal 1: To find the factors which have the largest effect on odour degradation and offer a guidance for engineered bacteria design.**\n\n***N0*** is the initiate number of engineered bacteria in each cell and ***n*** is the initiate number of engineered bacteria clusters in the map, which represent the initial concentration of the bacterium agent. Increasing N0 does not have a significant effect on odour degradation rate while increasing n has a significant effect. This indicate that average distribution and concentration of the bacterium agent matters.\n\n<img src="" alt="4.1.6" style="max-width:100%" />\n\nFigure 4.1.1 sensitivity analysis of N0\n\n<img src="" style="max-width:100%" />\n\nFigure 4.1.2 sensitivity analysis of n\n\n***f*** is the odour degradation coefficient, which represents the odour degradation ability of our bio-engineered bacteria. We hope to figure out to what extent the increase in degradation ability can affect odour treatment. When *f* increase from 10 to 50, the odour degradation rate improves significantly. However, the odour degradation rate does not show significant increase when f>50 (Figure 4.1.3), which may be limited by the odour production rate and odour diffusion rate (Figure 4.1.4).\n\nThese result reminds us that improving the degradation ability of bio-engineered bacteria can be a cost-effective choice at the beginning but it is not always useful especially when it\'s high enough.\n\n<img src="" alt="4.1.8" style="max-width:100%" />\n\nFigure 4.1.3 sensitivity analysis of f \n\n<img src="" alt="4.1.9" style="max-width:100%" />\n\nFigure 4.1.4 sensitivity of f is limited by odour diffusion rate \n\n\n\n### 4.2 Different application ways of engineered bacteria\n\n###### **Goal 2: To compare different ways of application and offer a guidance for hardware design.**\n\nThe most common application way of bio-engineered bacteria is spraying, which is cheap and convenient. At the same time, the immobilized microorganism technology(IMT) is attracting more and more attention as a novel microbial remediation technique. Coated bio-engineered bacteria on activated carbon or bio-carbon can increase the viability of bacteria^[7] and local concentration of odour. However, it can also cause lower distribution uniformity and higher cost. Spraying and immobilized bacteria are two of the alternative ways of application in our project. We hope to compare these two ways in application by modelling.\n\n| Feature | Spraying | Immobilized bacteria |\n| ----------------------- | -------- | -------------------- |\n| Gas absorption | no | yes |\n| Bacteria spread | yes | no |\n| Viability of bacteria | low | high |\n| Distribution uniformity | high | low |\n| Cost | low | high |\n\nTable 4.2.1 Feature of spraying and immobilized bacteria \n\nTo achieve this goal, we adjusted the rules of the basic model in the following aspect:\n\n* In case of immobilized bacteria, odour can spread from low density to high density spots due to the gas absorption ability of activated carbon or bio-carbon.\n\n* In case of immobilized bacteria, the value of ***r***(Intrinsic growth coefficient) and ***K***(environment capacity) is higher because activated carbon or bio-carbon can provide a substract attached for growth and function as a shelter .\n\n* ***N*** and ***n***, which are related to distribution uniformity, are different in these two cases.\n\n <img src="" alt="4.1.13" style="max-width:100%" />\n\n Figure 4.3.1 Immobilized bacteria and spraying\n\n | Parameter | Value for immobilized bacteria | Value for spraying bacteria |\n | --------------------------- | ------------------------------ | --------------------------- |\n | K | 0.5 | 0.05 |\n | r | 0.1 | 0.01 |\n | bp | 0 | 0.05 |\n | bps | 0.5 | 0.5 |\n | sbp(absorption coefficient) | 0.5 | 0 |\n | d | 0.5 | 0.5 |\n | K_m,de | 500 | 500 |\n | f | 600 | 600 |\n | p | 10 | 10 |\n | th | 7 | 7 |\n | N₀ | 2 | 0.5 |\n | n | 50 | 200 |\n | t | 60 | 60 |\n | s | 100*100 | 100*100 |\n\n Table 4.2.2 Values of parameters\n\nOur simulation result are showed intuitively as below **(Figure 4.3.2,Figure4.3.3)**.\n\n  \n\n  \n\n\n\n Figure 4.3.2 , Figure 4.3.3 Spraying bacteria(up) and immobilized bacteria(down). Bacteria spread(left) and odour degradation(right)\n\nUnder the condition above, spraying bacteria shows better odour degradation efficiency, with lower final concentration. Upregulating the initiate number of bacteria-immobilized biochar can not reverse its disadvantage. Indicating from our result, spraying may be a cheaper and more efficient way of application.\n\n <img src="" alt="4.1.14" style="max-width:100%" />\n\n Figure 4.2.4 The odour degradation curve of Immobilized bacteria and spraying bacteria\n\n\n\n### 4.3 Optimizing the spraying strategy\n\n###### Goal 3: To find the optimized spraying strategy in different cases\n\nIn our basic model, we assume that the odour is produced at a steady rate. However, in practical application, the odour is produced at alterable rate, which is influenced by temperature, the fermentation stage and so on. To offer a more precise guidance for application, we acquired the odour production rate - time curve from literature^[8]**(Figure 4.3.1)** and tried to figure out whether we can find a optimized initiate concentration considering both the efficiency and cost.\n\n<img src="" alt="4.1.15" style="max-width:100%" />\n\nFigure 4.3.1 Odour production rate changes over time. Experiment data from Yang *et. al.*, 2019\n\nHowever, our simulation result shows that in the range of variation causing by different stage of fermentation, the concentration of input bacteria will not affect the apparent odour degradation efficiency significantly.\n\n<img src="" alt="4.1.16" style="max-width:100%" />\n\nFigure 4.3.2 Different concentration of input bacteria in different stage of fermentation\n\nNext, we wonder whether adding bacteria for several times can improve the odour degradation efficiency. When the viability and spread rate of bacterial is high, adding bacteria for several times do not have a contribution to odour degradation. However, when the the viability and spread rate of bacterial is lower, adding bacteria for several times or adding larger amount of bacteria does help.\n\n<img src="" alt="4.1.17" style="max-width:100%" />\n\nFigure 4.3.3 Adding bacteria for several times\n\n\n\n### 4.4 Optimizing the strength and threshold of the kill switch\n\n###### Goal 4: To find the optimized strength and threshold of kill switch, considering both bio-safety and working efficiency.\n\nTo ensure bio-safety, we design a three-gear-adjustable kill switch, which is regulated by odour concentration in the environment.\n\nThere are two important parameters that determines the performance of our kill-switch in this CA model: the suicide coefficient ***(d)*** which describes the possibility that a bacterium will die in 1 min when the kill switch is on; the threshold ***(th)*** which tells us when the kill switch will be turned on. When ***d*** is too high or ***th*** is too low, the bacteria viability and odour degradation rate may be affected while the opposite may have bad impact on biosafety. For this purpose, we hope to know to what extent ***d*** and ***th*** can affect odour degradation rate.\n\nOur result shows that changing ***d*** and ***th*** has great influenced the end concentration of bacteria. However, the odour degradation rate is not affected (ignoring the abnormal value). This reminds us that when we design the killing strength and turn-on threshold of kill switch, we should put biosafety into the first consideration. High suicide coefficient and low threshold in a reasonable range is preferable.\n\n<img src="" alt="4.1.18" style="max-width:100%" />\n\n\n\nFigure 4.4 Optimizing the strength and threshold of kill switch\n\n\n\n## 5. Conclusion and Discussion\n\n### 5.1 Conclusion\n\nBy developing, validating and analysing the CA model, we answered several questions which are important to our project design, biosafety consideration and implementation.\n\n**Goal 1: To find the factors which have the largest effect on odour degradation rate and offer a guidance for engineered bacteria design.**\n\n \n\nIncreasing N0 does not have a significant effect on odour degradation rate while increasing n has a significant effect. This result indicates that average distribution and concentration of the bacterium agent matters. \n\nWhen f increase from 10 to 50, the odour degradation rate improves significantly. However, the odour degradation rate does not show significant increase when f>50 Improving the degradation ability of bio-engineered bacteria can be a cost-effective choice at the beginning but it is not always useful especially when it\'s high enough.\n\n \n\n**Goal 2: To compare different ways of application and offer a guidance for hardware design.**\n\n \n\nSpraying bacteria shows better odour degradation efficiency, with lower final concentration. Spraying may be a cheaper and more efficient way of application.\n\n \n\n**Goal 3: To find the optimized spraying strategy in different cases.**\n\n \n\nIn the range of variation causing by different stage of fermentation, the concentration of input bacteria will not affect the apparent odour degradation efficiency significantly. \n\nWhen the the viability and spread rate of bacterial is low (tough environment for example), adding bacteria for several times or adding larger amount of bacteria does help.\n\n \n\n**Goal 4: To find the optimized strength and threshold of kill switch, considering both bio-safety and degradation efficiency.**\n\n \n\nChanging d and th has great influenced the end concentration of bacteria. However, the odour degradation rate is not affected. During kill switch design we should put biosafety into the first consideration. High suicide coefficient and low threshold in a reasonable range is preferable. \n\n### 5.2 Discussion\n\nAlthough a series of concerned questions are answered by our CA model, there are still some inadequacies. Due to the lack of literature and experiment data, it\'s hard to determine the values of parameters. As a result, it\'s hard to give compelling quantitative result. Besides, some other factors which may have a influence on the result are not described in our model, for example, the inhomogeneity of odour production and competitive local bacteria. We hope to improve our model in the future continuously and try to answer more complex questions.\n\n## reference\n\n[1] Cellular Automata [Stanford Encyclopedia of Philosophy](https://plato.stanford.edu/index.html)\n\n[2] Zhu, M., Mori, M., Hwa, T., & Dai, X. (2019). Disruption of transcription-translation coordination in Escherichia coli leads to premature transcriptional termination. *Nature microbiology*, *4*(12), 2347–2356.\n\n[3] Zhu, M., Mori, M., Hwa, T., & Dai, X. (2019). Disruption of transcription-translation coordination in Escherichia coli leads to premature transcriptional termination. *Nature microbiology*, *4*(12), 2347–2356.\n\n[4] 崔玉雪.(2011).用于填埋场臭气控制的微生物除臭剂开发与除臭机理研究(硕士学位论文,华东师范大学).\n\n[5] *Emission standards for odor pollutants* GB/T14544-93\n\n[6] 郑骥,房蕾,李来庆,王敬贤,张继琳 & 李琳.(2011).生物菌剂处理生活垃圾填埋场渗滤液实验研究.中国环境科学学会.(eds.)*2011中国环境科学学会学术年会论文集（第一卷）*(pp.766-770).中国环境科学出版社.\n\n[7] 钱林波,元妙新 & 陈宝梁.(2012).固定化微生物技术修复PAHs污染土壤的研究进展. *环境科学*(05),1767-1776. doi:10.13227/j.hjkx.2012.05.055.\n\n[8] 杨惠媛.(2019).*生活垃圾初期降解过程污染物释放特征及环境影响分析*(硕士学位论文,昆明理工大学).\n\n\n\n\n\n '),this.ele=e)}}]),t}(i["a"]);Gt.id="CA",Gt=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Gt);var Vt=Gt,Ut=Vt,Kt=Object(y["a"])(Ut,qt,Wt,!1,null,null,null),Jt=Kt.exports;T()(Kt,{VCol:W["a"],VRow:G["a"]});var $t=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"poc",staticClass:"text-left"})])],1)},Qt=[],Yt=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.poc;console.log(e),e&&(e.innerHTML=ve()('\n# ODE Model\n\n## Background \n\nThe hydrogen sulfide sensor is an important part of our three-gear adjustable [kill switch](/Team:Tongji_China/Design). CstR can bind to Pcst and repress gene expression. Polysulfide, which is oxidized from hydrogen sulfide by SQR, can interact with CstR, lower the affinity of CstR to its operon and activate gene expression. To achieve the goal of three-gear adjustable kill switch, thorough comprehension towards the hydrogen sulfide sensor is needed.\n\n<img src="" alt="4.2.1" style="max-width:100%" />\n\nFigure 1 The mechanism of hydrogen sulfide sensor \n\n\n\n## Modelling \n\n#### Goals \n\nBy constructing the model of hydrogen sulfide sensor, we hope to achieve the following goal:\n\n1. To understand how the sensor will behave in different polysulfide concentrations.\n\n2. To understand how the reaction parameters can affect the performance of the sensor.\n\n3. To understand how we can improve the performance of our kill switch. \n\n#### Assumptions\n\nIn order to simplify our system, we make a list of assumptions after thoroughly consideration.\n\n1. At the beginning, P_cst is repressed by CstR in all the plasmids.\n\n2. At the beginning, there is no mKate mRNA and mKate protein in the cell.\n\n3. The volume of immobilized cells stays constant, and division of cells isn’t taken into account in this model.\n\n#### Model \n\nThe kinetics of polysulfide-CstR binding and CstR-P_cst binding has not been studied in details as far as we known so we decided to model the apparent relationship between polysulfide and mKate expression. The apparent kenetics of these process can be described using Hill equation as follow. \n\n$\frac{d[openPcst]}{dt}=\frac{V_{max}[H{S}_{n}H{]}^n}{K_d+[H{S}_{n}H{]}^n}$\n\n$\frac{d[mKateRNA]}{dt}=k_{m}kateRNA\ast [openPcst]-k_{RNA,de}\ast [mKateRNA]$\n\n$\frac{d[mKate]}{dt}=k_{kate}\ast [mKateRNA]-K_{kate,de}\ast [mKate]$\n\n#### Parameters \n\n After constructing the model, we tried to find the proper constants for each reaction and set reasonable initial values for the reactant. Due to the limited amount of experimental data and information available, some of the reaction constants had to be estimated by either fitting data or using numerical averages of a similar part. Values of these parameters are listed below.\n\n| **parameter** | **value** | **unit** | **description** | **source** |\n| ------------------------ | ---------- | -------- | ------------------------------------------------------------ | ---------- |\n| ***n*** | 3 | \\ | Hill Coefficient of the apparent polysulfide-P_cstreaction | [1] |\n| ***K_d*** | 9.5*10¹² | M³ | Apparent dissociation constant of polysulfide and P_cst | [1] |\n| ***V_max*** | 1 | M/s | The maximum reaction rate | \\ |\n| ***K_kate,mRNA*** | 0.02 | s^-1 | The transcription rate of mKate | [2] |\n| ***K_kate,de*** | 0.003 | s^-1 | The degradation rate of mKate mRNA | [3] |\n| ***K_kate*** | 0.06 | s^-1 | The translation rate of mKate | [4] |\n| ***K_kate,de*** | 0.02 | s^-1 | The degradation rate of mKate | [3] |\n| [ ***Closed P_cst*** ] | 2*10⁴ | M | Calculated from the copy number of pBR322 | \\ |\n| [***HS_nH***] | 1*10⁵ | M | \\ | \\ |\n\nTable 1 Reaction parameters and initial values for the reactant \n\n\n\n#### Validation and analysis \n\nTo validate our model, we firstly compared the mKate expression simulated by our model with our experimental data and found that they showed good consistency. The experimental data has higher mKate expression in the first few hours, indicating leaky expression, which is not described in our model. Leaky expression be a serious problem when it can lead to unexpected toxin protein expression. \n\n<img src="" alt="4.2.2" style="max-width:100%" />\n\nFigure 2 Comparison of simulation data and experimental data \n\nTo understand how the sensor would behave in different polysulfide concentrations, we run a scan with 6 different initial concentrations of polysulfide from 10 μM to 35μM by evenly spaced intervals. As expected, a higher concentration of polysulfide produces higher output of mKate. However, the difference between selected concentrations is very little in the first few hours. This might affect the promptness of the kill switch.\n\n<img src="" alt="4.2.3" style="max-width:100%" />\n\nFigure 3 Sensor behaviors in different polysulfide concentrations \n\nNext, we hope to figure out how these reaction parameters affect the performance of the sensor. Sensitivity analysis reveals that K_d have the greatest influence on the output. K_d is a parameter which is related to CstR expression level, the affinity between HS_nH and the affinity between CstR and P_cst. When K_d is large (10^-11~10^-9) , increasing K_d can significantly down-regulate the downstream output, while increasing a small K_d do not have much influence. \n\n\n\n<img src="" alt="4.2.4" style="max-width:100%" />\n\nFigure 4 Sensitivity analysis \n\n<img src="https://static.igem.org/mediawiki/2021/5/55/T--Tongji_China--4.2.5.jpg\n" alt="4.2.5" style="max-width:100%" />\n\nFigure 5 Sensitivity analysis of Kd \n\n\n\n## Conclusion\n\nThis model answers several concerned questions and reminds us of some important points in kill switch improvement. \n\n1. The leaky expression and lack of promptness are problems which should be taken seriously when doing further improvement.\n2. K_d is an important parameter when we hope to regulate downstream expression of genes. It may be adjusted by regulating CstR expression.\n\n\n\n## Reference\n\n[1] Liu, H., Fan, K., Li, H., Wang, Q., Yang, Y., Li, K., Xia, Y., & Xun, L. (2019). Synthetic Gene Circuits Enable *Escherichia coli* To Use Endogenous H2S as a Signaling Molecule for Quorum Sensing. *ACS synthetic biology*, *8*(9), 2113–2120. \n\n[2] https://2010.igem.org/Team:Warsaw/Stage1/PromMeas\n\n[3] https://bionumbers.hms.harvard.edu/bionumber.aspx?s=n&v=2&id=106253\n\n[4] Zhu, M., Mori, M., Hwa, T., & Dai, X. (2019). Disruption of transcription-translation coordination in Escherichia coli leads to premature transcriptional termination. *Nature microbiology*, *4*(12), 2347–2356.\n '),this.ele=e)}}]),t}(i["a"]);Yt.id="CA",Yt=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Yt);var Xt=Yt,Zt=Xt,ei=Object(y["a"])(Zt,$t,Qt,!1,null,null,null),ni=ei.exports;T()(ei,{VCol:W["a"],VRow:G["a"]});var ti=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.sectionNum=0,e.sections=[{title:"CA Model",normalClass:"light-blue lighten-4",activeClass:"light-blue darken-3"},{title:"ODE Model",normalClass:"amber lighten-4",activeClass:"amber darken-3"}],e}return t}(i["a"]);ti.id="Models",ti=Object(c["a"])([Object(h["a"])({components:{CA:Jt,ODE:ni}})],ti);var ii=ti,ai=ii,si=Object(y["a"])(ai,Lt,Nt,!1,null,null,null),oi=si.exports;T()(si,{VBtn:_["a"],VCol:W["a"],VRow:G["a"],VSlideGroup:vn["a"],VSlideItem:Tn["a"]});var ri=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("div",[t("v-img",{attrs:{src:""}}),t("h1",{staticClass:"text-left"},[e._v("Team Members")]),t("v-row",[t("v-col",{staticClass:"col-5 offset-md-1"},[t("TMember",{attrs:{src:"",name:"Hongjuan Hu",major:"Biotechnology",hobbies:"Music, photograph",description:"Always loving beauty!"}})],1),t("v-col",{staticClass:"col-5"},[t("TMember",{attrs:{src:"",name:"Yiying Zhang",major:"Biotechnology",hobbies:"iGEM",description:"She dreams of being a guitarist, a skater and an expert in strolling. She usually has great passion for interesting work but only wants to 'lie down' at the moment."}})],1)],1),t("v-row",[t("v-col",{staticClass:"col-5 offset-md-1"},[t("TMember",{attrs:{src:"",name:"Jiayi Chen",major:"Biotechnology",hobbies:"Painting, binge-watching, biology, design",description:"She is drawn to a relaxing and peaceful life，but sometimes she wants to challenge herself."}})],1),t("v-col",{staticClass:"col-5"},[t("TMember",{attrs:{src:"",name:"Jixuan Lin",major:"Biotechnology",hobbies:"Reading literature and philosophy, writing poems sometimes, photoing, and of course sleeping",description:"Trying to be alive and keep love by looking forward to the endless"}})],1)],1),t("v-row",[t("v-col",{staticClass:"col-5 offset-md-1"},[t("TMember",{attrs:{src:"",name:"Peihao Li",major:"Information Security",hobbies:"Coding, hacking, gaming",description:"PWN Everything!"}})],1),t("v-col",{staticClass:"col-5"},[t("TMember",{attrs:{src:"",name:"Yuanjia Wang",major:"Biotechnology",hobbies:"Reading, dreaming of cats",description:"Always trial and error, always no regrets."}})],1)],1),t("v-row",[t("v-col",{staticClass:"col-5 offset-md-1"},[t("TMember",{attrs:{src:"",name:"Jiang Wu",major:"Biotechnology",hobbies:"Doing art projects, growing plants",description:"Burn the bed and the dreams I never met， I‘ll face the wind and fill my head."}})],1),t("v-col",{staticClass:"col-5"},[t("TMember",{attrs:{src:"",name:"Hanqing Zhao",major:"Clinical Medicine",hobbies:"Reading, listening to music",description:"Be interested in everything except working."}})],1)],1),t("h1",{staticClass:"text-left my-8"},[e._v("Instructor and Advisors")]),t("v-row",[t("v-col",{staticClass:"col-5 offset-md-1"},[t("TAdvisor",{attrs:{src:"",name:"Yunzhe Kang",description:"Team leader of Tongji_China 2019 and team instructor of Tongji_China 2020"}})],1),t("v-col",{staticClass:"col-5"},[t("TAdvisor",{attrs:{src:"",name:"Jiacheng Jiang",description:"Team leader and HP Group Leader of Tongji_China 2020"}})],1)],1),t("v-row",[t("v-col",{staticClass:"col-5 offset-md-1"},[t("TAdvisor",{attrs:{src:"",name:"Wenting Lu",description:"Academic group member of Tongji_China 2020"}})],1),t("v-col",{staticClass:"col-5"},[t("TAdvisor",{attrs:{src:"",name:"Siyuan Li",description:"Team leader and Academic Group leader of Tongji_China 2020"}})],1)],1)],1)},li=[],ci=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-card",{attrs:{height:"45em"}},[t("v-img",{attrs:{"max-height":"32em",src:e.src}}),t("v-card-title",[e._v(e._s(e.name))]),t("v-card-subtitle",{staticClass:"text-left text-subtitle-1"},[t("div",[e._v("Major: "+e._s(e.major))]),e._v(" Hobbies: "+e._s(e.hobbies))]),t("v-divider"),t("v-card-text",{staticClass:"text-left text-subtitle-1"},[e._v(e._s(e.description))]),t("vcar")],1)},hi=[],mi=i["a"].extend({props:{src:String,name:String,major:String,hobbies:String,description:String}}),di=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return t}(mi);di.id="TMember",di=Object(c["a"])([h["a"]],di);var pi=di,ui=pi,gi=t("b0af"),fi=t("99d9"),bi=t("ce7e"),wi=Object(y["a"])(ui,ci,hi,!1,null,null,null),yi=wi.exports;T()(wi,{VCard:gi["a"],VCardSubtitle:fi["a"],VCardText:fi["b"],VCardTitle:fi["c"],VDivider:bi["a"],VImg:C["a"]});var vi=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-card",{attrs:{height:"41em"}},[t("v-img",{attrs:{src:e.src,"max-height":"32em"}}),t("v-card-title",[e._v(e._s(e.name))]),t("v-divider"),t("v-card-text",{staticClass:"text-left text-subtitle-1"},[e._v(e._s(e.description))]),t("vcar")],1)},Ti=[],Ci=i["a"].extend({props:{src:String,name:String,description:String}}),xi=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return t}(Ci);xi.id="TAdvisor",xi=Object(c["a"])([h["a"]],xi);var Ai=xi,ki=Ai,Si=Object(y["a"])(ki,vi,Ti,!1,null,null,null),ji=Si.exports;T()(Si,{VCard:gi["a"],VCardText:fi["b"],VCardTitle:fi["c"],VDivider:bi["a"],VImg:C["a"]});var Ei=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){return Object(o["a"])(this,t),n.apply(this,arguments)}return t}(i["a"]);Ei.id="Team",Ei=Object(c["a"])([Object(h["a"])({components:{TMember:yi,TAdvisor:ji}})],Ei);var _i=Ei,Pi=_i,zi=Object(y["a"])(Pi,ri,li,!1,null,null,null),Oi=zi.exports;T()(zi,{VCol:W["a"],VImg:C["a"],VRow:G["a"]});var Bi=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"attribution",staticClass:"text-left"})])],1)},Hi=[],Fi=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){var e=this.$refs.attribution;console.log(e),e&&(e.innerHTML=ve()("\n\n## Attributions & Acknowledgements\n\n### Team members\n\n**Hongjuan Hu**:\n\nTeam Leader, HP group leader,\n\nContact with collaboration and partnership,\n\nWiki writing\n\n\n\n**Yiying Zhang**:\n\nTeam Leader, Academic Group Leader,\n\nPlasmid construction and primer design,\n\noptimizations of promoter pathways (including wet lab and modeling),\n\nParticipating HP,\n\nWiki writing\n\n\n\n**Jiayi Chen**:\n\nThe construction and expression of Kill Switch,\n\nWiki writing,\n\nart design(Logo and poster design)\n\n\n\n**Jixuan Lin** :\n\nExpression of removing sulfur,\n\nParticipating HP,\n\nWiki writiing\n\n\n\n**Peihao Li** :\n\nWiki design\n\n\n\n**Yuanjia Wang**:\n\nIn charge of human practiced(participating and content planing),\n\nIn charge of education and public engagement,\n\nWiki writing\n\n\n\n**Jiang Wu**:\n\nExpression of removing sulfur,\n\nWiki writing and design\n\n\n\n**Hanqing Zhao** :\n\nExpression of removing sulfur,\n\n Plasmid construction and primer design,\n\nwiki writing\n\n\n\n### Instructor and advisors\n\n**Yuanzhe Kang** :\n\nInstructor.\n\nTeam leader of Tongji_China 2019 and team instructor of Tongji_China 2020. He helped us in building the team Tongji_China 2021. Guidance of project and experiments\n\n\n\n**Jiacheng Jiang** :\n\nAdvisor.\n\nTeam leader and HP Group Leader of Tongji_China 2020. He helped us in topic selction and the content arrangement in Human Practices.\n\n\n\n**WenTing Lu** :\n\nAdvisor.\n\nAcademic group member of Tongji_China 2020. She helped us in molecular cloning experimental design and primer design.\n\n\n\n**Siyuan Li** :\n\nAdvisor.\n\nTeam leader and Academic Group leader of Tongji_China 2020. He helped us in molecular cloning experimental design and primer design.\n\n\n\n## Acknowledgements\n\n### **Principal Investigator**\n\n#### School of Life Science and Technology,Tongji Univesity:\n\n- **Prof. Jing Zhang**: Deputy Dean of School, our primary PI. She helped us in various aspects.\n- **Dr. Ye Leng**: Associate professor of School. She kept following the process, helped us in contact with other professors and guidance outside the school.\n- **Prof. Changsheng Du**: He gave us suggestions on experiments, particularly in the area of molecular cloning and the choice of backteria.\n- **Prof. Chunguang Wang**：Professor of School. She provided suggestions on bacteria's working effeciency and potential application scenarios.\n- **Prof. Zhanyun Guo**: Professor of School. He gave us suggestions on experiments, particularly in the area of molecular cloning. He also gave us suggestions and methodological guidance on improving the stability of experimental results in the expression of hydrogen sulfide degradation.\n\n#### School of Environmental Science and Engineering, Tongji University：\n\n- **Prof. Fan Lv**: She introduced the development and market conditions of microbial fermentation and odor degradation of food waste,which inspired our final topic selection and the choice of ingredients. She also gave us suggestions on biogas slurry treatment and qualitative and quantitative detection.\n\n#### School of Political Science & International Relations, Tongji University:\n\n- **Prof. Ming Sun**：He teached us the crteria of language expression and topic selection in designing a questionnaire. He also gave suggestions on our first edition.\n\n#### School of Humanities, Tongji University\n\n- **Prof. Xinghua Lu**：Prof. Lu is a doctor of philosophy mainly focusing on philosophy of art, philosophy of technology and urban philosophy. He evaluated our project from the perspective of philosophy and gave suggestions on the techniques commonly used in synthetic biology. With the effort of Lu, a interdisciplinary communication was successfully held.\n\n\n\n### General Support\n\n#### School of Life Science and Technology,Tongji Univesity:\n\n- **Prof. Shaorong Gao**: Dean of School of Life Science and Technology, Tongji University. provided us with lots of experimental materials.\n- **Prof. Ping Li**: She shared lab resources with us.\n- **Dr. Ming Li**: She shared experimental materials with us.\n- **Mrs.Libo Xing**:Teacher in Tongji University, supports us in experimental materials.\n- **Mrs.Xin Gui**: Teacher in Tongji University, supports us in experimental materials and lab facilities.\n\n#### State Key Laboratory of Microbial Technology, Shandong University\n\n- **Prof. Huaiwei Liu**: He provided plasmid containing CstR and pCstR to us.\n\n\n\n### Others\n\n- **Zhifan Lin**: Junior student from School of Life Science and Technology,Tongji Univesity. He provided as numerous support on the field and literature search at the early stage of our topic selection. He also participated in the code part of making 'Synthesis of Biology'\n\n- **Youjun Shi**: Junior student from School of Life Science and Technology,Tongji Univesity. He participated field and literature search at the early stage of our topic selection. He also participated in the design of making 'Synthetic of Biology'\n\n- **Liwen Jing**: Third year postgraduate student from College of Surveying and Geographic Informatics，Tongji University. He was responsible for team photo shoots.\n\n- **Jiaxing Li**: Junior student from College of Philosophy, Law & Political Science, Shanghai Normal University. She gave us more detailed suggestions on our revised questionnaires and introduced relationships between design and analytical skills after collecting questionnaires.\n\n### Human Prctice Support\n\n- **Dr. Guangpu Guo** : Associate Professor of School of Life Science and Technology,Tongji Univesity. He helped us get in touch with Shanghai Minhang District Youth Science and Technology Centre.\n- **Mr. Wenwei Wu**: Head of Amenities Management Office in Hongmei Street. He showed us wet waste localisation process in Shanghai Citizen Environmental Protection Experience Center and helped us get in touch with the head of Shanghai Tianwei Environmental Protection Technology Co.,Ltd to know more information.\n- Shanghai Tianwei Environmental Protection Technology Co.,Ltd. Staffs from it introduced the whole waste disposal process, including front-end crushing and back-end composting, which inspired us the location our biological products can be used in.\n- **Mrs.Li**: Teacher in Shanghai Minhang District Youth Science and Technology Centre. She supported us in holding science communication activities.\n\n### Financial Support\n\nSchool of Life Science and Technology of Tongji University provided the experiment fund for us.\n "),this.ele=e)}}]),t}(i["a"]);Fi.id="Attribution",Fi=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],Fi);var Mi=Fi,Ri=Mi,Di=Object(y["a"])(Ri,Bi,Hi,!1,null,null,null),Ii=Di.exports;T()(Di,{VCol:W["a"],VRow:G["a"]});var Li=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"poc",staticClass:"text-left"})])],1)},Ni=[],qi=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.poc;console.log(e),e&&(e.innerHTML=ve()('\n# Collaboration\n\nWe realize that igem is not only a competition for solving practical problems using synthetic biology, but it also provides a community for every igemer to interact and collaborate. We have therefore worked well with a number of igem teams over the course of this year\'s competition and both teams have benefited from our collaborative efforts.\n\n## GA_State_SW_Jiaotong\n\n\n\nOn 5 June 2021, GA_State_SW_Jiaotong and Tongji_China held an online discussion on the development of the project and the design of the questionnaire.\n\n### GA_State_SW_Jiaotong helped us:\n\nGA_State_SW_Jiaotong put forward plenty of constructive advice on the designing of our questionnaire. For example, food waste doesn\'t have much to do with ages, so they suggested us decreasing the sorting of ages. Besides, they suggested us trying offline publicity to increase the diversity of respondents.\n\n### We helped GA_State_SW_Jiaotong :\n\nWe proposed some advice on their designing and modeling. For example, we introduced our kill switch to them, giving them an alternative design of kill switch.\n\n### Together makes us stronger\n\nWe\'ve finished **a complete and scientific questionnaire** after the discussion of questionnaire designing. As the questionnaires are important for the projects of both of us, the cooperation on questionnaire helps us **receive statistics in line with reality** and define the **following trend of the project**. Besides, we gave GA_State_SW_Jiaotong some advice on designing and modeling.\n\nSee our collaboration on [GA_State_SW_Jiaotong\'s collaboration](https://2021.igem.org/Team:GA_State_SW_Jiaotong/Collaboration).\n\n## Tongji_Software\n\n\n\nSee our collaboration on [Tongji_Software\'s collaboration](https://2021.igem.org/Team:Tongji_Software/Collaboration).\n\nWe have been in good relationship with Tongji_Software for a long time, so we have discussed with them for many times for our design and human practices. Before the 8th CCiC(Conference of China iGEMer Community), we made a pre-presentation together and asked for advice from teachers of our school. Besides, we made a collaboration on education in the seeding program for high school students. We gave online lecture on college lives, synthesis biology and the current iGEM project.\n\n## SJTU-BioX-Shanghai\n\n<img src="" alt="a9e8ef95983f46f080f69526cf37d97" style="max-width:40%" />\n\nSJTU-BioX-Shanghai contacted us when learning that we conducted the seeding program since they wanted to give lectures to more people. So we held an online meetup to talk about our ideas and experience. We happened to find that both our teams wanted to give a lecture to college students so we planned to hold a lecture together. However, because of the COVID-19, we couldn\'t give a lecture together, therefore we introduced each other\'s project when giving our own lecture.\n\n### SJTU-BioX-Shanghai helped us:\n\nSince iGEM is a crossing-field competition, SJTU-BioX-Shanghai proposed that the targets of education shouldn\'t be limited to biology-related majors. On one hand, iGEM aims at introducing synthesis biology to more people. On the other hand, crossing fields may bring us more inspiration and solution methods. Therefore we took their advice and decided to involve students with more majors.\n\n### We helped SJTU-BioX-Shanghai:\n\nWe put forward that we need to focus on the reflection of audience, therefore we introduced that a post-lecture questionnaire we used in the seeding program which guided this lecture. SJTU-BioX-Shanghai adopted our advice and designed a questionnaire for different majors in order to learn about the accpetance of their audience.\n\n### Together makes us stronger:\n\nAccording to our collaboration on education, we learned from each other and got much experience on education. Besides, in our lectures facing college students, we described each other\'s project and publicize each other\'s work.\n\nSee our collaboration on [SJTU-BioX-Shanghai\'s collaboration](https://2021.igem.org/Team:SJTU-BioX-Shanghai/Collaboration).\n\n## ICII\n\nWe realize that we need to introduce synthesis biology to more people. Therefore, we’ve designed different activities for different ages of people. [(To see more)](/Team:Tongji_China/Communication)\n\nWhen it comes to education for primary school students, we participated in ICII (Into China, Into iGEM) hosted by NAU-CHINA and CPU_CHINA. Here is what we’ve done.\n\n<video width="100%" controls>\n <source src="https://static.igem.org/mediawiki/2021/a/a4/T--Tongji_China--output.mp4" type="video/mp4">\n</video>\n\n## FAFU-CHINA\n\n<img src="" alt="7.4-6" style="max-width:30%" />\n\nWe not only hope to eliminate the odor of food waste but also want to **synthesize aroma substances**, breaking people\'s long-term bias on food waste. On the **China iGEM online meet-up**, we learned that **FAFU-CHINA** were doing **a project generating aroma**, therefore, we made a communication with members of FAFU-CHINA, putting forward the idea of partnership.\n\n<img src="" alt="7.4-1" style="max-width:100%" />\n\n### Initial stage of the project\n\nAfter proposing the idea of partnership, the two teams held **an online meetup** when both of us **shared the content and progress of our project**. During our talk, we happened to find that both of us wanted to **do a social survey**. Therefore, we **exchanged the content of our questionnaire** and **put forward some advice** respectively.\n\n<img src="" alt="7.4-2" style="max-width:100%" />\n\n<img src="" alt="7.4-3" style="max-width:100%" />\n\n#### FAFU-CHINA helps us\n\nFAFU-CHINA suggested us referring to some **proven questionnaire information** already available such as CGSS(China general social survey), ISSP(International Social Survey Program), EASS(East Asian Social Survey). Besides they recommended some books on questionnaire like \'Wan Juan Fang Fa\' published by Chongqing University. Meanwhile, FAFU-CHINA suggested us to **pre-publish** to learn about opinions of more people.\n\n#### We help FAFU-CHINA\n\nWe put forward some ideas on the questionnaire of FAFU-CHINA as well. We proposed that the description of the questionnaire should be **clear and easy-to-understand**, or they can try some **examples** to make concrete description. Besides, we thought that they can **combine multiple-choice and fill-in-the-blank questions** and understand targets\' ideas more completely.\n\n#### Together makes us stronger\n\nWe\'ve finished **a complete and scientific questionnaire** after the discussion of questionnaire designing. As the questionnaires are important for the projects of both of us, the cooperation on questionnaire helps us **receive statistics in line with reality** and define the **following trend of the project**.\n\n\n\n### Middle stage of the project\n\nWe still kept in frequent contact in the following progress of the project. As both of our projects **have close relationship with human beings** in the application scenarios, we though it essential to talk about the **reasonableness of our projects from the view of morality**. Given that we are in different cities, we **held a talk about morality in our school respectively** and worked as the **online organizers of opponent\'s activity**, making more people participated into the talk about morality.\n\n<img src="" alt="7.4-4" style="max-width:100%" />\n\n#### FAFU-CHINA helps us\n\nOn June 15th of 2021, we invited **Professor Xinghua Lu** from College of Humanities in Tongji University to give us a talk between synthesis biology and philosophy themed on **\'Philosophy vs Synthesis biology, human beings and rubbish in biosphere\'**. **FAFU-CHINA**, the online organizer, **helped organize the online part of the project**. We had a new opinion on the project and synthesis biology from the view of philosophy. With help of FAFU-CHINA, we **make more people involved into the talk**, making the **spark of thoughts overcome the restriction of distance**.\n\n#### We help FAFU-CHINA\n\nFAFU-CHINA invited **Professor Liye Zhan** from Fujian Agriculture and Forestry University who has worked in psychological health education and has much experience in human practices. We talked about the problems of **privacy and morality of targets** in the questionnaire. Under suggestion of Professor Liye Zhan, we **explained our aims** before collecting questionnaires and **respect the willingness** of targets. Also, we studied **related laws** together. All the circulation and collection of our questionnaires are based on serious discussion.\n\n#### Together makes us stronger\n\nWe realized that it\'s unavoidable to face **morality problems** when solving problems in real life by means of **synthesis biology**. In order to learn opinions of people **in different areas**, we organized **activities related to morality** and **worked as online organizer**, making more people involved and learning about more opinions.\n\n\n\n### Ended stage of the project\n\nWhen it comes to the post-project, we held an online meetup about the application problems.\n\n#### FAFU-CHINA helps us\n\nAs the initial idea of our partnership, we hope to synthesize aroma as well as eliminating the odor of food waste. The linalool producted by FAFU-CHINA does well in covering unpleasant smell of polysulfides. Therefore we decided to co-cultivate the bio-engineered bacteria used for oxidizing H₂S and generating linalool to eliminate the odor as well as generate aroma. FAFU-CHINA build a model to simulate the environment where the two kinds of bacteria are co-cultivated. The results are as follows:\n\n| group | temperature | xylose | glucose | pH | alcohols | biomass |\n| ----- | ----------- | ------ | ------- | ---- | -------- | ------- |\n| 1 | 30 | 8 | 16 | 7 | 0 | 0.663 |\n| 2 | 37 | 8 | 16 | 7 | 0 | 1 |\n| 3 | 30 | 8 | 16 | 6 | 0 | 0.943 |\n| 4 | 37 | 8 | 16 | 6 | 0 | 1.093 |\n| 5 | 30 | 8 | 16 | 5.5 | 0 | 1.58 |\n| 6 | 32.5 | 8 | 16 | 5.5 | 0 | 1.68 |\n| 7 | 35 | 8 | 16 | 5.5 | 0 | 1.024 |\n| 8 | 37 | 8 | 16 | 5.5 | 0 | 0.963 |\n| 9 | 30 | 8 | 16 | 5.25 | 0 | 1.289 |\n| 10 | 37 | 8 | 16 | 5.25 | 0 | 0.967 |\n| 11 | 30 | 8 | 16 | 5 | 0 | 1.360 |\n| 12 | 37 | 8 | 16 | 5 | 0 | 0.497 |\n| 13 | 30 | 12 | 12 | 7 | 0 | 0.557 |\n| 14 | 37 | 12 | 12 | 7 | 0 | 0.968 |\n| 15 | 30 | 12 | 12 | 6 | 0 | 0.925 |\n| 16 | 37 | 12 | 12 | 6 | 0 | 1.000 |\n| 17 | 30 | 12 | 12 | 5.5 | 0 | 1.32 |\n| 18 | 32.5 | 12 | 12 | 5.5 | 0 | 1.48 |\n| 19 | 35 | 12 | 12 | 5.5 | 0 | 1.96 |\n| 20 | 37 | 12 | 12 | 5.5 | 0 | 0.899 |\n| 21 | 30 | 12 | 12 | 5.25 | 0 | 1.113 |\n| 22 | 37 | 12 | 12 | 5.25 | 0 | 0.877 |\n| 23 | 30 | 12 | 12 | 5 | 0 | 1.288 |\n| 24 | 37 | 12 | 12 | 5 | 0 | 0.321 |\n| 25 | 30 | 8 | 16 | 7 | 1.1 | 0.234 |\n| 26 | 37 | 8 | 16 | 7 | 1.1 | 0.643 |\n| 27 | 30 | 8 | 16 | 6 | 1.1 | 0.356 |\n| 28 | 37 | 8 | 16 | 6 | 1.1 | 0.654 |\n| 29 | 30 | 8 | 16 | 5.5 | 1.1 | 1.134 |\n| 30 | 32.5 | 8 | 16 | 5.5 | 1.1 | 1.278 |\n| 31 | 35 | 8 | 16 | 5.5 | 1.1 | 0.634 |\n| 32 | 37 | 8 | 16 | 5.5 | 1.1 | 0.654 |\n| 33 | 30 | 8 | 16 | 5.25 | 1.1 | 0.625 |\n| 34 | 37 | 8 | 16 | 5.25 | 1.1 | 0.634 |\n| 35 | 30 | 8 | 16 | 5 | 1.1 | 0.999 |\n| 36 | 37 | 8 | 16 | 5 | 1.1 | 0.135 |\n\n[FAFU-CHINA\'s wiki](https://2021.igem.org/Team:FAFU-China/Model).\n\n#### We help FAFU-CHINA\n\nAt the same time, we started to **do experiments to test** our envisaged application scenarios. Therefore we received the linalool from FAFU-CHINA and planned to **react the linalool and our bio-engineered bacteria with H~2~S**. Then we will test the **components of treated gases** in order to define whether the odor is treated after processing.\n\n#### Together makes us stronger\n\nThe exploration in application makes both of our project **more complete**. For FAFU-CHINA, applying the aroma generating microorganism provides **an alternative future** for their project. For Tongji_China, eliminating odor as well as generating aroma helps us solve the problem **more completely** and provides a more **pleasant working environment** for related people, which is **in line with our values**.\n\n<img src="" alt="7.4-5" style="max-width:100%" />\n\nSee our partnership on [FAFU-CHINA\'s wiki](https://2021.igem.org/Team:FAFU-China/Partnership).\n\n### Summary\n\nWe\'ve established solid partnership with FAFU-CHINA after learning that their project can help ours in application. **At the initial stage**, we talked about our design **on questionnaire** and received scientific statistics which **define the following trend of the project**. **At the middle stage**, we **co-organized** some online and offline **lectures on morality** to talk about the morality problems we meet in the project. **At the ended stage**, we explored the possibility that we can **co-cultivate our bacteria** to **deodorizing while generating aroma by means of model**. \n\n## SJTang\n\nWe met with SJTang during the 8th CCiC(Conference of China iGEMer Community). They constructed bioengineered bacteria to produce hydrogen by modifying E.coli and R.palustris. We realized that food waste is kind of valuable resources which we can utilize. So we wanted to develop more application scenarios of our project. So we talked to SJTang and came to a consensus that we would co-cultivate the modified hydrogen-producing bacteria and our deodorizing bacteria to realize deodorizing while producing hydrogen. On the other hand, since our implementation scenarios are in waste bins where much bacteria live, it\'s essential to test co-cultivating environments.\n\nThen SJTang got our bio-engineered bacteria and helped us with the experiment.\n\n<img src="" alt="7.4-13" style="max-width:100%" />\n\nGrowth curve of 3 different strains. HoxG1 for Hydrogenase expression, T7-Sqr and SSAS for sulfide oxidization.\n
\n\nThe experiment showed that our SSAS bacteria used for degrading S^2- have similar growth rates with E.coli modified by SJTang\'s hydrogenase. So SJTang used SSAS and their hydrogenase strain for co-cultivation and did some futher experiments.\n\n<img src="" alt="7.4-14" style="max-width:100%" />\n\nGrowth curve of different strains. Both SSAS and HoxG1 use E.coli BL21 as chassis.\n
\n\nAfter doing experiments, SJTang found that this two kinds of bacteria had similar living conditions. So they induced the expression of sulfide oxidization enzymes and tested the efficiency of removing S^2- in the presence of the other bacteria. The results are as follows:\n\n<img src="" alt="7.4-15" style="max-width:100%" />\n\nS2- concentration test. Use OD 665nm for concentration domination. The higher the OD 665nm value, the greater the S2- concentration.\n
\n\n\nThe results show that after adding the E.coli modified by SJTang\'s hydrogenase, the concentration of S2- in the solution increases, although without an obvious difference. However it indicates us that we need to consider more when applying our bacteria into a complex environment. The specific reasons for this result require the cooperation of the two teams to conduct a further exploration afterward.\n\nTo see our collaboration on [SJTang\'s collaboration](https://2021.igem.org/Team:SJTang/Partnership).\n\n## DUT_China\n\nOn the **China iGEM online meet-up**, we shared about our kill switch which aroused great interests from DUT_China. Therefore, they had a heated discussion on the design of kill switch with us. They were **inspired by our design of kill switch** and **designed a kill switch** for E.coli BL21/pET28a-PD-MD-hA (Secretory) in the environment. \n\nTo see our collaboration on [DUT_China\'s collaboration](https://2021.igem.org/Team:DUT_China/Collaboration).\n\n## CPU_CHINA\n\nWe have collaborated with CPU_CHINA at different stages of our project. The details are showing in the [partnership page](/Team:Tongji_China/Partnership).\n\nTo see our collaboration on [CPU_CHINA\'s collaboration](https://2021.igem.org/Team:CPU_CHINA/Collaboration).\n '),this.ele=e)}}]),t}(i["a"]);qi.id="Collaboration",qi=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],qi);var Wi=qi,Gi=Wi,Vi=Object(y["a"])(Gi,Li,Ni,!1,null,null,null),Ui=Vi.exports;T()(Vi,{VCol:W["a"],VRow:G["a"]});var Ki=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"poc",staticClass:"text-left"})])],1)},Ji=[],$i=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.poc;console.log(e),e&&(e.innerHTML=ve()('\n## CPU_CHINA\n\n<img src="" alt="7.4-7" style="max-width:100%" />\n\nTongji_China and CPU_CHINA have been in good relationship for many years. Therefore, this year we contacted each other at the very beginning of our project.\n\n### Our timeline\n\n#### April\n\nIn April, with instructors of both teams, we held an online meetup to **talk about our topics**. We got familiar with each other and shared our ideas on opponents\' topics. We found that the problems we focus on are **about waste**. Tongji_China has focused on the **odor** caused by food waste after the implementation of garbage sorting regulations. While CPU_CHINA noticed the phenomenon that **packaging waste** were piled up near express transfer stations. Since the background of us is similar, **defined the willing to establish partnership** primarily.\n\n<img src="" alt="7.4-8" style="max-width:100%" />\n\n<img src="" alt="7.4-9" style="max-width:100%" />\n\nFigure1-1 Our first online meetup\n\n#### May\n\nIn May, our members came to **Nanjing** and had an **offline communication** with CPU_CHINA. Both of us had a more concrete **design plan** and we exchanged our ideas on the design. On the meetup, Tongji_China asked whether our **genes should be expressed intracellularly or extracellularly**. We proposed that if we wanted to express it extracellularly, secreted expression of SQR and SOD might have the problem of low transmembrane rate and the enzymes produced by lysis-engineered bacteria recovery had the problem of **enzyme degradation by intracellular proteases**. In this regard, CPU-CHINA **proposed two solutions** respectively: (i) the target protein can be assisted to exit the cell by **constructing a signal peptide library** and screening the signal peptide with the highest efficiency to avoid the encounter between the protease and the cell. (ii) The addition of **protease preparations or EDTA** during the lysis of E. coli could be considered to inhibit protease activity. Given that both of the solutions need great work, we finally decided to **express our genes intracellularly**. \n\nOn the other hand, since we learned that CPU-CHINA was going to **conduct a questionnaire** and we happened to work out a guide on how to design a questionnaire. Therefore, we **shared some experience** to them and proposed some **revising advice**. [(To see more)](/Team:Tongji_China/Contribution)\n\n<img src="" alt="7.4-12" style="max-width:100%" />\n\nFigure1-2 Our trip to Nanjing\n\n#### June\n\nIn June, there\'s **China iGEM online meetup** where teams can communicate their project. In order to do a **perfect presentation understood by everyone**, we held an online meetup to **give a pre-presentation** to each other. After presenting our projects, we had **further understanding** of each other\'s work and **proposed some advice for presentation**.\n\n<img src="" alt="7.4-10" style="max-width:100%" />\n\nFigure1-3 Our online meetup to pre-present\n\n#### July\n\nBoth of us wanted to **introduce synthesis biology** to more people, **especially to children**. Therefore, **CPU_CHINA launched \'ICII\'** (Into China, Into iGEM) that focused on the education of children. Tongji_China took part in the activity and together we **spread the idea of iGEM to children from different cities**. [(To see more)](/Team:Tongji_China/Collaboration)\n\n<img src="" alt="6.3-1" style="max-width: 100%;" title="">\n\n#### August\n\nSince the COVID-19 break out in part of Shanghai ,our predicted trip to **waste treatment factory** had to be delayed. Luckily, CPU_CHINA would visit one in Nanjing, therefore we asked for their help to **collect some information we needed**. Through the information they collected, we realized that **there\'s already methods to deal with odor in factories**. So we defined our application scenarios to be **the front and middle end**.[(To see more)](/Team:Tongji_China/Human_Practices)\n\n### Summary:\n\nWe\'ve established solid partnership with CPU_CHINA after collaborations in different stages of our project. **In the beginning** of our project, we discussed the **topic and our design**, which helps a lot in our following project. Besides, we **pre-presented** to each other to gather advice from the view of audience which **makes our presentation more easy-to-understand**. Besides, we participated in **ICII** launched by CPU_CHINA to make more **children understand the charm of synthesis biology**. Last but not least, CPU_CHINA helps us in **human practices** and collects much useful information which helps us in **defining the implementation scenarios**. \n\nSee our partnership on [CPU_CHINA\'s wiki](https://2021.igem.org/Team:CPU_CHINA/Partnership)\n\n\n## FAFU-CHINA\n\n<img src="" alt="7.4-6" style="max-width:30%" />\n\nWe not only hope to eliminate the odor of food waste but also want to **synthesize aroma substances**, breaking people\'s long-term bias on food waste. On the **China iGEM online meet-up**, we learned that **FAFU-CHINA** were doing **a project generating aroma**, therefore, we made a communication with members of FAFU-CHINA, putting forward the idea of partnership.\n\n<img src="" alt="7.4-1" style="max-width:100%" />\n\n### Initial stage of the project\n\nAfter proposing the idea of partnership, the two teams held **an online meetup** when both of us **shared the content and progress of our project**. During our talk, we happened to find that both of us wanted to **do a social survey**. Therefore, we **exchanged the content of our questionnaire** and **put forward some advice** respectively.\n\n<img src="" alt="7.4-2" style="max-width:100%" />\n\n<img src="" alt="7.4-3" style="max-width:100%" />\n\n#### FAFU-CHINA helps us\n\nFAFU-CHINA suggested us referring to some **proven questionnaire information** already available such as CGSS(China general social survey), ISSP(International Social Survey Program), EASS(East Asian Social Survey). Besides they recommended some books on questionnaire like \'Wan Juan Fang Fa\' published by Chongqing University. Meanwhile, FAFU-CHINA suggested us to **pre-publish** to learn about opinions of more people.\n\n#### We help FAFU-CHINA\n\nWe put forward some ideas on the questionnaire of FAFU-CHINA as well. We proposed that the description of the questionnaire should be **clear and easy-to-understand**, or they can try some **examples** to make concrete description. Besides, we thought that they can **combine multiple-choice and fill-in-the-blank questions** and understand targets\' ideas more completely.\n\n#### Together makes us stronger\n\nWe\'ve finished **a complete and scientific questionnaire** after the discussion of questionnaire designing. As the questionnaires are important for the projects of both of us, the cooperation on questionnaire helps us **receive statistics in line with reality** and define the **following trend of the project**.\n\n\n\n### Middle stage of the project\n\nWe still kept in frequent contact in the following progress of the project. As both of our projects **have close relationship with human beings** in the application scenarios, we though it essential to talk about the **reasonableness of our projects from the view of morality**. Given that we are in different cities, we **held a talk about morality in our school respectively** and worked as the **online organizers of opponent\'s activity**, making more people participated into the talk about morality.\n\n<img src="" alt="7.4-4" style="max-width:100%" />\n\n#### FAFU-CHINA helps us\n\nOn June 15th of 2021, we invited **Professor Xinghua Lu** from College of Humanities in Tongji University to give us a talk between synthesis biology and philosophy themed on **\'Philosophy vs Synthesis biology, human beings and rubbish in biosphere\'**. **FAFU-CHINA**, the online organizer, **helped organize the online part of the project**. We had a new opinion on the project and synthesis biology from the view of philosophy. With help of FAFU-CHINA, we **make more people involved into the talk**, making the **spark of thoughts overcome the restriction of distance**.\n\n#### We help FAFU-CHINA\n\nFAFU-CHINA invited **Professor Liye Zhan** from Fujian Agriculture and Forestry University who has worked in psychological health education and has much experience in human practices. We talked about the problems of **privacy and morality of targets** in the questionnaire. Under suggestion of Professor Liye Zhan, we **explained our aims** before collecting questionnaires and **respect the willingness** of targets. Also, we studied **related laws** together. All the circulation and collection of our questionnaires are based on serious discussion.\n\n#### Together makes us stronger\n\nWe realized that it\'s unavoidable to face **morality problems** when solving problems in real life by means of **synthesis biology**. In order to learn opinions of people **in different areas**, we organized **activities related to morality** and **worked as online organizer**, making more people involved and learning about more opinions.\n\n\n\n### Ended stage of the project\n\nWhen it comes to the post-project, we held an online meetup about the application problems.\n\n#### FAFU-CHINA helps us\n\nAs the initial idea of our partnership, we hope to synthesize aroma as well as eliminating the odor of food waste. The linalool producted by FAFU-CHINA does well in covering unpleasant smell of polysulfides. Therefore we decided to co-cultivate the bio-engineered bacteria used for oxidizing H₂S and generating linalool to eliminate the odor as well as generate aroma. FAFU-CHINA build a model to simulate the environment where the two kinds of bacteria are co-cultivated. The results are as follows:\n\n| group | temperature | xylose | glucose | pH | alcohols | biomass |\n| ----- | ----------- | ------ | ------- | ---- | -------- | ------- |\n| 1 | 30 | 8 | 16 | 7 | 0 | 0.663 |\n| 2 | 37 | 8 | 16 | 7 | 0 | 1 |\n| 3 | 30 | 8 | 16 | 6 | 0 | 0.943 |\n| 4 | 37 | 8 | 16 | 6 | 0 | 1.093 |\n| 5 | 30 | 8 | 16 | 5.5 | 0 | 1.58 |\n| 6 | 32.5 | 8 | 16 | 5.5 | 0 | 1.68 |\n| 7 | 35 | 8 | 16 | 5.5 | 0 | 1.024 |\n| 8 | 37 | 8 | 16 | 5.5 | 0 | 0.963 |\n| 9 | 30 | 8 | 16 | 5.25 | 0 | 1.289 |\n| 10 | 37 | 8 | 16 | 5.25 | 0 | 0.967 |\n| 11 | 30 | 8 | 16 | 5 | 0 | 1.360 |\n| 12 | 37 | 8 | 16 | 5 | 0 | 0.497 |\n| 13 | 30 | 12 | 12 | 7 | 0 | 0.557 |\n| 14 | 37 | 12 | 12 | 7 | 0 | 0.968 |\n| 15 | 30 | 12 | 12 | 6 | 0 | 0.925 |\n| 16 | 37 | 12 | 12 | 6 | 0 | 1.000 |\n| 17 | 30 | 12 | 12 | 5.5 | 0 | 1.32 |\n| 18 | 32.5 | 12 | 12 | 5.5 | 0 | 1.48 |\n| 19 | 35 | 12 | 12 | 5.5 | 0 | 1.96 |\n| 20 | 37 | 12 | 12 | 5.5 | 0 | 0.899 |\n| 21 | 30 | 12 | 12 | 5.25 | 0 | 1.113 |\n| 22 | 37 | 12 | 12 | 5.25 | 0 | 0.877 |\n| 23 | 30 | 12 | 12 | 5 | 0 | 1.288 |\n| 24 | 37 | 12 | 12 | 5 | 0 | 0.321 |\n| 25 | 30 | 8 | 16 | 7 | 1.1 | 0.234 |\n| 26 | 37 | 8 | 16 | 7 | 1.1 | 0.643 |\n| 27 | 30 | 8 | 16 | 6 | 1.1 | 0.356 |\n| 28 | 37 | 8 | 16 | 6 | 1.1 | 0.654 |\n| 29 | 30 | 8 | 16 | 5.5 | 1.1 | 1.134 |\n| 30 | 32.5 | 8 | 16 | 5.5 | 1.1 | 1.278 |\n| 31 | 35 | 8 | 16 | 5.5 | 1.1 | 0.634 |\n| 32 | 37 | 8 | 16 | 5.5 | 1.1 | 0.654 |\n| 33 | 30 | 8 | 16 | 5.25 | 1.1 | 0.625 |\n| 34 | 37 | 8 | 16 | 5.25 | 1.1 | 0.634 |\n| 35 | 30 | 8 | 16 | 5 | 1.1 | 0.999 |\n| 36 | 37 | 8 | 16 | 5 | 1.1 | 0.135 |\n\n[FAFU-CHINA\'s wiki](https://2021.igem.org/Team:FAFU-China/Model)\n\n#### We help FAFU-CHINA\n\nAt the same time, we started to **do experiments to test** our envisaged application scenarios. Therefore we received the linalool from FAFU-CHINA and planned to **react the linalool and our bio-engineered bacteria with H~2~S**. Then we will test the **components of treated gases** in order to define whether the odor is treated after processing.\n\n#### Together makes us stronger\n\nThe exploration in application makes both of our project **more complete**. For FAFU-CHINA, applying the aroma generating microorganism provides **an alternative future** for their project. For Tongji_China, eliminating odor as well as generating aroma helps us solve the problem **more completely** and provides a more **pleasant working environment** for related people, which is **in line with our values**.\n\n<img src="" alt="7.4-5" style="max-width:100%" />\n\nSee our partnership on [FAFU-CHINA\'s wiki](https://2021.igem.org/Team:FAFU-China/Partnership)\n\n### Summary\n\nWe\'ve established solid partnership with FAFU-CHINA after learning that their project can help ours in application. **At the initial stage**, we talked about our design **on questionnaire** and received scientific statistics which **define the following trend of the project**. **At the middle stage**, we **co-organized** some online and offline **lectures on morality** to talk about the morality problems we meet in the project. **At the ended stage**, we explored the possibility that we can **co-cultivate our bacteria** to **deodorizing while generating aroma by means of model**. \n\n## SJTang\n\nWe met with SJTang during the 8th CCiC(Conference of China iGEMer Community). They constructed bioengineered bacteria to produce hydrogen by modifying E.coli and R.palustris. We realized that food waste is kind of valuable resources which we can utilize. So we wanted to develop more application scenarios of our project. So we talked to SJTang and came to a consensus that we would co-cultivate the modified hydrogen-producing bacteria and our deodorizing bacteria to realize deodorizing while producing hydrogen. On the other hand, since our implementation scenarios are in waste bins where much bacteria live, it\'s essential to test co-cultivating environments.\n\nThen SJTang got our bio-engineered bacteria and helped us with the experiment.\n\n<img src="" alt="7.4-13" style="max-width:100%" />\n\nGrowth curve of 3 different strains. HoxG1 for Hydrogenase expression, T7-Sqr and SSAS for sulfide oxidization.\n
\n\nThe experiment showed that our SSAS bacteria used for degrading S^2- have similar growth rates with E.coli modified by SJTang\'s hydrogenase. So SJTang used SSAS and their hydrogenase strain for co-cultivation and did some futher experiments.\n\n<img src="" alt="7.4-14" style="max-width:100%" />\n\nGrowth curve of different strains. Both SSAS and HoxG1 use E.coli BL21 as chassis.\n
\n\nAfter doing experiments, SJTang found that this two kinds of bacteria had similar living conditions. So they induced the expression of sulfide oxidization enzymes and tested the efficiency of removing S^2- in the presence of the other bacteria. The results are as follows:\n\n<img src="" alt="7.4-15" style="max-width:100%" />\n\nS2- concentration test. Use OD 665nm for concentration domination. The higher the OD 665nm value, the greater the S2- concentration.\n
\n\n\nThe results show that after adding the E.coli modified by SJTang\'s hydrogenase, the concentration of S2- in the solution increases, although without an obvious difference. However it indicates us that we need to consider more when applying our bacteria into a complex environment. The specific reasons for this result require the cooperation of the two teams to conduct a further exploration afterward.\n '),this.ele=e)}}]),t}(i["a"]);$i.id="Partnership",$i=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],$i);var Qi=$i,Yi=Qi,Xi=Object(y["a"])(Yi,Ki,Ji,!1,null,null,null),Zi=Xi.exports;T()(Xi,{VCol:W["a"],VRow:G["a"]});var ea=function(){var e=this,n=e.$createElement,t=e._self._c||n;return t("v-row",[t("v-col",{staticClass:"col-3"},[e.ele?t("Anchor",{attrs:{ele:e.ele}}):e._e()],1),t("v-col",{staticClass:"col-9"},[t("div",{ref:"mc",staticClass:"text-left"})])],1)},na=[],ta=function(e){Object(r["a"])(t,e);var n=Object(l["a"])(t);function t(){var e;return Object(o["a"])(this,t),e=n.apply(this,arguments),e.ele=null,e}return Object(p["a"])(t,[{key:"mounted",value:function(){window.scrollTo(0,0);var e=this.$refs.mc;console.log(e),e&&(e.innerHTML=ve()("\n# Medal criteria\n\n## Bronze\n\n**Competition deliverable:**\n\nWe've finished our wiki, the presentation video and filled in the judging form on time.\n\n**Attributions**: https://2021.igem.org/Team:Tongji_China/Attributions\n\nWe've recorded each members' attributions and those who contribute to our project in detail.\n\n**Project Description**: https://2021.igem.org/Team:Tongji_China/Description\n\nWe've described our project from abstract, inspiration, background and goals&methods.\n\n**Contribution**: https://2021.igem.org/Team:Tongji_China/Contribution\n\nWe've finished a guide to design a questionnaire in order to help the future iGEM teams when designing questionnaires. Also we updated some information of existed parts.\n\n## Silver\n\n**Engineering Success**: https://2021.igem.org/Team:Tongji_China/Engineering\n\nWe've done successful engineering in expression of H~2~S oxidization related enzymes.\n\n**Collaboration**: https://2021.igem.org/Team:Tongji_China/Collaborations\n\nWe've collaborated with GA_State_SW_Jiaotong, Tongji_Software, SJTU-BioX-Shanghai and ICII(Into China, Into iGEM), during which we've got much improvement for our project.\n\n**Human Practices**: https://2021.igem.org/Team:Tongji_China/Human_Practices\n\nWe've done a series of human practices based on our values to explore the meaning of our project to the world.\n\n**Proposed Implementation**: https://2021.igem.org/Team:Tongji_China/Implementation\n\nWe've taken implementation of our project into consideration and finished much work to test our application meanings.\n\n## Gold\n\n**Integrated Human Practices**: https://2021.igem.org/Team:Tongji_China/Human_Practices\n\nWe've finished a series of human practices in different stages of our project, most of them determines our choice in purpose, design and execution.\n\n**Project Modeling**: https://2021.igem.org/Team:Tongji_China/Model\n\nWe've built two models, one is for predicting whether our three-gear-adjustable kill switch can work as expected, the other one is for simulating the spread and working efficiency of our bacteria.\n\n**Partnership**: https://2021.igem.org/Team:Tongji_China/Partnership\n\nWe've established solid partnership with CPU_CHINA, FAFU-CHINA and SJTang. Our long-term partnership has great meaning to both of our teams.\n\n**Proof of Concept**: https://2021.igem.org/Team:Tongji_China/Proof_Of_Concept\n\nWe've tested the efficiency of our bacteria of eliminating the odor of eggs.\n\n**Education & Communication:** https://2021.igem.org/Team:Tongji_China/Communication\n\nIn order to introduce synthesis biology to more people, we've designed different activities to different ages of people, from primary school students to college student and received many reflections.\n\n "),this.ele=e)}}]),t}(i["a"]);ta.id="Medal",ta=Object(c["a"])([Object(h["a"])({components:{Anchor:we}})],ta);var ia=ta,aa=ia,sa=Object(y["a"])(aa,ea,na,!1,null,null,null),oa=sa.exports;T()(sa,{VCol:W["a"],VRow:G["a"]}),i["a"].use(ne["a"]);var ra=[{path:"",name:le.id,component:le},{path:"/Description",name:ke.id,component:ke},{path:"/Results",name:Oe.id,component:Oe},{path:"/Contribution",name:Ie.id,component:Ie},{path:"/Design",name:xn.id,component:xn},{path:"/Engineering",name:Pn.id,component:Pn},{path:"/Experiments",name:Rn.id,component:Rn},{path:"/Notebook",name:Gn.id,component:Gn},{path:"/Parts",name:Yn.id,component:Yn},{path:"/Proof_Of_Concept",name:at.id,component:at},{path:"/Safety",name:mt.id,component:mt},{path:"/Human_Practices",name:wt.id,component:wt},{path:"/Communication",name:kt.id,component:kt},{path:"/Implementation",name:Ot.id,component:Ot},{path:"/Entrepreneurship",name:It.id,component:It},{path:"/Model",name:oi.id,component:oi},{path:"/Team",name:Oi.id,component:Oi},{path:"/Attributions",name:Ii.id,component:Ii},{path:"/Collaborations",name:Ui.id,component:Ui},{path:"/Partnership",name:Zi.id,component:Zi},{path:"/Medal_Criteria",name:oa.id,component:oa}],la=new ne["a"]({mode:"history",base:"/Team:Tongji_China",routes:ra}),ca=la,ha=t("2f62");i["a"].use(ha["a"]);var ma=new ha["a"].Store({state:{},mutations:{},actions:{},modules:{}}),da=t("f309");i["a"].use(da["a"]);var pa=new da["a"]({});i["a"].config.productionTip=!1,new i["a"]({router:ca,store:ma,vuetify:pa,render:function(e){return e(ee)}}).$mount("#app")},ed1f:function(e,n,t){},f59d:function(e,n,t){}});

//# sourceMappingURL=app.js.map