Team:Leiden/Distribution-kit-search/dataset

[{"machine":"BBa_K314110","videoId":"BBa_K314110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1A - [ Translational_Unit ] ['45minutes. As is clearly visible on the gel to the right single strand DNA of...the plasmid is only made when the f1 origin is present....included. This is considered an indication of the increasing ssDNA plasmid... Figure 2. Graph showing yield of ssDNA vs time. It is also shown the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K731722","videoId":"BBa_K731722","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1D - [ Terminator,rnap, bacteriophage, t7, terminator, single ] ['with T7 RNAP T7 promoter 0.985 0.001 with E. coli RNAP Ptac ...The characterization of this part was done by the Trento iGEM team 2012 using...peak is at 515 nm and the emission of mVenus was collected at its maximum...at 609 nm. Here is a summary of these wavelengths ...The activity of this part was analyzed both with T7 and E. coli RNA... Vs is the A206K Venus peak s intensity of the construct with the terminator of interest inserted in the prefix suffix linker ... Vc is the A206K Venus peak s intensity of the control construct without intervening terminator ... Cs is the mCherry peak s intensity of the construct with the terminator inserted ... Cc is the mCherry peak s intensity of the control construct ...T7 lysozyme is a natural inhibitor of T7 RNA polymerase activity thus...behind a lacUV5 promoter.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...T7 RNAP T7 promoter 0.985 0.001 with E. coli RNAP Ptac ...']]"},{"machine":"BBa_K398326","videoId":"BBa_K398326","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1C - [ Regulatory,promoter ] ['Promoter of the CaiF protein...pCaiF is a promoter region from E.coli containing the binding site for the...global regulator Crp which is expressed during periods of starvation. Under ...pCaiF is tightly regulated by cAMP levels....pCaiF is a natural promoter found in E. coli K12 pCaiF is part of the...translational unit of the protein CaiF which is a transcriptional regulator of...Figure 1 Illustration of the mechanism of promoter pCaiF. At the left the...promoter is off because there is enough substrate glucose . At the right the...promoter is on activated by the presence of cAMP crp...certain cell density is reached they can start to degrade other carbon sources...promoters in the catalog....The pCaiF promoter was characterized using GFP generator E0040. To determine...be concluded that the part is sensitive to cAMP levels. Moreover it was found...that the part is active under starvation periods stationary phase at low... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be... promoter...']]"},{"machine":"BBa_K398331","videoId":"BBa_K398331","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1E - [ Measurement ] ['pCaiF is a promoter region from E.coli containing the binding site for the...global regulator Crp which is expressed during periods of starvation. Under ...pCaiF is tightly regulated by cAMP levels....We are very interested in this promoter. According to the description of this...part pCaiF is a natural promoter found in E. coli K12 which regulates the...The promoter is regulated by the level of cAMP. Because decomposition product... Figure 3. This is the cell concentration corresponding to the fluorescence...is that GFP per cell of group 1 and group 2 is slightly higher compared to...OD600 to cells amounts. The right line chart is in the log scale and the left...is in the log scale and the left is in normal.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K808025","videoId":"BBa_K808025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1F - [ Coding,cds, enzyme, function, degradation ] ['A cutinase is a cuticula degrading hydrolase from the fungus Fusarium solani...Atomic force microscopy is used to make very precise surface analysis up to...A piece of a PET water bottle is melted between two metal plates using a heat...gun to create a flat sample. It is incubated for 24 h at 37 C after applying...a solution of 90 mol L FsC. The Sample is washed with distilled water and...The resulting surface is not only rougher but persumably less dense and...Conditions were set at T 34 C and pH 7.4. The method is simple. The...absorption is measured every minute over 30 minutes by an ELISA reader capable...The mechanism of pNPB degradation. The release of pNP is measured by the...quantified by measuring the absorbtion at 405 nm over time. 405 nm is the...Burk diagram. At the point where the regression line is crossing the x axis...the x coordinate amounts to 1 Km. So Km is about 400 M. To calculate the...associated y coordinate is 1 Vmax. Consequently Vmax for 5nM FsC is 0 001467...The Kcat value is calculated through dividing Vmax by the enzyme concentration...This part was used by Tianjin 2015 in its Stimulated Plastic Enzymolysis.We... Figure 2. The results of SDS PAGE. M is Protein marker. a is sample of FsC...which is non induced. b is sample of FsC which is induced....The amount of protein after induced is larger than non induced and molecular...weight is about 25kDa which is target protein s molecular weight. So we infer... Figure 2. The result of protein BL21 FsC expression. M is Protein marker....a is sample of FsC in BL21 which is non induced. b is sample of FsC in BL21...which is induced. c is sample of supernatant after breaking bacteria and...centrifugation d is sample of sediment after breaking bacteria and...sample of media after filtration by Ni column. g is sample of liquid after...removing impurity with 50mM MCAC. h is sample of media after removing impurity...with 50mM MCAC. i is sample of target protein after washing with 200mM MCAC. j...There is still a little protein combine with media after washing with 200mM...to 1X PBS because 200mM MCAC is noxious for enzyme. Final concentration is... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K314100","videoId":"BBa_K314100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1G - [ Composite ] ['constructs were grow in DH5a constitutive promoters...inducible promoter...BL21 DE3 T7 promoter ...']]"},{"machine":"BBa_K808001","videoId":"BBa_K808001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1H - [ Coding ] []]"},{"machine":"BBa_K314101","videoId":"BBa_K314101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1I - [ Composite ] ['constructs were grow in DH5a constitutive promoters...inducible promoter...BL21 DE3 T7 promoter ...']]"},{"machine":"BBa_K808003","videoId":"BBa_K808003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1J - [ Coding ] ['protein with 5 alpha helical spanners Fig. 1 . The N teminus is with a... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K314201","videoId":"BBa_K314201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1K - [ Coding ] ['Reference showing that Tse2 is toxic Tsi2 is the antitoxin and that these...']]"},{"machine":"BBa_K808010","videoId":"BBa_K808010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1L - [ Coding,cds, biosynthesis, function, degradation ] [' TphB is coding for the decarboxylating cis dihydrodiol dehydrogenase from...']]"},{"machine":"BBa_K314202","videoId":"BBa_K314202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1M - [ Coding ] ['for individual regulation of each component separately. Use this part if you...It is a substrate for the Pseudomonas aeruginosa type 6 secretion system. ...protein Tse2. Tsi2 is not secreted through the Type 6 Secretion System....']]"},{"machine":"BBa_K808011","videoId":"BBa_K808011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1N - [ Coding,cds, biosynthesis ] [' TphA1 is coding for the terephthalate dioxygenase reductase from Comamonas...TphA1 is just like TphA2 an Rieske protein with an iron sulfur center. In...TphA1 reduces the TphA2A3 complex and is again in the oxidized state....']]"},{"machine":"BBa_K346002","videoId":"BBa_K346002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1O - [ Regulatory,function, sensor, metal, promoter, regulation ] ['PmerT promoter mercury responsive ...This part PmerT is a promoter from Tn21 mercury resistance mer operon. The...divergently oriented promoters Pr and Ptpad. Park Wireman et al. 1992 . Pr...is the promoter of the regulatory protein gene merR and Ptpcad is for the...dimeric MerR regulator binds to the operator region of the promoter and...recruits RNA polymerase forming a ternary complex. Transcription is slightly...repressed because the apo MerR regulator dimer has bent the promoter DNA such...realignment of the promoter such that RNA polymerase contacts the 35 and 10...The key sequence for MerR s binding is a region of interrupted dyad symmetry...And the structure of Pr botton strand is similar to Ptpcad in a divergent... 35 and 10 elements of mercury inducible promoter PmerT which has a...polymerase is inhibited Fig.2 . The Hg bound MerR can result in an a...competing relationship. The threshold of PmerT is controlled by the expression... Fig.2. DNA sequence of the Tn21 mer operon promoter region. The MerR...binding site on PmerT is marked by a box. The 35 and 10 regions for both...sequence that MerR recognizes and binds to is marked with arrows under the DNA...sequence. The divergently oriented promoters are marked by blue box and purple...constitutive promoter J23 family that drives the expression of an mercury...receptor MerR which would de repress its cognate promoter merR on murcury...We select three constitutive promoters of varying strengths from iGEM promoter...promoter that is the lower the MerR receptor concentration the more... Figure 4 A Different constitutively J23 family promoter measured... The Hill constant EC50 is the inducer concentration that provokes half maximal activation of a sensor EC50 is negatively correlated with sensitivity.... KTop is the sensor s maximum output expression level KTop is positively correlated with output amplitude.... promoter ...chassis it works in DH5 alpha n a PmerT promoter mercury responsive ...']]"},{"machine":"BBa_K808013","videoId":"BBa_K808013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 1P - [ Coding,cds, biosynthesis ] [' TphA3 is coding for the small terephthalate 1 2 dioxygenase subunit from...']]"},{"machine":"BBa_K548000","videoId":"BBa_K548000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2A - [ Signalling ] ['This BioBrick is a human cell line optimized version of Aequorin a...blue light max 469nm 1 . Aequorin is NOT a fluorescent protein it does not...EcoRI and PstI restrictions sites and is ligated to the iGEM pSB1C3 backbone....Results of our luminometer experiments. Note that the y axis is logarithmic....our biobrick produce blue light but that this production of light is heavily...']]"},{"machine":"BBa_K325210","videoId":"BBa_K325210","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2B - [ Reporter,classic, reporter, function, reporter, light ] ['This part is contains the coding sequence for a mutant light emitting enzyme...wavelength when placed under a promoter provided the media is supplemented...']]"},{"machine":"BBa_K648028","videoId":"BBa_K648028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2C - [ Coding ] ['Cro is produced by the pr promoter in the lambda phage system. Normally C1 is...repressing the pr promoter. However when the lytic switch is thrown and RecA...cleaves the C1 dimer the pr promoter is unrepressed. This results in the...production of cro which in turn represses the prm promoter which halts the...']]"},{"machine":"BBa_K325219","videoId":"BBa_K325219","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2D - [ Generator ] ['This part generates a red mutant of the luciferase from the Japanese firefly... L.cruciata as well as the luciferin regenerating enzyme LRE . It is under...the control of an Arabinose induced promoter. D Luciferin has to be added to...6 hydroxybenzothiazole CHBT . This compound is non enzymatically converted...the natural system L cysteine is used to produce L Luciferin which then...']]"},{"machine":"BBa_K648029","videoId":"BBa_K648029","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2E - [ Coding ] ['This region contains promoters prm and pr facing in opposite directions. It...C1 dimer is bound naturally bound to the Or1 repressing promotor pr and...the lytic state. The Cro produced at the pr promoter then binds to the Or3...site inhibiting the prm promoter. For a better description of the Lambda... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K325108","videoId":"BBa_K325108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2F - [ Generator ] ['This part is a translational unit for a mutant of the luciferase from the...North American firefly P. pyralis . It is under the control of an Arabinose...induced promoter pBAD . D Luciferin has to be added to obtain light output....EPIC stands for Enhanced Photon Initiating Complex . It is described in...The part is codon optimised for expression in E.coli ....']]"},{"machine":"BBa_K530015","videoId":"BBa_K530015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2G - [ Regulatory ] ['FCY2 Yeast Promoter...FCY2 Promoter is used to regulate the expression of genes within the genome of...This is the sequencing for colony 8. Colony 8 is a perfect match with the...genomic DNA promoter....']]"},{"machine":"BBa_K325209","videoId":"BBa_K325209","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2H - [ Generator,classic, generator, uncategorized ] ['This is the wild type luciferase from Luciola cruciata with a luciferin...regenerating enzyme both under the control of an arabinose induced promoter....']]"},{"machine":"BBa_K530019","videoId":"BBa_K530019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2I - [ Terminator ] ['HHO1 Terminator is used to regulate the expression of genes within the genome...This is the sequencing for colony 1. Colonies 1 and 10 are both a perfect...match with the genomic DNA promoter....']]"},{"machine":"BBa_K325259","videoId":"BBa_K325259","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2J - [ Generator,classic, generator, uncategorized ] ['This part should show similarity to...This part is based on part...This part is based on Part... page does not exist planning will be the successor to this part...be submitted during November 2010. In the meantime it is possible to use this...']]"},{"machine":"BBa_K530025","videoId":"BBa_K530025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2K - [ Coding ] ['This is the sequencing for GLGP. The areas of mismatch in the middle of the...sequence are due to the fact that the gene is too long for only two primers to...']]"},{"machine":"BBa_K325903","videoId":"BBa_K325903","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2L - [ Generator ] ['This part contains the Genes LuxE and LuxG from V.fischeri that have been...than 30 C if light production is desired.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K542003","videoId":"BBa_K542003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2M - [ Inverter ] ['Production of TetR is regulated by the pBAD promoter...the constitutively on promoter...Therefore this part may be used in conjunction with the pTet promoter as an...This part was characterized in...']]"},{"machine":"BBa_K316027","videoId":"BBa_K316027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2N - [ Composite ] ['promoter hyper spank...site. Due to the 8bp recognition sequence it is a rare site that can be used...cloning steps are not required and ligated into the vector after it is cut...wet lab work involving this part....For more information about this part of our project please visit our...']]"},{"machine":"BBa_K542010","videoId":"BBa_K542010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2O - [ Coding ] ['that the interior of the MC is negatively charged the UL 2009 iGEM team has...']]"},{"machine":"BBa_K415023","videoId":"BBa_K415023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 2P - [ Composite ] ['This is a LuxR LacO regulated GFP LuxR cI regulated mCherry with LuxR cI ...regulated AHL amplification TetR regulated LuxR production. This part...activated by presence of both LuxR and 3OC6HSL. The LuxR is normally...Green fluorescence is repressed by LacI and red fluorescence and auto ...induction is repressed by CI.This composite is composed of the parts...luxR mCherry and luxI and is thus auto inducing. The production of luxR is...repressed by cI. This part is intended to be used along with one of the...state 1 is induced by UV exposure and to state 2 is IPTG. If the toggle is set...exposed to certain levels of UV see power modulations cI is cleaved by Rec A...The following is the plasmid map of the part ...inhibitory lambda cI protein is more sensitive to Rec A cleavage. We got the...Glu233 Lys we were able to create a toggle that is more sensitive to UV...E0040 . However mCherry expression is directly correlated with UV exposure...mCherry both driven by the R0065 luxR cI hybrid promoter....']]"},{"machine":"BBa_K346004","videoId":"BBa_K346004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3A - [ Composite,binding, metal ] ['This part was designed to function as lead binding peptide in our project. It...translocated to the periplasm and membrane respectively. In short this part...engineering strategy. This part worked as the core part in the lead...The figure shows the structure of PbrR and MBP lead . The left is the...']]"},{"machine":"BBa_K823042","videoId":"BBa_K823042","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3B - [ Regulatory ] ['PsspK promoter regulated by sigma G...A B. subtilis promoter regulated by G late in Sporulation in the forespore...Our team used this part in the combination with P...ECF41 during Sporulation. This then activates the PydfG promoter producing...']]"},{"machine":"BBa_K316003","videoId":"BBa_K316003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3C - [ Coding ] ['Catechol or catechol 2 3 dioxygenases C2 3O O 2 is converted by a ring...cleavage into 2 hydroxymuconate semialdehyde which is the cytotoxic and bright...yellow coloured product1. This is a key enzyme in many soil bacterial...2 3 dioxygenase2 was originally isolated from Pseudomonas putida and is active...Catechol is classed as irritant in the EU but as toxic in the USA as well as...proper safety equipment. More information is available on the Material Safety... Characterization in r.p.u. of Pveg promoter ...Aims of experiment Measuring the activity of BioBrick promoters using an in...Results pVeg promoter in pSB1C3 vector a high copy plasmid has an 1.62...promoter population of cells by signal from the standard promoter J23101...reporter. The substrate catechol is colourless. However within seconds of...peak appears at about 380nm. The absorbance at this particular wavelength is...Due to technical limitations to measure kinetic parameters of XylE is to lyse...reaction as this is the only time when substrate concentration values are...plot shows an atypical curve a linear graph is expected for Michaelis Menten... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K823017","videoId":"BBa_K823017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3D - [ Terminator ] [' This is a copy of the Part B0014 wiki index.php title Part B0014 action edit redlink 1 Part B0014 page does not exist . Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K523000","videoId":"BBa_K523000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3E - [ Reporter ] ['This is based on part...part it contains the lac promoter and codes for 76 N terminal residues of...colonies with this part will be blue....The part can be used as a promoter or as a cloning vector.... Usage as a promoter ...The part can be used simply as a detectable promoter. If added upstream of...The PCR product and the plasmid containing this part can then both be digested...for this procedure The answer is that these produce compatible sticky ends...and so the new part would circularise. Thus the normal method is to use one...something similar. This is Edinburgh 2011 s exact procedure. For detailed...BioSandwich protocol BBF RFC 81 though its use is entirely optional....YAU China team verified the function of this part in E.coli and got the...this part...This is our transformation diagram of four groups of plasmids.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K817018","videoId":"BBa_K817018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3F - [ Device ] ['E.coli F plasmid transposon tn1000 tn3 family . Its promoter region consists...catastrophe. For this reason it is multimer resolution system MRS that... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K538104","videoId":"BBa_K538104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3G - [ Translational_Unit,classic, generator, rc ] ['This part was submitted by team Amsterdam... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K873002","videoId":"BBa_K873002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3H - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['HSP promoter...This promoter is 5 end upstream of the initiating AUG for groE and is...generated by ambient temperature. The promoter has consensus 35 region and... 10 region which can be recognized by sigma32 RNAP high promoter activity... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']]"},{"machine":"BBa_K538004","videoId":"BBa_K538004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3I - [ Coding,function, regulation, transcriptional ] ['Each of them comprises a promoter an RBS and a coding region but no...The promoter is either the Lac operon s pLacI promoter...cold shock protein Csp expression is actually induced by this. Jones and...which is known as the cold shock domain and is common to all cold shock...shock proteins suggests that they carry out a task which is key to cell... 2. Jiang Hou Inouye CspA the major cold shock protein of Escherichia coli is an RNA chaperone. J. Biol. Chem. 272 196 202 1997 ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_S05060","videoId":"BBa_S05060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3J - [ Intermediate ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K538000","videoId":"BBa_K538000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3K - [ Coding ] ['This BioBrick encodes the protein cochaperonin 10 which is part of the...This part is used in several cold resistance BioBricks or CryoBricks ...assembly of over 30 of E. coli s cellular proteins is required for... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K774001","videoId":"BBa_K774001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3L - [ Regulatory,promoter ] [' 1 PyeaR CArG nitric oxide nitrate nitrite sensing hybrid Mammalian Bacterial promoter...Bacterial promoter...further by ligating it to its mammalian counterpart CArG promoter sequence...NdeI were added between the 2 promoters. The genes were synthesised in two...of the PyeaR promoter so that it could be used in both mammalian and bacterial...systems. This is something that we thought was important as sensing nitric...carried out by ligating the promoters to fluorescent reporters and studying...transformation with the bacterial mammalian promoter as well as the...promoters on its growth over time. The promoters E.coli was transformed with...were PyeaR M B and B M. These promoters all react to nitrogenous species. By...comparison between all three of these promoters on the growth of E.coli . To...see if the presence of novel promoters caused any significant changes in...have been transformed will be referred to as the promoter with which they were...For this sample the sequencing data is exactly as predicted.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...gene promoters for radiogenetic cancer therapy. Gene therapy 9 20 ... promoter...']]"},{"machine":"BBa_K525998","videoId":"BBa_K525998","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3M - [ Regulatory,direction, forward, promoter, regulation, positive, rnap, bacteriophage, t7 ] ['Promoter T7 and RBS...T7 promoter and RBS. The T7 promoter does not work with the RNA polymerase...express BioBricks under the control of a T7 promoter E. coli carrying a T7...mutation in the sequence. A series of promoters with different expression...Summary We tried to improve this promoter sequence by adding a Lac operator... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']]"},{"machine":"BBa_K748002","videoId":"BBa_K748002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3N - [ Coding,cds, enzyme, cds, enzyme, lysis, chassis, prokaryote, ecoli ] ['Lysostaphin is a zinc metalloenzyme that has a specific lytic action against...band approximately 28 KDa is observed in samples and not observed in...These data is shown on Figure 4 thereby proving the functionality of the...TU Eindhoven 2018 functionally improved this part in multiple ways. Through...killer device is no longer necessary. Additionally this new construct...activity of the truncated lysostaphin against S. aureus is demonstrated... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K608002","videoId":"BBa_K608002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3O - [ Intermediate ] ['strong Promoter and strong RBS...You can insert your gene of interest behind this part. ...Slovenia HS team characterized this part in 2015....BdhB with His tag. To evaluate the activity of the promoter and RBS proteins...fraction mostly likely due to the strength of the promoter and RBS. The... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_S05048","videoId":"BBa_S05048","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 3P - [ Intermediate ] []]"},{"machine":"BBa_K331022","videoId":"BBa_K331022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4A - [ Composite ] ['This part has a oligo arginine sequence fused to the N terminus of an enhanced...']]"},{"machine":"BBa_K381001","videoId":"BBa_K381001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4B - [ Composite,Kit plates, immune_regulation, devices ] ['Nitrate and Nitrite sensitive promoter PyeaR with a GFP coding device and...PyeaR is normally repressed by NsrR a protein native to most E. coli cells....When Nitrate or Nitrite enter the cell it is converted to Nitric Oxide. This...HFLS H2Z hanzhou s experience with this part. In our experience with this...concentration of nitrite 40mM the promoter will be repressed unlike nitrite...in low concentration. Furthermore if nitrate 40mM is present along with...nitrite 40mM the promoter will be inhibited....iGEM 2010. It is a nitrate reporter PyeaR GFP composite. The team BCCS ...of Potassium Nitrate which is much more lower than all the teams before. The...to read but also more meaningful. The data is shown as below....PyeaR is repressed by NsrR protein under no nitrate or nitric oxide condition ...and is activated when nitrate or nitrite is existing....The promoter PyeaR is sensitive to nitrate and nitrite. When nitrate and...transcription of downstream genes. Then the promoter PyeaR will be activated....where there is no fertility which can save excess fertilizer. Given the...was fluctuated significantly. This instability is unfavorable for the...signal requires special equipment that is not readily available for farmers....for visual detection. On the one hand amilCP expression is less affected by...temperature and is a more stable reporter than GFP. On the other hand blue...the NO concentration is stable at about 5.5 M. Since our project also tested...promoter which is sensitive to NO. Native NsrRBS the native NsrR binding...regulation 2 . First a protein degradation tag AAV is added to the reporter... Fig. 3 . This hybrid regulation system is sufficient to reduce the sensor s...due to the time limitation the result is not shown here. 800px T NEU China...AAV degradation tag. Off state when there is no NO induction. On state when...there is NO induction....operon transcription by the nitrate responsive regulator NarL is independent...characterized this part by measuring its expression levels in E. coli DH10 ... 4. Resuspend bacteria pellet by adding 1 ml LB followed by vortexing. This is the 1 OD600 working stock...inducer concentration above 10 M saturated the expression from the promoter....characterizing the induction of PyeaR promoter in different concentrations....donor. From literature it is known that one molecule of SNP releases one...The bacterial promoter PyeaR is inducible depending on the concentration of NO...available in the media. It is induced best in the range of 10 5 M to 10 4 M....']]"},{"machine":"BBa_K331024","videoId":"BBa_K331024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4C - [ Composite ] ['This part has a oligo arginine sequence fused to the N terminus of an enhanced...']]"},{"machine":"BBa_K314103","videoId":"BBa_K314103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4D - [ Composite ] ['constructs were grow in DH5a constitutive promoters...inducible promoter...BL21 DE3 T7 promoter ...']]"},{"machine":"BBa_K558009","videoId":"BBa_K558009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4E - [ Coding,chassis, prokaryote, cyanobacterium, chassis, prokaryote, synechocystis, function, dna ] ['This is the coding sequence of thiamin monophosphate pyrophosphorylase ...']]"},{"machine":"BBa_K346000","videoId":"BBa_K346000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4F - [ Translational_Unit,chassis, bacteriophage, t3, function, regulation, transcriptional, rnap, bacteriophage, t3 ] ['The RNA polymerase of bacteriophage T3 is DNA directed RNA polymerase with...Furthermore promoters of the T7 and T3 RNAPs are also quite similar with...polymerase or T7 RNA polymerase can transcribe the heterologous promoter...efficiently 3 4 . Namely the T3 RNA polymerase is orthogonal to T7 RNA...polymerase which is an excellent alternative of T7 polymerase for complex...promoter based the data gained from T7 polymerase. ...a. The interaction between bacterial RNA polymerase and the promoter DNA....b. The interaction between T3 polymerase and the T3 promoter....2 . The 12 to 17 region of the promoter interacts with a beta loop of the T3...3 . The 5 to 12 region of the promoter interacts with the core specificity...a plasmid that has T7 promoter upstream of T3 polymerase. The left three...right is protein expression in whole cell cytosol or inclusive body. The...fourth column is the protein marker. The right three columns represent strains...that were induced by 10 3 M IPTG for 30 hours under 18 . Note that there is a... Figure 4 The strength of different T3 promoters under the same expression...promoter strength in accordance with the order from strong to weak. The Y...promoters can be divided into 3 subgroups weak medium and strong. You can...find more details about the promoter intensity characterization on the...Following is the key to the parts.igem number of each T3 promoter we...cause a significant basal level at T3 promoter. Therefore when T3 polymerase...biology Orthogonal to T7 polymerase T7 promoter pair family Phage and... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be... biology Orthogonal to T7 polymerase T7 promoter pair family Phage and...']]"},{"machine":"BBa_K575008","videoId":"BBa_K575008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4G - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0030 GFP...This part consists of the LasR PAI1 3 oxo C12 HSL inducible promoter RBS... Part B0030 and a GFP reporter. It is a characterized as a unit within part... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...n a LasR PAI1 Inducible Promoter RBS B0030 GFP...']]"},{"machine":"BBa_K395602","videoId":"BBa_K395602","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4H - [ Generator ] ['This work is done by Toshitaka Matsubara.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K575010","videoId":"BBa_K575010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4I - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0030 RFP...This part consists of the LasR PAI1 3 oxo C12 HSL inducible promoter RBS...Quorum sensing is a process of bacterial cell cell communication that uses...LasI that makes an AHL called oxoC12. LasR complexed with oxoC12 is able to...interact with LasR dependent promoters and activate transcription Rust 1996 ....ribosome binding site RBS driven by the lasB promoter which is a LasR ...dependent promoter. Upon activation of the LasR dependent promoter RFP will...be expressed and red fluorescence should be observed. RFP expression is thus...dependent on the presence of LasR and AHLs. Hereafter we refer to this part as...SdiA is unable to interact with the lasB promoter Lindsay 2005 . As a...this part in E. coli a source of LasR would have to be introduced and AHLs...This E. coli system is optimal for characterization because plasmids...encodes a LasR dependent promoter plasI fused to luxCDABE from Photorhabdus...the Biobrick plasmid containing the lasB promoter fused to RFP. Transformants...The scheme of the assay is summarized in Figure 1A. In wells A1 A6 200...nm B . Optimal excitation is 573 nm and emission is 607 nm....nm B . Optimal excitation is 573 nm and emission is 607 nm....biobrick plasmid previously listed as LasR dependent is NOT responding to...luxCDABE fusion is an internal control that demonstrates that pAL105 is indeed...providing LasR that is responding to AHLs. However the biobrick part encoding...the plasB rfp is failing to respond....Figure 2. LasR is specific to oxoC12 but the lasB promoter in Part Bba K575010...n a LasR PAI1 Inducible Promoter RBS B0030 RFP...']]"},{"machine":"BBa_K325218","videoId":"BBa_K325218","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4J - [ Generator,classic, generator, uncategorized ] ['This part should show similarity to...This part is based on part... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K575009","videoId":"BBa_K575009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4K - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0034 GFP...This part consists of the LasR PAI1 3 oxo C12 HSL inducible promoter RBS... Part B0034 and a GFP reporter. It is a characterized as a unit within part...n a LasR PAI1 Inducible Promoter RBS B0034 GFP... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be... n a LasR PAI1 Inducible Promoter RBS B0034 GFP...']]"},{"machine":"BBa_K325909","videoId":"BBa_K325909","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4L - [ Generator ] ['As of October 2010 we believe this is the first and only BioBrick to emit... Penn iGEM 2015 used this part to make the sender cells in light mediated...10 beta competent cells since it is a commonly used E. coli strain in iGEM ...arabinose induced promoter pBAD. ...The data is analyzed using the formula Average Luminescence 0Hrs...similar during the first four hours there is a significant increase in...strength in bacteria. The new part is ...Genetics 28 117 139. Following is a contribution to this part by the... Following is a contribution to this part by the NUS Singapore 2019 team. ...10 beta and this is likely due to a higher maximum growth in the former... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K575011","videoId":"BBa_K575011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4M - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0034 RFP...This part consists of the LasR PAI1 3 oxo C12 HSL inducible promoter with an...n a LasR PAI1 Inducible Promoter RBS B0034 RFP...']]"},{"machine":"BBa_K325100","videoId":"BBa_K325100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4N - [ Reporter ] ['This part is a translational unit for a mutant of the luciferase from the...regenerating enzyme LRE . It is under the control of an Arabinose induced...promoter pBAD . D Luciferin has to be added to obtain light output....EPIC stands for Enhanced Photon Initiating Complex . It is described in...The part is codon optimised for expression in E.coli ....']]"},{"machine":"BBa_K575012","videoId":"BBa_K575012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4O - [ Composite ] ['RhlR PAI2 Inducible Promoter RBS B0030 GFP...RhlR PAI2 inducible promoter with an RBS B0030 and a GFP reporter. It is a...n a RhlR PAI2 Inducible Promoter RBS B0030 GFP...']]"},{"machine":"BBa_K523001","videoId":"BBa_K523001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 4P - [ Translational_Unit ] ['The native ribosome binding site is present....N terminal is cleaved off before the protein reaches its mature form....Edinburgh 2011 carried out some experiments on this part under the control of...the lac promoter see details at part...']]"},{"machine":"BBa_K608003","videoId":"BBa_K608003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5A - [ Intermediate ] ['strong Promoter medium RBS...This part consists of a strong promoter combined with a medium RBS. ...You can insert your gene of interest behind this part. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_S05050","videoId":"BBa_S05050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5B - [ Intermediate ] []]"},{"machine":"BBa_K608004","videoId":"BBa_K608004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5C - [ Intermediate ] ['strong Promoter weak RBS...This part consists of a strong promoter combined with a weak RBS. You can...insert your gene of interest behind this part. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K819017","videoId":"BBa_K819017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5D - [ Regulatory,promoter, ribosome, prokaryote, ecoli ] ['Luminesensor repressible SulA408 promoter...SulA promoter in 408 form. ...SulA promoter belongs to the SOS regulon family. In E.coli it promotes the...promoter inhibiting the transcription of the genes downstream. ...SulA408 promoter will not be bound by LexA protein but is compatible to...orthogonal promoter is formed because the influence of endogenous LexA protein...SulA408 promoter and therefore inhibit the gene expression e.g....containing SulA408 promoter constructed by Peking 2012 iGEM team ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...family SOS box n a Luminesensor repressible SulA408 promoter...']]"},{"machine":"BBa_K608006","videoId":"BBa_K608006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5E - [ Intermediate ] ['medium Promoter medium RBS...This part consists of a medium promoter and a medium RBS....You can insert your gene of interest behind this part. ...If you want a functional protein you need a promoter and a ribosome binding... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K819010","videoId":"BBa_K819010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5F - [ Generator,chassis, prokaryote, ecoli, function, motility ] ['CheZ is a significant protein in E.coli chemotaxis pathway. CheZ can prevent...CheZ was placed under a weak promoter... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K608007","videoId":"BBa_K608007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5G - [ Intermediate ] ['medium Promoter weak RBS...This part consists of a medium promotor and a weak RBS....You can insert your gene of interest behind this part. ...If you want a functional protein you need a promoter and a ribosome binding... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K934012","videoId":"BBa_K934012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5H - [ Composite ] ['We constructed this part by combining...']]"},{"machine":"BBa_K608008","videoId":"BBa_K608008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5I - [ Regulatory ] ['constitutive strong promoter with medium RBS and GFP...Strong promoter from the constitutive promoter family combined with medium RBS...tagged to the promoter and RBS domain....which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...promoter and RBS activity is. With this reporter gene it was possible to...analyze the expression via plate reader. GFP is excited at a wavelength of...the exact wavelength. The more GFP in the sample the higher is the GFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....GFP fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ... PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ...PR4 medium Promoter J23110 strong RBS B0034 ...PR5 medium Promoter J23110 medium RBS B0032 ...PR6 medium Promoter J23110 weak RBS B0031 ...The results of this test show that PR2 is 7.9 times stronger than PR3 which...tested the promoter and RBS activity with RFP as a reporter and the results...The kanamycin resistant plasmid pET 28a is transformed into the TOP10...strain which is coated on the LB plate with kanamycin as a negative control....The strain is cultured overnight at 37 C. ...containing 5 ml LB which is called 0h. We culture bacterial cells at 37 C ...microplate reader. Total fluorescence is divided by OD600 to obtain...24h is 2.725 which is slightly lower than the OD600 3.04 at 30h....RFU OD600 at 24h is 501.76 which is significantly higher than the RFU OD600...The cell death rate is close to or even higher than the cell division rate ...We compared the fluorescence intensity of this part in overnight cultures of...strong promoter and a weak ribosome binding site controlling the expression of...GFP. We compared it to other parts with GFP under a medium promoter with a...supports the claim that GFP is produced regardless of arabinose concentration ...supporting the status of the constitutive promoter....']]"},{"machine":"BBa_K934022","videoId":"BBa_K934022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5J - [ Composite ] ['We constructed this part by combining...']]"},{"machine":"BBa_K608010","videoId":"BBa_K608010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5K - [ Regulatory ] ['Medium promoter with strong RBS and GFP...Medium promoter from the constitutive promoter family combined with a strong...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...promoter and RBS activity is. With this reporter gene it was possible to...analyze the expression via plate reader. GFP is excited at a wavelength of...the exact wavelength. The more GFP in the sample the higher is the GFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube.... Figure 2 GFP fluorescence intensity dependent on the strenght of promoter... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ...PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ... PR4 medium Promoter J23110 strong RBS B0034 ...PR5 medium Promoter J23110 medium RBS B0032 ...PR6 medium Promoter J23110 weak RBS B0031 ...experiment. We have also tested the promoter and RBS activity with RFP as a...and PR4 Green . The T7 promoter lead to about 2.6 as much protein being...promoter medium promoter strong RBS to T7 expression. Some proteins fold...better under constitutive promoters however nobody had yet directly compared...We found that the T7 promoter produced about 2.6 times as much fluorescent...signal as the constitutive PR4 promoter indicating that T7 is much more...however after the initial expression the promoter seems to be shut off.... Promoter and RBS ...PR4 medium Promoter J23110 strong RBS B0034 ...in expression over time for the PR4 constitutive promoter. Additionally other...constitutive promoters should be directly compared to T7 promoter expression....well this is the control . Repeat step 11 two more times add the 200 L to...seen in Graph 1. This same pattern is seen in Graph 2 for the average...constitutive promoter with strong medium and weak RBS GFP PR4 GFP PR5 GFP ...TOP10 is the only cell line showing consistency in the hierarchy of the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K934026","videoId":"BBa_K934026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5L - [ Composite ] ['LacI generator which is activated by LuxR 3OC6HSL complex...']]"},{"machine":"BBa_K608011","videoId":"BBa_K608011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5M - [ Regulatory ] ['Medium promoter with medium RBS and GFP...Medium promoter from the constitutive promoter family combined with medium RBS... PR5 and GFP. To quantify the gene expression GFP was tagged to the promoter...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...promoter and RBS activity is. With this reporter gene it was possible to...analyze the expression via plate reader. GFP is excited at a wavelength of...the exact wavelength. The more GFP in the sample the higher is the GFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....GFP fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ...PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ...PR4 medium Promoter J23110 strong RBS B0034 ... PR5 medium Promoter J23110 medium RBS B0032 ...PR6 medium Promoter J23110 weak RBS B0031 ... SASTRA Thanjavur 2019 Characterization Effect of pH on promoter...the optimal one thus producing a bell shaped curve when the pH is plotted...This biobrick is present in plasmid pSB1C3 which harbours a chloramphenicol...The kanamycin resistant plasmid pET 28a is transformed into the TOP10...strain which is coated on the LB plate with kanamycin as a negative control....The strain is cultured overnight at 37 C. ...constitutive promoter with strong medium and weak RBS GFP PR4 GFP PR5 GFP ...TOP10 is the only cell line showing consistency in the hierarchy of the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K733001","videoId":"BBa_K733001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5N - [ Regulatory,promoter ] [' Ptms a constitutive promoter in E. coli and B. subtilis .... Ptms is a constitutive promoter that can be recognized by SigA factor in...transcription and translation signals Ptms is also functional in E. coli .... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter...']]"},{"machine":"BBa_K608012","videoId":"BBa_K608012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5O - [ Regulatory ] ['Medium promoter with weak RBS and GFP...Medium promoter from the constitutive promoter family combined with a weak RBS...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...promoter and RBS activity is. With this reporter gene it was possible to...analyze the expression via plate reader. GFP is excited at a wavelength of...the exact wavelength. The more GFP in the sample the higher is the GFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....GFP fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ...PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ...PR4 medium Promoter J23110 strong RBS B0034 ...PR5 medium Promoter J23110 medium RBS B0032 ... PR6 medium Promoter J23110 weak RBS B0031 ...The kanamycin resistant plasmid pET 28a is transformed into the TOP10...strain which is coated on the LB plate with kanamycin as a negative control....The strain is cultured overnight at 37 C. ...constitutive promoter with strong medium and weak RBS GFP PR4 GFP PR5 GFP ...TOP10 is the only cell line showing consistency in the hierarchy of the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K733006","videoId":"BBa_K733006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 5P - [ Coding ] ['This is mature Bone Morphogenetic Protein 2 BMP2 with a singal peptide YdjM....']]"},{"machine":"BBa_K575014","videoId":"BBa_K575014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6A - [ Composite ] ['RhlR PAI2 Inducible Promoter RBS B0030 RFP...RhlR PAI2 inducible promoter with RBS B0030 and RFP.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...n a RhlR PAI2 Inducible Promoter RBS B0030 RFP...']]"},{"machine":"BBa_K523002","videoId":"BBa_K523002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6B - [ Translational_Unit ] ['This is the E. coli glucosidase gene bglX . The part contains the native...The product protein is believed to be periplasmic. glucosidase cleaves...N terminal is cleaved off before the protein reaches its mature form....Edinburgh 2011 carried out some experiments on this part under the control of...the lac promoter see details at part... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K575013","videoId":"BBa_K575013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6C - [ Composite ] ['RhlR PAI2 Inducible Promoter RBS B0034 GFP...RhlR PAI2 inducible promoter with an RBS B0034 and a GFP reporter. It is a...n a RhlR PAI2 Inducible Promoter RBS B0034 GFP...']]"},{"machine":"BBa_K523003","videoId":"BBa_K523003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6D - [ Coding ] ['This is a version of...glycine. The effect of both of these features is to provide an in frame BglII... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K575015","videoId":"BBa_K575015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6E - [ Composite ] ['RhlR PAI2 Inducible Promoter RBS B0034 RFP...RhlR PAI2 inducible promoter with RBS B0034 and RFP.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...n a RhlR PAI2 Inducible Promoter RBS B0034 RFP...']]"},{"machine":"BBa_K523004","videoId":"BBa_K523004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6F - [ Coding ] ['This is a version of...glycine. The effect of both of these features is to provide an in frame BglII... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K575020","videoId":"BBa_K575020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6G - [ Regulatory ] ['Genomic LasR PAI1 Inducible Promoter Long ...This is a promoter region extracted from the Pseudomonas Aeruginosa genome. It...hierarchy. It is used in part... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K523006","videoId":"BBa_K523006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6H - [ Composite ] ['under control of lac promoter. LacZ is also present....N terminal is cleaved off before the protein reaches its mature form....control of the lac promoter creating...part is a good control since it has both Plac LacZ like this part and a...periplasmic protein like this part and is known to actually work....We Edinburgh 2011 made cell extracts using this part and compared them to a...If the cell extract is capable of starch degradation this will cause the...Streaks of E. coli with this part and grown on starch agar eventually show...hardened microbiologist. This phenotype is only visible after several days ...this part doesn t display a mucoid phenotype on starch agar and so E. coli ...A control ought to be run testing whether this part displays the mucoid...phenotype on normal agar. On the assumption that this phenotype is related to...shown by E.coli is in fact related to the ability of this part to degrade...There is clear evidence that malS when expressed from a high copy number...plasmid is capable of at least mild starch degradation....The mucoid phenotype was unexpected. It is possible that starch degradation...We replaced Plac LacZ with T7 promoter...of expression levels in bacteria for the chosen enzyme. This is because a high...As expected 7 is the optimum pH for amylase production....As we can clearly see beef extract is the most optimum nitrogen source for...We can thus conclude that Sucrose is the optimum carbon source for amylase... p It is clearly evident pH 7 is the ideal condition for the enzyme to...The maximum activity is found to be at 24 C and we notice a sharp decline in... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K575021","videoId":"BBa_K575021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6I - [ Regulatory ] ['Genomic LasR PAI1 Inducible Promoter Short ...This is a promoter region extracted from the Pseudomonas Aeruginosa genome. It... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K538101","videoId":"BBa_K538101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6J - [ Translational_Unit,classic, generator, rc ] ['This part was submitted by team Amsterdam...As this part had already been submitted by the 2011 Amsterdam team we decided...protein is 56 872 Da . The gel image is as seen below ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K590028","videoId":"BBa_K590028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6K - [ Composite ] ['This part consists of Aldehyde Decarbonylase...Washington iGEM Team has used this part to see if it can be used together with...']]"},{"machine":"BBa_K525710","videoId":"BBa_K525710","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6L - [ Coding,cds, enzyme, ligase, chassis, prokaryote, ecoli, proteindomain, affinity, proteindomain, tail, rnap, bacteriophage, t7 ] ['under release of NMN. AMP is used to catalyse the formation of a...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...that the biobrick part is not of potential allergen status. In 80 amino acid...this biobrick. This also means that there is not of potential allergen status....Promoter PT7 ...Expression of LigA in E. coli is an easy approach to produce the recombinant...The expected molecular weight is about 75 kDa. M prestained protein...of the Mascot Score for MS is 63 and the one for MS MS is 26. The MS Coverage...As it is reported in literature the majority of LigA usually occurs in its...adenylated form after extraction from E. coli . An indication for this is the...identified as LigA from E. coli suggesting that gel band 3 is the adenylated...form and gel band 4 is the deadenylated form. Depending on whether the protein...an excess of nicotinamide mononucleotide NMN for deadenylation is possible....characterization of LigA is shown in figures 3 and 4. The molecular beacon...Thus this approach is useful to measure LigA activity and therefore detect...the employed NAD concentration. This phenomenon is illustrated in figure 6... Figure 6 The initial fluorescence enhancement rate is dependent on the NAD... concentration. For illustration the fluorescence intensity is normalized...factor for the enzymatic reaction but not the NAD which is supposed to be...concentrations below the molecular beacon concentration. This is shown in...figure 7 in which the linear dependence is indicated by linear regression of...after NAD addition as shown in figure 5 is plotted versus the employed NAD ...concentration. Data is fitted with linear regression for NAD concentrations...The fluorescence intensity enhancement is supposed to be caused by LigA...The specifity of LigA for its substrate NAD is important in order to couple...reactions. The verification of the selectivity is an important matter to...plotted versus the employed pyruvate concentration. Data is fitted with linear...scale is firstly caused by 100 fold dilution of the LDH reaction mix after...Because DNA ligase from E. coli is commercially aquirable for cloning...tested whether it is also suitable for molecular cloning procedures. Hence ...There is a linear dependence for both parameters while the NAD concentration...By meeting this requirements the NAD bioassay is suitable for investigations...of the signal to background ratio S B is as follows ...The majority of purified DNA ligase from E. coli KRX is usually in the...adenylated form. But only the apoenzyme is really useful for the NAD bioassay... It is a similar procedure to the one mentioned above except that you prepare 500 nM molecular beacon and 600 nM target or split target dissolved in bioassay buffer in a PCR tube. ... To check whether the NAD bioassay is suitable for the analysis of NADH dependent enzymatic reactions it was coupled with the NADH dependent conversion of pyruvate to L lactic acid by lactic acid dehydrogenase LDH http www.sigmaaldrich.com catalog ProductDetail.do lang de N4 59747 7CSIGMA N5 SEARCH CONCAT PNO 7CBRAND KEY F SPEC from E. coli .... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K590034","videoId":"BBa_K590034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6M - [ Coding ] ['This part encodes FabH2. The 2011 University of Washington iGEM...alkanes using this part and the...addition expression of this part and the...FabH2 is a FabH homolog from Bacillus subtilis . The FabH family of proteins...with is extended by 2 carbon units to form longer chain length fatty acids....from C13 to C17. This is the first time that even chain length alkanes have...alkane spectrum from C13 to C17. This is the first time that even chain length...alkanes have been recombinately produced. This part requires further...and to increase the amount of C14 C16 alkane yield as current yield is only...In E. coli the eFabH enzyme active site has a catalytic triad which is an...specificity for acetyl CoA and is unable to use branched chain substrates ...acids eFabH like eFabH is. eFabH is incapable of using branched chain...substrates as an initial substrate and is highly specific towards the simple...Therefore it is thought that the composition of fatty acids produced by...broadly specific enzymes like bFabH2 is determined largely by the initial...initial substrate is branched then a high amount of branched fatty acids will...gene of E. coli is unable to use and produce branched chain fatty acids ... FabH is a determining factor in branched chain fatty acid biosynthesis. J... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...1.Beta ketoacyl acyl carrier protein synthase III FabH is a determining...']]"},{"machine":"BBa_K608351","videoId":"BBa_K608351","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6N - [ Composite,cds, transcriptionalregulator, cds, transcriptionalregulator, repressor, function, regulation, transcriptional, promoter, regulation, constitutive, regulation, multiple ] [' correct temperature sensitive promoter... Why did we make this part Because sequencing of...This composite promoter consists of a constitutive promoter...raised to 42 C and a cI regulated promoter based on the pR promoter...The temperature sensitive promoter functioning at 28 30 C...temperature sensitive promoter functioning at 42 C ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']]"},{"machine":"BBa_K576003","videoId":"BBa_K576003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6O - [ RNA ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K564012","videoId":"BBa_K564012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 6P - [ Measurement ] ['promoter and RBS of E. coli chitoporin translationally fused with lacZ....oligosaccharides. This outer membrane porin is required for Salmonella and...nitrogen. It is only synthesized in the presence of these substrates. In...nature it is regulated by sRNAs.The 5 untranslated region and promoter of...this gene is fused with reporter gene lacZ and is donwlregulated by sRNA chiX...']]"},{"machine":"BBa_K607035","videoId":"BBa_K607035","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7A - [ DNA ] [' Note This part did not have a reference sequence. A reference sequence... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K733008","videoId":"BBa_K733008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7B - [ Coding ] ['and protein electrophoresis protein detection size studies . FLAG is a... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K607038","videoId":"BBa_K607038","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7C - [ Generator ] ['Prm modified promoter generating GFP...Modified lamdba Prm promoter repressed by 434 cI generating GFP. Part used...For more information about the modified lambda Prm promoter see ...n a Prm modified promoter generating GFP...']]"},{"machine":"BBa_K733009","videoId":"BBa_K733009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7D - [ Composite ] [' Ptms is a promoter which proves to be functional in both E. coli and B....subtilis . R.P.U standard is advocated by part registry to represent the...efficiency of a constitutive promoter. Kelly et al. 2009 We intend to...characterize promoter Ptms in E. coli . Using E. coli as our initial...participants because E. coli is frequently used by iGEM participants....Link to our Ptms promoter ... Promoter characterization...1.JPG wiki images c c3 Promoter characterization 1.JPG File Promoter characterization 1.JPG ...The key reason for using this low efficiency constitutive promoter in our...construct is to enable our bacteria to express a low level of antitoxin so...expression of BMP2 is tightly linked to the toxin its expression can be...Our objective in characterizing this promoter is to test whether Ptms works in... E. coli DH10B strain and determine its relative promoter unit RPU compared...to the standard constitutive promoter a promoter whose activity is...1 . Ptms should work in E. coli . This is supported by previous research...Instead of using the absolute promoter activity as the final result our...constitutive promoter. By adopting this method we are able to eliminate...measured to obtain the Relative Promoter Units RPU ...5 . Calculating the Relative Promoter Units RPU using the obtained data ...4 . Absolute promoter activity of Ptms and I20260 were calculated by...5 . Averaged absolute promoter activity was then obtained by averaging the...respective sets of absolute promoter activity values ...promoter activity over the averaged I20260 absolute promoter activity....low promoter efficiency in E.coli DH10B strain....Promoter.jpg wiki images a ae PTms Promoter.jpg File PTms Promoter.jpg ...promoter in B. subtilis and we still hope that we can address this in the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...Glieberman A Monie D Endy D Measuring the activity of BioBrick promoters...']]"},{"machine":"BBa_K515007","videoId":"BBa_K515007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7E - [ Coding,cds ] ['This part consists of the Dendra2 coding sequence codon optimised for... Escherichia coli . It is part of the composite BioBrick... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K733010","videoId":"BBa_K733010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7F - [ Composite ] ['This construct contains a low efficient constitutive promoter Ptms with an... ydcE ndoA . Pellegrini et al. 2005 Besides the low efficiency promoter... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K584000","videoId":"BBa_K584000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7G - [ Composite ] ['inducible promoter pBAD . Since the construct that we cloned contained an...medium strength promoter at OD600 0.5. ...transcription activity of pBad promoter by measuring the fluorescence per...0.1 in order to find the concentration at which pBad promoter is most...promoter was maximally induced. We additionally created a fold activation and...promoter was strongly induced as the arabinose concentration was increased.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K733013","videoId":"BBa_K733013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7H - [ Regulatory ] ['Construct of a constitutive promoter Pveg and a strong R.B.S. for Bacillus...subtilis . It is ready to drive any transcription of gene in Bacillus... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K523008","videoId":"BBa_K523008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7I - [ Coding ] ['This is a modified version of...RFC10 suffix . Because the SpeI site is out of frame two extra G bases have...Incidentally although this part has been made in RFC10 format the two extra...The DNA is a codon optimised version of the N and C terminal domains of...INPNC is fused to another protein the passenger it causes the passenger...']]"},{"machine":"BBa_K733014","videoId":"BBa_K733014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7J - [ Composite ] ['function of this biobrick is to allow the bacteria to produce Bone...']]"},{"machine":"BBa_K660610","videoId":"BBa_K660610","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7K - [ Composite ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K733016","videoId":"BBa_K733016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7L - [ Composite ] ['This is the composite part of...is added the translation at the downstream of Pveg promoter will be...']]"},{"machine":"BBa_K660004","videoId":"BBa_K660004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7M - [ Reporter ] ['ideal reporter for characterisation of new promoters. The page for this...infections it has outperformed GFP. It is much smaller than GFP at around 300...bleaching reversibility is due to the changing state between the fluorescent...Another advantage of LOV in comparison to other fluorescent proteins is it s...']]"},{"machine":"BBa_K733017","videoId":"BBa_K733017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7N - [ Composite ] ['This is the composite part of...is added the translation at the downstream of Pveg promoter will be...']]"},{"machine":"BBa_K545666","videoId":"BBa_K545666","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7O - [ RBS ] []]"},{"machine":"BBa_K817002","videoId":"BBa_K817002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 7P - [ Regulatory ] ['It s a fatty acyl CoA responsive promoter which will express the downstream...To evaluate the PfadBA promoter function we design a PfadBA mRFP reporter...control group which is the same colony and identical amount of bacteria but...fluorescence intensity to get the expression level of PfadBA promoter in...PfadBA is so high that we cannot see significant signal rise after induction...repressive function is antagonized by fatty acyl CoA. 3 By co transforming...constructs with PfadBA and FadR into the bacterial platform it is made...Our PfadBA promoter can work in response to environmental fatty acid change ...when host is fed with fatty diet....Fluorescence to Anderson Promoter. ...acid to E.coli and Relative Fluorescence to Anderson Promoter...acid. We d like to understand more about this promoter by answering the... How strong is the promoter pFadBA ...than control. However when the concentration is 25mM it inhibits growth of...E. coli. We can notice that low concentration of fatty acid is somehow benefit...highest concentration to induce the promoter in the following experiments. ...level the fluorescence level will rise. The fold change is almost 2.5 times...in 0.625 mM LB but is only 1.7 times in 0.156 mM LB. This data shows that...fatty acid actually induce the promoter and higher concentration induces more... Relative Fluorescence to Anderson Promoter...between pFadBA and Anderson promoter. By comparing pFadBA with Anderson...promoter it demonstrates that the fluorescence level of pFadBA is much lower...Figure 4. Comparison of pFadBA with the Anderson promoter ...']]"},{"machine":"BBa_K588001","videoId":"BBa_K588001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8A - [ Regulatory ] ['Tryptophan promoter and operator...ptrp is a promoter with the trp operator. It will be repressed by trpR...This part is a clone of K360023... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K564013","videoId":"BBa_K564013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8B - [ Measurement ] ['oligosaccharides. This outer membrane porin is required for Salmonella and...nitrogen. It is only synthesized in the presence of these substrates. In...nature it is regulated by sRNAs. In this biobrick we altered the ribosome...between ChiP and its regulator. The promoter and reporter have not been...']]"},{"machine":"BBa_K611010","videoId":"BBa_K611010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8C - [ Composite ] ['different arabinose concentrations as long as AraC is present....']]"},{"machine":"BBa_K515100","videoId":"BBa_K515100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8D - [ Composite,function, biosynthesis ] ['IAA biosynthetic genes under control of the Pveg2 promoter...The IAM pathway is a two step pathway which generates indole 3 acetic acid...which is hydrolyzed to indole 3 acetic acid and ammonia by indoleacetamide...The Salkowski assay is a colourimetric assay that detects IAA with high...assay is the simplest way to determine whether there is IAA present in...is uncharacterised which is why all of our controls showed moderate levels of...IAA is known to degrade quite rapidly so we tested the effect of light...producing pathway endogenous to E. coli is much more complicated than...anticipated. We may postulate that IAA is not produced when growth conditions...are very favourable and cell density is high.... Figure 8 HPLC peak corresponding to IAA. Positive control is 50 M IAA in...acetonitrile. Auxin Xpress is filtered supernatant of E. coli BL21...transformed with the Auxin Xpress construct. Negative control is filtered...promoter and antibiotic resistance. ...The characteristic IAA peak detected by LCMS confirms that IAA is being...Summary We built two new parts based on this part to extend its function....This part is the only one available with IAAM and IAAH but unfortunately we... Two new bio bricks were designed based on this part using the primers...Summary We upgraded this part by adding MS2 and PP7 RNA binding proteins....We modified this part so that it is possible to synthesize the IAA enzymes... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K611018","videoId":"BBa_K611018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8E - [ Composite ] ['Mutant Regulatory protein promoter characterization plasmid...This part can be used to characterize promoter repressor and...promoter activator pairs by swapping in the desired parts on either end....To characterize promoter mutants ligate the corresponding wild type repressor...mutant promoter to the 5 end cut the construct at EcoRI and XbaI and the...promoter at EcoRI and SpeI....wildtype promoter on the 5 end and adding the mutant repressor or activator...Expression is reported via GFP fluorescence. The amount of repressor activator...can be controlled using the arabinose inducible pBAD promoter with increased...concentration and a corresponding change in promoter activity level....it is not necessary to add a terminator once the wild type and mutant...This part was used to build parts like...allowed the characterization of the LacI promoter...']]"},{"machine":"BBa_K515102","videoId":"BBa_K515102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8F - [ Composite,cds, receptor ] ['J23100 promoter PA2652...PA2652 is a malate responsive chemoreceptor originally found in Pseudomonas...expression is under the control of the constitutive promoter...expression through easy switching of promoters. In addition it allows the...promoter is replaced....This device is compatible with motile strains of E. coli . It has been...towards malate of the E. coli with PA2652 is 1 mM. The sharp decrease in...number of cells after 1 mM concentration is caused by malate saturation of the...funcionality of this device. This analysis is based on the uniformity of the...velocity is dictated by smooth swimming or random tumbling becomes uniform as...the attractant is sensed....therefore recognising the attractant. This is also confirmed by positive...control cells exposed to 10 mM serine where the response of cells is also...']]"},{"machine":"BBa_K611025","videoId":"BBa_K611025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8G - [ Regulatory ] ['LacI Promoter Variant 5...derepressed allowing for transcription of the Lac repressor. This is seen as a...promoter to transcribe.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K523013","videoId":"BBa_K523013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8H - [ Coding ] [' EYFP under the control of the Lac promoter....the outer membrane this region is the main source of fluorescence in the INP ...Our project used surface display system and we choose this part to construct...testing the surface display efficiency of this part we found that the...that the ratio of guanine and cytosine is about 55 .Because if the GC ratio of...genes is between 45 and 55 the genes is suitable for PCR amplification so...this part can be amplified well.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K611026","videoId":"BBa_K611026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8I - [ Regulatory ] ['LacI Promoter Variant 6...derepressed allowing for transcription of the Lac repressor. This is seen as a...promoter to transcribe.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K523014","videoId":"BBa_K523014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8J - [ Composite ] ['lac promoter. The native ribosome binding site is present....The BglX glucosidase is expected to be localised to the periplasm. It ought...We Edinburgh 2011 conducted two assays comparing the activity of this part...promoter... 4 methylumbelliferyl D glucuronide MUG left photo . This substrate is a cellobiose analog.... 4 methylumbelliferyl D cellobioside MUC right photo . This substrate is larger and is more like a cellulose analog.... Left side of plate lysate debris from JM109 expressing this part K523014...As can be seen bglX is capable of degrading MUG the cellobiose analog ...We tested the ability of E. coli with this part to grow on minimal media...grow if glucose was the carbon source showing that it is fundamentally...on cellobiose in fluid media. On the figure below it is shown that this...The bglX is compared to another biobrick which have the ability to degrade... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K569017","videoId":"BBa_K569017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8K - [ Coding,chassis, prokaryote, ecoli, Kit plates, probiotics, production ] ['CheY is a chemotaxis protein that is activated by the protein CheA. This...activation is done by phosphorylation. After CheY is activated it then acts...This motion is known as tumbling and causes randomly oriented movement. CheY... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K523015","videoId":"BBa_K523015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8L - [ Composite ] ['This is C. fimi endoglucanase under the control of the Lac promoter. This...of Lac promoter RBS and endoglucanase from C. Fimi. We characterized the...activity of pH6 is relatively higher than that of pH7 and higher temperature...seems to have positive influence on enzyme activity is 30 C and 37 C can be...activity of pH6 is relatively lower than that of pH7 and higher temperature...process due to it is also a relatively growth fitness temperature for E.coli.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K617003","videoId":"BBa_K617003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8M - [ DNA ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K523020","videoId":"BBa_K523020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8N - [ Composite ] ['This is a fusion of Ice Nucleation Protein and the E. coli cryptic... glucosidase bglX under the control of the lac promoter. If it works... Warning Part submitted to Registry is believed to contain major errors....This notice will be removed if when the situation is improved.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K617004","videoId":"BBa_K617004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8O - [ DNA ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K523022","videoId":"BBa_K523022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 8P - [ Composite ] ['Lac promoter driving expression of crtE crtI and crtB carotenoid synthesis... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_S04602","videoId":"BBa_S04602","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9A - [ Translational_Unit ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K817016","videoId":"BBa_K817016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9B - [ DNA ] ['It is the centromere site that can be recognized by parB of pseudomonas putida...KT2440 when providing this part in cis on an low copy plasmid and providing...']]"},{"machine":"BBa_S04607","videoId":"BBa_S04607","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9C - [ Intermediate ] []]"},{"machine":"BBa_K817021","videoId":"BBa_K817021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9D - [ Intermediate ] ['The intermediate part is our basic part K817027 with RBS B0030 in the front....This is the method we used to test our secretion system mainly on the three...0.6 implying the bacterial growth is at its log phase or 1.0 implying the...concentrating the extracellular fluid sample is due to the minimal limit this... The result on the left side is the two SP1 and SP2 peptides. This figure...secretion test. The left figure is the negative control we applied on that...secretion efficiency by the Image J software. The result is as follow ...']]"},{"machine":"BBa_K568006","videoId":"BBa_K568006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9E - [ Intermediate ] ['This is a small synthesized part of the optogenetical AND Gate...']]"},{"machine":"BBa_K817022","videoId":"BBa_K817022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9F - [ Intermediate ] ['The intermediate part is our basic part K817028 with RBS B0030 in the front....This is the method we used to test our secretion system mainly on the three...0.6 implying the bacterial growth is at its log phase or 1.0 implying the...concentrating the extracellular fluid sample is due to the minimal limit this... The result on the left side is the two SP1 and SP2 peptides. This figure...secretion test. The left figure is the negative control we applied on that...secretion efficiency by the Image J software. The result is as follow ...']]"},{"machine":"BBa_K516011","videoId":"BBa_K516011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9G - [ Translational_Unit ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K817023","videoId":"BBa_K817023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9H - [ Intermediate ] ['The intermediate part is our basic part K817029 with RBS B0030 in the front....This is the method we used to test our secretion system mainly on the three...0.6 implying the bacterial growth is at its log phase or 1.0 implying the...concentrating the extracellular fluid sample is due to the minimal limit this... The result on the left side is the two SP1 and SP2 peptides. This figure...secretion test. The left figure is the negative control we applied on that...secretion efficiency by the Image J software. The result is as follow ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K516030","videoId":"BBa_K516030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9I - [ Reporter ] ['This construct is useful to measure the relative strength of promoters or the...RBS efficiency in relationship with a promoter of interest. ...To build a measurement device is only necessary assemble a standard biobrick...promoter with this device or another one of the Kit plate ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K817024","videoId":"BBa_K817024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9J - [ Intermediate ] ['The intermediate part is our intermediate part K817021 with double terminator...This is the method we used to test our secretion system mainly on the three...0.6 implying the bacterial growth is at its log phase or 1.0 implying the...concentrating the extracellular fluid sample is due to the minimal limit this... The result on the left side is the two SP1 and SP2 peptides. This figure...secretion test. The left figure is the negative control we applied on that...secretion efficiency by the Image J software. The result is as follow ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K516031","videoId":"BBa_K516031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9K - [ Reporter ] ['This construct is useful to measure the relative strength of promoters or the...RBS efficiency in relationship with a promoter of interest. ...To build a measurement device is only necessary assemble a standard biobrick...promoter with this device or another one of the Kit plate ...expression of RFP may be induced using a stronger promoter. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K763001","videoId":"BBa_K763001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9L - [ Reporter ] ['This construction is made up of two elements ...1 . The transcription factor binding site inside the promoter...bacterium is suffering from heat shock 1 . We have taken the promoter...When is the protein synthesized In order to obtain the red fluorescent...The molecular mechanism underlying this phenomenon is as follows high...the RNA polymerase to bind to some consensus promoter sequence. groE has this...sequence in its promoter 4 . That is because this gene encodes a chaperon...cells many of them are heat shock proteins whose function is to assist the...consisting of three steps. First the polypeptide substrate is captured by...GroEL. Upon binding of the co chaperone GroES and ATP the substrate is then...promotes proper folding. After hydrolysis of ATP the polypeptide is released...How did we deal with this construction We were able to activate the promoter...strain carrying the AsRed2 gene under the control of groE promoter was set up...INDUCED PROMOTER . According to our results it seems that protein expression... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K516032","videoId":"BBa_K516032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9M - [ Reporter ] ['This construct is useful to measure the relative strength of promoters or the...RBS efficiency in relationship with a promoter of interest. ...To build a measurement device it is only necessary assemble a standard...biobrick promoter with this device or another one of the Kit plate ...']]"},{"machine":"BBa_K763002","videoId":"BBa_K763002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9N - [ Reporter ] ['1 . The transcription factor binding site inside the promoter and ...protein. We chose as the promoter sequence the one of the nirB gene because...it is 100 dependent on FNR 1 2 which is the transcription factor activated...when there is no oxygen in the environment. It is involved mainly in cellular...When is the protein synthesized In order to obtain this green fluorescent...protein one condition is required anaerobic conditions should be met. We grew...The molecular mechanism underlying this phenomenon is as follows the promoter...is activated when there is a lack of O2 in the environment thanks to a family...transcription of target promoters. Under aerobic conditions i.e. when oxygen...the control of the nirB promoter was grown on LBA under two different...REGULATED PROMOTER ....']]"},{"machine":"BBa_K516022","videoId":"BBa_K516022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9O - [ Device ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K769001","videoId":"BBa_K769001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 9P - [ Device ] ['When OmpC promotor is activated by phosphorylated OmpR GFP is expressed....promoter regulation ...this study we will be using E. coli strains TOP10 which is a high efficiency...DH5a which maximizes transformation efficiency too and BL21 which is an...ideal strain for expression vectors. The presence of ompC promoter in the...This part contains the OmpC promoter a promoter regulated by OmpR and...contains Green Fluorescent Protein at its downstream. OmpC is the outer...membrane porin that is only expressed when the environment osmolarity is high....Therefore when the environment is in high osmolarity ompC promoter will be...measurement kit is in MEFL E.coli particles. Emission of GFP were read at...BL21 because BL21 is a protein expressing bacteria while TOP10 is bacteria...for this phenomenon is that there are differences in ompC promoter regulation...in different bacterial strains. OmpR regulated promoter mediated gene...regulated promoter showed a high leaky expression in high copy vectors e.g....expression with the ompC promoter....part will consider which bacteria that is most appropriate for their research....']]"},{"machine":"BBa_K576005","videoId":"BBa_K576005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10A - [ Reporter ] ['The RFC53 HeadPart with promoter and RBS attached....']]"},{"machine":"BBa_K523023","videoId":"BBa_K523023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10B - [ Composite ] ['This is the lac promoter driving Enhanced Yellow Fluorescent Protein. It was... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K652004","videoId":"BBa_K652004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10C - [ Generator ] ['This part contains an RBS the type III Zoarces elongatus antifreeze protein...Note Becuase this protein is so small 7kDa expression may be difficult to...are easier to see not so diffuse is advisable....This is a graph of the biofilm production with and without the expression of...']]"},{"machine":"BBa_K568004","videoId":"BBa_K568004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10D - [ Composite ] ['Optogenetical AND Gate blue light without first promoter choose your first...This is part of an AND gate where one can choose the first promoter which...controls the supDtRNA. The logical gate is based on amber stop codon...translated by ribosomes if the correct supD tRNA is present....This part can be used when one wants an AND gate where the T7ptag T7...polymerase with amber stop codon mutation is under the control of a bluelight...complex leads to the unbinding of YcgE from the YcgZ promoter which activates...if enough supD tRNA is available. SupDtRNA is only produced once a chosen...promoter is cloned at the 5 site of the part....The so constructed AND gate should ensure that expression of T7ptag is only...n a Optogenetical AND Gate blue light without first promoter choose your... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... n a Optogenetical AND Gate blue light without first promoter choose...']]"},{"machine":"BBa_K654058","videoId":"BBa_K654058","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10E - [ Coding ] ['Thioesterase is used in conjunction with Fatty Acyl CoA Synthetase to greatly...the amount of bioproducts produced. It is used to produce Fatty Alcohols and...our pBAD promoter is inducible by arabinose induced and non induced samples....volts for 30 minutes in TAE 1X. The marker used during the migration is the...After transformation minipreparation is realized and enzymatic digestion is...performed. The ligation between TesA pBAD and pSB1A3 is then realized....used during the migration is the NEB 1 kb Plus Ladder. ...construction was then induced and an acidic value is performed. ...Transformed bacteria with TesA gene and pBAD promoter were cultured until... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K639003","videoId":"BBa_K639003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10F - [ Composite ] ['The stringent response in bacteria is caused by amino acid starvation fatty...Our system will be based on a promoter that is important for regulating growth...and proliferation. At the moment we are trying to use the rrnB p1 promoter ...molecule. Hopefully the promoter will be down regulated enough by increased...lacI represses a second promoter pLac that induces the production of red...An overview of the construct is seen in the picture below....Plasmid map of the complete construct. Promoters are shown in blue and genes...The stress sensor is made from these biobricks....cultures of the construct with and without the rrnB P1 promoter were grown...inhibition. M9 is a minimal medium lacking amino acids. M9 was used because...ppGpp is mainly produced in the stringent response during amino acid...from the experiment is shown in figures below as fluorescence divided by...mCherry even when they are not stressed LB and LB IPTG . This is possibly...due to the rrnB P1 promoter not being strong enough to produce sufficient...Looking at the difference between samples with P and without promoter P ...in LB and LB IPTG it is clear that the rrnB P1 promoter does produce lacI....The fluorescence OD value of P in LB is lower than P in LB indicating...production of lacI. When it is induced by IPTG inhibiting lacI the level...The fluorescence OD of the M9 samples is much higher than the LB. This was...in all M9 parallels after 3 5 hours data not shown . What is interesting...here is that the difference between P and P seems to be gone. This...indicates that the rrnB P1 promoter does indeed produce less lacI when the...shutting it down. As the data was quite variable this is hard to say for...First of all there is a remarkable difference between the distributions for M9...and LB. The distribution for LB is relatively sharp compared to M9 which means...there is little difference in the level of light emitted from the individual...cells. The distribution for M9 is much broader showing a greater variance and...it is also shifted to the right. A distribution shifted to the right means... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K634001","videoId":"BBa_K634001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10G - [ Coding ] ['exaE is a transcription factor that is activated by phosphorylation from exaD.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K606017","videoId":"BBa_K606017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10H - [ Translational_Unit ] ['Fused with the RBS SpoVG this biobrick is the expression cassette for B.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K624003","videoId":"BBa_K624003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10I - [ Coding,chassis, miscellaneous ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K627011","videoId":"BBa_K627011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10J - [ Device ] ['This BioBrick is a 2 part fusion of arabinose inducible induction system and...When arabinose is added to the media 2mM up to 50 mM the CAP lost its...express at a very high rate. So we can assume that this system is an effectiv... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K624000","videoId":"BBa_K624000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10K - [ Regulatory,chassis, miscellaneous ] [' Magnetospirillum magneticum AMB 1 fused with the second strongest promoter... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K568001","videoId":"BBa_K568001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10L - [ Composite ] ['This logical gate is based on amber stop codon suppression via the non ...only be translated by ribosomes if the correct supD tRNA is present. The supD...tRNA is expressed when the red light sensor...be transfected with another plasmid containing a T7 promoter followed by a...If the part is hit by both far red light 705 nm and blue light 465 nm ...beams the AND Gate is turned on. Red light induces the autophosphorylation at...from the YcgZ promoter which activates the transcription of T7ptag T7...This AND gate should ensure that expression of T7 polymerase is only induced...']]"},{"machine":"BBa_K624004","videoId":"BBa_K624004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10M - [ Coding,chassis, miscellaneous ] ['pYMB Fig. 1 is described to contain the ori origin of replication rep gene...pYMB is constructed by equipping the ori the appropriate promoter for AMB 1...promotor Pmsp1. The constructed vector is capable of replicating within both... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K592016","videoId":"BBa_K592016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10N - [ Composite ] ['YF1 works in conjunction with its response regulator FixJ. This part consists...of RBS coupled YF1 and FixJ without promoter without terminator.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K581005","videoId":"BBa_K581005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10O - [ RNA,chassis, prokaryote, ecoli, regulation, negative ] [' SgrS sugar transport related sRNA wt is a small RNA regulator that...expression of PtsG is repressed....gene silencing ability. These results indicate that it is the base pairing of...the two RNAs rather than particular nucleotides that is important for SgrS...though complementary is rather dispensable for the efficient silencing... SgrS wt in this part will be constitutively expressed in E.coli after... Following is a contribution to this part by the NUS Singapore 2019 team. ...coli especially when glucose is the only carbon source Wadler ...constitutive promoter to express SgrS team NUS 2019 adopted tetracycline... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K592018","videoId":"BBa_K592018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 10P - [ Composite ] ['This is the red light sensor Cph8 with RBS.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K516132","videoId":"BBa_K516132","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11A - [ Measurement ] ['Constitutive promoter J23101 with mRFP RBS B0032...constitutive promoter with...The change in fluorescence intensity in the medium is related to the culture...containing 5 ml LB which is called 0h. At the same time we also inoculated...culture bacterial cells at 37 C 220 rpm. The sampling time point is 24h....microplate reader. Total fluorescence is divided by OD600 to obtain...and 3.245 respectively which is very close. The OD600 of the strain...RFU OD600 at 24h is 49.57 which is higher than the RFU OD600 31.04 at 30h....RFU OD600 at 24h and 30h is close to zero. The Bba K516132 containing strain...RFU OD600 is 45.26 at 37 which is higher than 3.74 at 30 ....n a Constitutive promoter J23101 with mRFP RBS B0032... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be... n a Constitutive promoter J23101 with mRFP RBS B0032...']]"},{"machine":"BBa_K797001","videoId":"BBa_K797001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11B - [ Coding ] ['This parts is a coding region of phage shock protein A. It ease the difference... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K553003","videoId":"BBa_K553003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11C - [ Composite ] ['This part produces constitutively the P. aeruginosa LasR trans activator....promoter... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K914001","videoId":"BBa_K914001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11D - [ Composite,biosafety, xnase ] ['RBS. This part can be used to confer immunity against the colicin E2 activity... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K541501","videoId":"BBa_K541501","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11E - [ Regulatory,chassis, prokaryote, bsubtilis ] ['Promoter Pveg RBS spoVG and SacB signal peptide for B. subtilis...2008 Imperial Collage. Pveg is a constitutive promoter that constitutively...expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome...is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3 ...region of the 16s rRNA from B. subtilis. SacB is a signal peptide used in the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K914003","videoId":"BBa_K914003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11F - [ Regulatory,promoter ] ['L rhamnose inducible promoter pRha ...L rhamnose inducible promoter is capable of high level recombinant protein...expression in the presence of L rhamnose it is also tightly regulated in the...L rhamnose is taken up by the RhaT transport system converted to L rhamnulose...the resulting rhamnulose 1 phosphate is hydrolyzed by an aldolase RhaD into...dihydroxyacetone phosphate which is metabolized in glycolysis and...promoter....The genes rhaBAD are organized in one operon which is controlled by the...rhaPBAD promoter. This promoter is regulated by two activators RhaS and RhaR ...and the corresponding genes belong to one transcription unit which is located...in opposite direction of rhaBAD. If L rhamnose is available RhaR binds to the...rhaPRS promoter and activates the production of RhaR and RhaS. RhaS together...with L rhamnose in turn binds to the rhaPBAD and the rhaPT promoter and...application of the rhamnose expression system it is not necessary to express...copy plasmids. Therefore only the rhaPBAD promoter has to be cloned upstream...of the gene that is to be expressed. Full induction of rhaBAD transcription...also requires binding of the CRP cAMP complex which is a key regulator of...and similar species and identified that the at the position is sometimes...ordered a gBlock with the pRha sequence having the mutation and this is the...In order to characterize this promoter we made a construct with a medium RBS...promoter was repressed by Glucose did not show any visible fluorescence. Both...Next we characterized the pRha promoter using a plate reader. We used...Characterized the pRha promoter using a plate reader...As we can see from the graph above pRha promoter works as expected and it...The UChicago 2015 iGEM team also used this part in their project and did some...characterization of the promoter using Western blot for their gene of...characterized the promoter when expressed in a high copy plasmid. Accordingly ...promoter in the high copy number plasmid....The UChicago team also verified that the pRha promoter is quite tight and has...a relatively gradual response curve characteristics that makes the promoter...0 L rhamnose there is significantly less KaiA expressed compared to KaiB and...KaiC on a separate constitutively expressed promoter. This supports our... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...When using this promoter as a biosensor it is used with only one gene...encoding a fluorescent protein rfp gfp .This is because the...modification has already been tested in cyanobacteria which is a clade within...it s difficult to find a good inducible promoter system which is no toxic ...We know for exemple that the rhamnose is metabolized by E.coli so the...Another point to ameliorate is the false dose dependant effect of the P...rhaBAD biobrick.3 In fact some studies show that effect is due to the...inducer is optimal to produce a chosen protein efficiently.3...This promoter can be induced by an analogue of L rhamnose the L mannose ...described previously is sometimes even more sensitive for it than for...we have a response that continues in time and is more powerful.1 That surely...which is useful to produce the same concentration of protein in different...cells except for low inducer concentration where the expression is bimodal.1...This bimodality at low concentration is also encountered with the Plac IPTG...inducible system which is hugely used so it isn t really a problem.1 It can... 1. Kelly et al 2016 Synthetic Chemical Inducers and Genetic Decoupling Enable Orthogonal Control of the rhaBAD Promoter https pubs.acs.org doi 10.1021 acssynbio.6b00030 ... 3. Hjelm 2017 Tailoring Escherichia coli for the L Rhamnose PBAD Promoter Based Production of Membrane and Secretory Proteins https pubmed.ncbi.nlm.nih.gov 28226208 ... promoter...']]"},{"machine":"BBa_K541502","videoId":"BBa_K541502","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11G - [ Regulatory,chassis, prokaryote, bsubtilis ] ['Promoter Pveg RBS spoVG and LipA signal peptide for B. subtilis...2008 Imperial Collage. Pveg is a constitutive promoter that constitutively...expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome...is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3 ...region of the 16s rRNA from B. subtilis. LipA is a signal peptide from the B.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K914011","videoId":"BBa_K914011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11H - [ Intermediate,biosafety, semantic_containment ] ['This is the intermediate of the K914000 part so you can change the promoter... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K541503","videoId":"BBa_K541503","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11I - [ Regulatory,chassis, prokaryote, ecoli ] ['Constitutive Strong promoter Strong RBS and TAT signal peptide...Twin arginine signal peptide is an efficient protein export signal sequence of...E. coli. Because of its constitutive character its promoter works... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K738002","videoId":"BBa_K738002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11J - [ Generator,rna, aptamer ] ['However when theophylline is added the fold of the loop is changed and thus...substantial amount of split GFP combination is permitted because of the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K541505","videoId":"BBa_K541505","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11K - [ Generator,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli ] ['Lipopolysaccharide LPS or endotoxin is the major mediator of septic shock ...E. Coli as a single point while the Bacillus spread is fresh. We aimed to see...EColi of the plate B1 does not grow the reason for this is LALF protein.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K863206","videoId":"BBa_K863206","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11L - [ Other ] ['This part is a part of a shuttle vector... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K541506","videoId":"BBa_K541506","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11M - [ Generator,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli ] ['Reflectin is a self assembling protein that has the ability to reflect the sun...reflects light 3 . Reflectivity in these animal tissues is achieved by...a Bragg reflector creates a thin film interference pattern which is the...Optical characterization of these proteins is an important work for studies...using reflectin proteins. However it is hard to characterize the refractive... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K875009","videoId":"BBa_K875009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11N - [ Coding,chassis, prokaryote, ecoli, nissle, Kit plates, antimicrobial, Kit plates, probiotics, Kit plates, probiotics, biocontainment ] ['The LL 37 cathelicidin is a human antimicrobial peptide....The exact mechanism by which AMPs kill microorganisms is still under debate....LL 37 were all qualitative. This is why our team undertook the task of...characterizing this part in order to report a quantitative absorbance study....bacteria. Escherichia coli is susceptible to the effects of this peptide ...composite capable of expressing LL 37 under the regulation of the T7 promoter....its toxicity towards its host it may have caused this partial inhibition....reduction in total growth was perceived. In conclusion inhibition is not... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K541526","videoId":"BBa_K541526","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11O - [ Device,chassis, prokaryote, bsubtilis ] ['2008 Imperial Collage. Pveg is a constitutive promoter that constitutively...expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome...is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3 ...region of the 16s rRNA from B. subtilis. LipA is a signal peptide from the B.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K895000","videoId":"BBa_K895000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 11P - [ Regulatory ] ['The constitutive promoter region 103 bp from the Escherichia coli K 12... tatABCD twin arginine translocase operon. This is a constitutive promoter...that gives good levels of expression in E. coli but is not inducible or...repressible. The promoter region is cloned as an EcoRI PstI fragment into...pSB1C3 following Biobrick Standard RFC 10 . This is a corrected part that... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K581006","videoId":"BBa_K581006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12A - [ RNA,chassis, prokaryote, ecoli, transcriptional ] ['PtsG is a glucose permease which is subordinate to phosphotransferase system...part of the small RNA regulator sgrS wt 1 . ptsG mRNA is regulated by SgrS by...short imperfect base pairing interactions and its expression is thus...gene silencing ability. These results indicate that it is the base pairing of...the two RNAs rather than particular nucleotides that is important for SgrS...though complementary is rather dispensable for the efficient silencing...detail ptsG1 refers to a C85G mutant of ptsG wt while ptsG2 is a C87G...the transcription of ptsG gfp mRNA which is the target of constitutively...expressed SgrS. This is how we implemented both reporting and repressing...outputs as a result of the activation of Psal. When there is more salicylate...in the media the GFP fluorescence intensity is expected to be stronger. B ...downstream a constitutive promoter. In this scenario as the concentration of...be stronger so the GFP fluorescence intensity is supposed to be weaker. ...to the lower right as expected which is 5 to 6 folds. As for the ptsG...differ at only one base pair the repression efficacy is around 3 folds. By...contrast the inhibiting effect of on ptsG2 and SgrS2 on ptsG1 is rather...between sRNA and mRNA occurs extremely rapidly gene expression is completely...silenced if the target transcription rate is below a threshold. Above this...induced SgrS repressing the expression of ptsG GFP. The promoter activity is...Different promoter activities were obtained by varying salicylate...with variable Hill slope given as a parameter and the R 2 is 0.9974 0.9879 ...salicylate induced a dose response curve is also fitted with an R 2 of...the performance of SgrS ptsG pairs is very close to the idealized threshold ...biology 5 regulatory region of ptsG wt is the target of sRNA SgrS wt ...']]"},{"machine":"BBa_K592020","videoId":"BBa_K592020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12B - [ Reporter ] ['FixK2 promoter is the downstream signaling promoter of YF1 FixJ blue light ...opposite way with lights activating and darkness inactivating is more...desirable. Therefore an inverter was placed behind FixK2 promoter. When in...binds to FixK2 promoter allowing the transcription of the lambda C1 thus...FixK2 promoter which in turn has near zero activity. The lambda C1... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K581008","videoId":"BBa_K581008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12C - [ Generator ] ['This is the cell death protein coding sequence under the control of a...relatively weak RBS. It is replicable in non ccdB resistant strains.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']]"},{"machine":"BBa_K546000","videoId":"BBa_K546000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12D - [ Signalling,classic, signalling, receiver, function, biosynthesis, ahl, function, cellsignalling ] ['transcriptional rate of the lux pR promoter while also decreasing the...transcriptional rate of the lux pL promoter....The quorum sensing molecule AHL is produced by LuxI which is under the control...of the lux pR promoter. In combination with LuxR AHL thus increases the...For determining the experimental data this part was combined with...The GFP expression rapidly increases indicating functionality of this part....controls GFP expression. As a result a positive feedback loop is initiated....displayed is the average of all 4 technical replicates. All...displayed. One biological repeat of the 2 plasmid strain experiment is not...graph is shown underneath here....only strain. For both strains every value displayed is the average of all 4 ...OD600 increases there is a sharp increase in HSL concentration in the cells....Though a slight increase in fluorescence is also seen in the absence of the...']]"},{"machine":"BBa_K524001","videoId":"BBa_K524001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12E - [ Reporter ] ['green fluorescence. Hence when this biobrick is expressed together with...']]"},{"machine":"BBa_K546001","videoId":"BBa_K546001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12F - [ Composite,classic, signalling, receiver, function, cellsignalling ] ['AiiA enzyme. AiiA is capable of degrading the quorum sensing molecule AHL....It should be noted that if AHL is added to this system it forms a complex with...Functionality of this part was tested by treating AHL mixtures with strains...expressing this part. Liquid cultures were grown overnight 1 mL aliquots of...detecting GFP. The result is shown below....This part is functional as AHL concentrations drop after incubation with E....coli transformed with this part. The GFP expression is much higher in the non...']]"},{"machine":"BBa_K539421","videoId":"BBa_K539421","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12G - [ Generator ] ['promoter lacI regulated RNA thermometer... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...n a promoter lacI regulated RNA thermometer...']]"},{"machine":"BBa_K641009","videoId":"BBa_K641009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12H - [ Composite ] ['transcription factor for the ctx Promoter. Thus If this composite part is...This is available in .pdf format here ...']]"},{"machine":"BBa_K539622","videoId":"BBa_K539622","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12I - [ Intermediate ] []]"},{"machine":"BBa_K517002","videoId":"BBa_K517002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12J - [ Translational_Unit ] ['The a pinene synthase PsTPS Pin synthase is a monoterpene synthase... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K539119","videoId":"BBa_K539119","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12K - [ Coding ] ['UPS contributed to the characterisation of this part by adding a new...This is the coding sequence of crtY from Pantoea ananatis formerly Erwinia...The following is the gel electrophoresis result of crtY...We can see that the location of plasmid cut by Spe1 is the same as uncut...result is shown below....Since the CrtI phytoene desaturase is a part of the biosynthesis pathway of...carotenoids fig. 1 it is often co expressed with the other enzymes of the...of single domain CrtI CrtY and CrtB fig.2 . CrtB is unambiguously detected...bifunctional lycopene cyclase phytoene synthase CrtYB enzyme is depicted in...orange the phytoene desaturase enzyme CrtI is depicted in red. Orange or...predicted to be cytosolic and CrtY enzyme is predicted to be transmembrane... 2 surprisingly there is a natural fusion between CrtY and CrtB which gives...CrtYB enzyme 3 . There is a strong opinion on the importance of this natural...pathway from phytoene to carotene is depicted at the top with the same color... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K517003","videoId":"BBa_K517003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12L - [ Translational_Unit ] ['The b pinene synthase PsTPS Pin2 synthase is a monoterpene synthase... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K649001","videoId":"BBa_K649001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16M - [ Reporter ] ['GFP expression after induction of 3OC12 HSL is 170 times as high as before....This work is done by Takuya Tsubaki....Generally in the presence of 3OC12 HSL LasR activates lasI promoter and the...3OC12 HSL LasR can t activate lasI promoter. 2011 iGEM Tokyo Tech...We improved previous las promoters. ...']]"},{"machine":"BBa_K517005","videoId":"BBa_K517005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12N - [ Translational_Unit ] ['wild type Erg20. GPP is a precursor in producing monoterpenes whereas FPP... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K519010","videoId":"BBa_K519010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12O - [ Coding,binding, metal, proteindomain ] ['SmtA is a metallothionein that can bind to heavy metal ions such as Cd II ....This SmtA is cloned from Synechococcus sp. PCC7942 a cyanobacterial strain....SmtA is a type II metallothionein with a reduced cys content.It was reported...expressed under a constitutive promoter J23109 work very well. We plotted a... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K577894","videoId":"BBa_K577894","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 12P - [ Reporter ] ['promoter I14033. The TetR represses the pTet promoter in front of the YFP...gene. By addition of tetracycline or aTc this repression is inhibited and the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K541596","videoId":"BBa_K541596","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13A - [ Device,chassis, prokaryote, ecoli ] ['Reflectin gene with J04500 promoter...Lipopolysaccharide LPS or endotoxin is the major mediator of septic shock ...']]"},{"machine":"BBa_K895004","videoId":"BBa_K895004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13B - [ Coding ] ['This is a coding part comprising the full open reading frame of Salmonella...CD27 bacteriophage. The CD27 endolysin is believed to have high specificity... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K584001","videoId":"BBa_K584001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13C - [ Composite ] ['Constitutive promoter GFP generator...']]"},{"machine":"BBa_K861090","videoId":"BBa_K861090","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13D - [ Coding ] ['2012 was improved by adding a T7 promoter RBS and T7 terminator to its...enzyme encoded by the yhjH gene is to promote motility whilst reducing biofilm...normal non transformed ones. This is because by promoting motility the...surrounding is to actively leave unfavorable environments for more fitting...was done by adding a T7 promoter and RBS...consideration. As shown in Figure 1 the colorant intensity is higher in the...The function of this gene is to enhance motility whilst reducing biofilm...This is why the project makes use of two more genes aiiA and epsE which... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']]"},{"machine":"BBa_K584002","videoId":"BBa_K584002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13E - [ Composite ] []]"},{"machine":"BBa_K861172","videoId":"BBa_K861172","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13F - [ Generator ] ['lambda cI generator controlled by PcstA glucose repressible promoter ...Lambda cI is controlled by promoter PcstA which can be activated by CRP cAMP...n a lambda cI generator controlled by PcstA glucose repressible promoter ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be... n a lambda cI generator controlled by PcstA glucose repressible promoter ...']]"},{"machine":"BBa_K584003","videoId":"BBa_K584003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13G - [ Composite ] ['Lambda cI and LuxR regulated hybrid promoter GFP generator...This part was designed to test the functionality of the promotor region....n a Lambda cI and LuxR regulated hybrid promoter GFP generator...']]"},{"machine":"BBa_K861173","videoId":"BBa_K861173","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13H - [ Reporter ] ['mRFP generator controlled by PcstA glucose repressible promoter ...RFP is controlled by promoter PcstA which can be activated by CRP cAMP...this part characterization knowing the change in output by varying the...our experience a significant drawback is its considerable autofluorescence ...Vilnius Lithuania 2019 iGEM team suggests future teams that choose this part...promoter. It has been shown by previous teams that with the increased...concentration of glucose there is a decrease in the activity of PcstA. Team...iGEM IISER Kolkata is trying to characterize what is the effect of increasing...As expected there is a linear increase in the OD600 of the bacterial culture...increase in concentration of glucose fructose and xylose there is a decrease...in mRFP fluorescence. This signifies the fact that the PcstA promoter activity... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...n a mRFP generator controlled by PcstA glucose repressible promoter ...']]"},{"machine":"BBa_K540001","videoId":"BBa_K540001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13I - [ Regulatory,function, sensor, metal, promoter, regulation ] ['rcn cobalt sensitive promoter...P rcn is a promoter that is activated by cobalt. The RcnR repressor binds to...the promoter by default. When enough cobalt molecules accumulate in the cell...on the rcn promoter....Prcn is also activated by nickel but we have not characterized this aspect....iGEM Gfp. It has been done with the wild type promoter. The part we provide...contains the exact sequence of the promoter but a silent mutation to remove a...PstI site. The GFP used here is a stable GFP. ...In order to determine wether rcn promoter is inducible by cobalt or not a...NM522 p157 where p157 is a plasmid containing a fusion P rcn stable GFP ...promoter described in Appl Environ Microbiol. 2009 March 75 6 1723 1733 . ...NM522 p115 where P115 is the control plasmid pPROBE OT ....are stopped when the OD reaches 1. A last sampling is done after an overnight...control of rcn promoter responds spectacularly well to cobalt a drastic...increase of the fluorescent specific activity is observed in presence of the...cobalt addition . This probably results from the leaky nature of the promoter...Our characterisation of rcn promoter shows that this promoter is inducible...by cobalt. Kinetic analysis of the promoter allowed us to establish that an...OD 600nm of 0 2 was optimum for rcn promoter activation....To conclude this work shows that this promoter can be used with efficiency in...selective to the rcn promoter an other kinetic mesurment is done with a...MC4100 strain transformed by a plasmid containing the pLac promoter fused with...These results show that cobalt hasn t activated the pLac promoter. So the...cobalt activation is specific to the rcn promoter....This part is not toxic by itself. However when using this part you will...probably need to handle cobalt. Cobalt is toxic in all its forms ionic or... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']]"},{"machine":"BBa_K741003","videoId":"BBa_K741003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13J - [ Generator ] ['Promoter pRM with GFP gene downstream. The pRM is a modified one whose OR3... the third right operator is mutated to be obliterated. This means our pRM is...by CI dimer. We use this part to test the basic level of expression of...Figure 2 shows that the fluorescence intensity of prm gfp is so weak in...']]"},{"machine":"BBa_K606013","videoId":"BBa_K606013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13K - [ Translational_Unit ] ['This is a translational unit for expressing the RFP in B. Subtilis. The RBS...used is SpoVG K143021 that works both in B. subtilis and E. coli....Reporter system for whatever promoter or systems in B. subtilis....']]"},{"machine":"BBa_K741006","videoId":"BBa_K741006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13L - [ Translational_Unit ] ['It is a fusion protein of Cro and GFP. The linker between the two protein is...']]"},{"machine":"BBa_K606048","videoId":"BBa_K606048","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13M - [ Generator ] []]"},{"machine":"BBa_K822000","videoId":"BBa_K822000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13N - [ Regulatory ] ['lldPRD operon promoter RBS from E. coli...This is the promoter region for the lldPRD operon previously named lct of E....promoter has been shown to be induced by L lactate....The promoter is repressed activated by the regulatory protein lldR encoded by...and O2 in the promoter region and inhibits expression. 1 ...The activity of the promoter may be repressed by chloramphenicol and nutrient ...In the following figure we compared the expression of lldPRD operon promoter ...GFP and T7 lldPRD operon promoter GFP. The T7 promoter could enhance gene...Considering that the lactate concentration in yogurt is generally no more than...1m mol L the conclusion can given that the T7 promoter can enhance the signal...intensity for our experiments Figure 1 . p Figure 1 lldPRD operon promoter ...GFP vs T7 lldPRD operon promoter GFP...below T7 lldPRD operon promoter GFP... p We can easily find that the Lldr T7 lldPRD operon promoter GFP part are in...a higher level of expression comparing to the lldPRD operon promoter GFP when...the lactate concentration is lower than nearly 1.5 mM. Considering that the...lactate concentration in yogurt is generally no more than 1 mM the conclusion...can give that the T7 promoter can enhance the signal intensity for our...Figure 1 Lldr T7 lldPRD operon promoter GFP...Figure 2 lldPRD operon promoter GFP vs Lldr T7 lldPRD operon promoter GFP...Lldr T7 lldPRD operon promoter GFP composite ...']]"},{"machine":"BBa_K606053","videoId":"BBa_K606053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13O - [ Intermediate ] []]"},{"machine":"BBa_K822001","videoId":"BBa_K822001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 13P - [ Regulatory ] ['ldhA promoter RBS from Corynebacterium glutamicum...Promoter region associated with the ldhA operon of C. glutamicum....']]"},{"machine":"BBa_K598000","videoId":"BBa_K598000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14A - [ Reporter,chassis, prokaryote, ecoli, direction, forward, plasmidbackbone, copynumber, high, regulation, negative ] ['This is a GFP generator regulated by thiamine pyrophosphate TPP responsive...recently a full length hammerhead ribozyme from Schistosoma mansoni is being...conformational change which is important for genetic control. This natural...defined structure is stabilized. As shown in Figure 1C upon addition of...in yellow represents stem III which is later modified to be the linker...ribozyme and aptamer is shown in yellow. C The secondary structure of...dimensional segment in blue is TPP and the yellow part represents the linker...structure of TPP ribozyme 2.5 is shown in Figure 2 . The lower part of the...structure is natural TPP aptamer riboswitch and the upper part is Schistosoma...and hammerhead ribozyme the pairing nucleotides of which is the only...ribozymes 2.5. Natural TPP aptamer domain blue is fused to stem III of the...ribozyme is shown in green. Stems are indicated by roman numerals rate ...cleavage site is marked by a red arrow. RBS is shaded in pink and the...translation start code AUG is shaded in black. The figure was modified from...cleavage site. The figure is modified from 3 . ...ribozyme 1.20 would change to a conformation that is suitable for hammerhead... Figure 4 . This part consists of TPP ribozyme 2.5 kindly provided by...Native RBS E0040 B0015. This part consists of TPP ribozyme 2.5 with native RBS...inactive TPP HHAz 2.5 3 which is kindly provided by Markus Wieland et al. ...Then we constructed three different constructs based on this part along with...upstream T7 promoter and the downstream coding sequence is a GFP gene ...To prove that the performance of TPP ribozymes is not relevant to the...To further investigate whether the performance of TPP ribozymes is influenced...by upstream promoter and downsteam terminator we inserted pBAD promoter...promoter TPP ribozyme GFP and T7 terminator with native RBS. B 36 2.5...promoter or downstream terminator comparing T7 2.5 to pBAD 2.5 . These...inhibition ratio is fluorescence intensity under given TPP concentrations...during characterization thus is elected as an component of the toolkit to...We set two experiment groups for characterizing this part one without...arrow pBAD promoter... Figure 12 Construction of TPP RBS. TPP RBS consists of pBAD promoter ...']]"},{"machine":"BBa_K577895","videoId":"BBa_K577895","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14B - [ Reporter ] ['promoter I14033. The TetR represses the pTet promoter in front of the RFP...gene. By addition of tetracycline or aTc this repression is inhibited and the...']]"},{"machine":"BBa_K598001","videoId":"BBa_K598001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14C - [ Reporter,chassis, prokaryote, ecoli, function, reporter, fluorescence, regulation, positive, rna, riboswitch, regulator ] ['This is a GFP generator regulated by theophylline responsive riboswitch. mRNA...promoters it would be used to demonstrate theophylline responsive curve ...theophylline concentration there is negligible growth inhibition.....Theophylline is a small molecule which is passable through bacterial...ligand shifts the inhibitory secondary structure element that is originally...of theophylline. Theophylline aptamer is boxed. 1nt slipping mechanism is...shown in yellow. UGGA is shown in red as RBS sequence. AUG initiation codon is...GFP fluorescence intensity is measured to demonstrate the ability of P1G1...intensity is measured with increasing concentrations of theophylline Fig.4 ....fluorescence intensity is still low indicating relatively low translation...expediently down regulate downstream gene translation but it is impossible to...strong RBS is thought to proportionally shift the modulating range activation...theophylline. Theophylline aptamer is boxed. 1nt slipping mechanism is shown...in yellow. UGGA is shown in red as RBS sequence. AUG start codon is in black....loop structure of 1G1 is schematized in Fig.6. 1G1 shares the same slipping...Dose response curve is shown in Fig.5. 1G1 displays a 10 fold activation ratio...']]"},{"machine":"BBa_K577893","videoId":"BBa_K577893","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14D - [ Reporter ] ['promoter I14033. The TetR represses the pTet promoter in front of the GFP...gene. By addition of tetracycline or aTc this repression is inhibited and the...']]"},{"machine":"BBa_K598003","videoId":"BBa_K598003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14E - [ RNA ] ['2.5 with the native RBS AAGGAGAT This part is a thiamine pyrophosphate...standard restriction sites in this part attaching upstream of target gene can...and start code of target gene after standard assembly is not appropriate....This part is obtained by PCR from inactive TPP HHAZ 2.5 1 which is kindly...']]"},{"machine":"BBa_K577881","videoId":"BBa_K577881","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14F - [ Reporter ] ['This reporter part is a combination of a constitutive promoter AraC gene a...pBad promoter inducible with arabinose and a GFP gene. The whole part is...approached with the usual restriction digest method. The purpose of this part...significant expression of the GFP gene. This is useful if the user plans to...part. This part can be inserted in a cell line that does not contain any AraC...in its genome which is important if the user is not using Top 10 cells....K577881 part is an inducible araC pBAD promoter with GFP. This section aims to...expression in this part and provide more detailed data for this part....2 . GFP expression in E.coli under the control of pBAD promoter induced by...3 . GFP expression of E.coli under the control of pBAD promoter induced by...different concentrations of L arabinose. It is not sufficient to induce the...As shown in Fig.3 K577881 part the inducible araC pBAD promoter with GFP ...the K577881 part which has an inducible araC pBAD promoter with GFP is...optimal concentration range for arabinose induced araBAD promoter is from...1 000 to 5 000 M which is dose dependent and increases over time....']]"},{"machine":"BBa_K598005","videoId":"BBa_K598005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14G - [ RNA ] ['This is a theophylline responsive riboswitch which enables to modulate...']]"},{"machine":"BBa_K530000","videoId":"BBa_K530000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14H - [ Coding ] ['UPS contributed to the characterisation of this part by adding a new...Enzyme in the pathway required for B Carotene Synthesis. This enzyme is a...combination it is the full Phytoene Synthase enzyme spliced with a Lycopene...compared with a wild type control. tHMG1 is used to funnel more initial...This is the sequencing for colony 2....Since the CrtI phytoene desaturase is a part of the biosynthesis pathway of...carotenoids fig. 1 it is often co expressed with the other enzymes of the...of single domain CrtI CrtY and CrtB fig.2 . CrtB is unambiguously detected...bifunctional lycopene cyclase phytoene synthase CrtYB enzyme is depicted in...orange the phytoene desaturase enzyme CrtI is depicted in red. Orange or...predicted to be cytosolic and CrtY enzyme is predicted to be transmembrane... 2 surprisingly there is a natural fusion between CrtY and CrtB which gives...CrtYB enzyme 3 . There is a strong opinion on the importance of this natural...pathway from phytoene to carotene is depicted at the top with the same color...']]"},{"machine":"BBa_K598006","videoId":"BBa_K598006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14I - [ RNA ] ['This is a theophylline responsive riboswitch which enables to modulate...']]"},{"machine":"BBa_K542004","videoId":"BBa_K542004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14J - [ Device ] ['Note that the pLacI promoter...regulating the Lumazine Synthase gene not the pBAD promoter...Therefore Lumazine Synthase production is IPTG inducible. ...This part was characterized in...']]"},{"machine":"BBa_K598007","videoId":"BBa_K598007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14K - [ Reporter ] ['Theophylline Responsive Riboswitch P1G1 with Native RBS E0040 B0015 This is a...intensity. Under the control of different promoters it could be used to...downstream gene expression. In this part the theophylline responsive...']]"},{"machine":"BBa_K575024","videoId":"BBa_K575024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14L - [ Composite ] [' Pseudomonas Aeruginosa detector. The device is designed to fluoresce with...sensing molecules. The promoter in front of GFP is activated by the...LasR PAI1 Inducible Promoter RBS B0030 GFP Constitutive Promoter RBS... 3 oxo C12 HSL inducible promoter RBS Part B0030 and a GFP reporter....to the characterization of this part by obtaining novel dose dependent...PAI 1 promoter in BL21 Escherichia coli for use in co culture...a lot of cell debris in brightfield so it is possible that the percent of...taken directly after AI 1 was added. The sensitivity of the PAI 1 promoter as...AI 1 to determine if this promoter exhibited dose dependent expression at...sought to characterize how sensitive the construct s promoter was to changes...At lower levels of AI 1 percent expression of fluorescence is shown to be...PAI 1 promoter is very sensitive exhibiting fluorescence at concentrations as...expression of promoter was minimal as illustrated by the lack of fluorescing...similar intensity of fluorescence is much higher in response to 17.5 100 nM...Kaplan H. B. Greenberg E. P. 1985 . Diffusion of autoinducer is involved...']]"},{"machine":"BBa_K598008","videoId":"BBa_K598008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14M - [ Reporter ] ['This is a basic part that consists of thiamine pyrophosphate TPP ligand...Native RBS E0040 B0015. This part consists of TPP ribozyme 1.20 with native...1.20 1 which is kindly provided by Markus Wieland et al. and then...This part is obtained by PCR from TPP HHAZ 1.20 1 which is kindly provided...']]"},{"machine":"BBa_K575025","videoId":"BBa_K575025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14N - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0030 GFP Constitutive Promoter RBS...This construct contains a LasR PaI1 3 oxo C12 HSL inducible promoter with an...RBS and a GFP reporter. There is also constitutive transcription of the LasR...receptor protein. Thus the promoter will activate and fluorescence will be...']]"},{"machine":"BBa_K598009","videoId":"BBa_K598009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14O - [ Device ] ['This is a measurement with a theophylline responsive riboswitch and reporter...fluorescence intensity. In this part the theophylline responsive riboswitch...']]"},{"machine":"BBa_K575026","videoId":"BBa_K575026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 14P - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0030 RFP Constitutive Promoter RBS...This construct contains a LasR PaI1 3 oxo C12 HSL inducible promoter with an...RBS and an RFP reporter. There is also constitutive transcription of the LasR...receptor protein. Thus the promoter will activate and fluorescence will be...to the characterization of this part by demonstrating that the part produces...BL21 E. coli chassis BL21 is a strain that produces a constant high level...Although it may be clearly observed that fluorescence is relatively minimal...even when AI 1 is added the data indicates that the promoter is as in part...hours after incubation but even at 1.5 and 3 hours it is evident from the...that although it would likely not serve as a very good reporter this part...']]"},{"machine":"BBa_K606061","videoId":"BBa_K606061","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15A - [ RBS ] ['This is a strong ribosome binding site from suibtilis. This part is a copy of...This parts also works fine in E. coli....This part can be use to express proteins in both B. subtilis and E. coli and...']]"},{"machine":"BBa_K863200","videoId":"BBa_K863200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15B - [ Other,chassis, eukaryote, chassis, eukaryote, pichia, chassis, eukaryote, yeast, direction, forward ] ['This part is a part of a shuttle vector...']]"},{"machine":"BBa_K606034","videoId":"BBa_K606034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15C - [ RNA ] []]"},{"machine":"BBa_K863201","videoId":"BBa_K863201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15D - [ DNA,chassis, eukaryote, chassis, eukaryote, pichia, chassis, eukaryote, yeast, direction, forward, function, recombination, plasmid, chromosomalintegration, plasmid, component, other ] ['This part is a part of a shuttle vector...']]"},{"machine":"BBa_K606041","videoId":"BBa_K606041","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15E - [ Generator ] []]"},{"machine":"BBa_K929301","videoId":"BBa_K929301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15F - [ Reporter ] ['The Potsdam Assembly Standard is a modified PLICing Phosphorothioate based...RFP The red fluorescence of the transformed colonies is obvious after 24 h...production. For the over night culture fig. 1 we observed that it is better...The insert is amplified with primers that contain 4 phosphothioate...out resulting in a 3 overhang which is suitable to the overhangs that was...']]"},{"machine":"BBa_K606040","videoId":"BBa_K606040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15G - [ Regulatory ] ['Promoter Hyperspank B.subtilis E.coli...Promoter hyper spank is an IPTG inducible promoter that has been designed for...promoter hyper spank can be induced by addition of Isopropyl...This promoter is flanked by two LacO sites. One downstream to make road block ...and one upstream to prevent the binding of the sigma subunit. This part is...Note Since there is not a sufficient expression of the LacI gene in subtilis ...genes in B. subtilis. Otherwise the promoter is going to act as a...Please note that this promoter also works fine in E. coli and can be use to...devices since the promoter have approximtely the same behaviour in both....']]"},{"machine":"BBa_K929302","videoId":"BBa_K929302","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15H - [ Coding ] ['AID is known to be responsible for somatic hypermutation and the class switch...To generate this part we used the Potsdam...success is much higher than without and that a electrophoretic purification...']]"},{"machine":"BBa_K553020","videoId":"BBa_K553020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15I - [ Coding ] ['The coding sequence is composed from the N Terminus to the C Terminus by the...']]"},{"machine":"BBa_K778000","videoId":"BBa_K778000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15J - [ Regulatory ] ['hycAp Promoter of hyc operon activated by FhlA...hycAp is the promoter of hyc operon FHL formate hydrogen lyase activated by...']]"},{"machine":"BBa_K510022","videoId":"BBa_K510022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15K - [ Other ] [' Single target transposition to the bacterial genomes is dependent on the...reveal that this region is highly conserved and Tn7 transposition has been...attTn7 at the C terminus of the glmS gene with the TnsD binding site is shown....']]"},{"machine":"BBa_K895006","videoId":"BBa_K895006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15L - [ Reporter ] ['This is GFP from Biobrick... baking yeast chassis and adding a yeast inducible promoter pGalS...validate and characterize the function of the pGalS promoter. In future...homologous overhangs to the GDP promoter and the CYC1 terminator. ... One set of primers would amplify from the URA 3 promoter to the GDP promoter...constitutive GDP promoter and the CYC1 terminator. The translational unit was...yeast strain BY4742 as the negative control. It is evident that there is...each cell. Below is the data obtained ...Note that the average fluorescence of each cell is 19331.989 21560.915 ...']]"},{"machine":"BBa_K510036","videoId":"BBa_K510036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15M - [ Device ] ['Proteolysis is a very common system to regulate gene expression in all...polypeptide into ClpP for its degradation which is very fast. The action of...this ClpXP protease is enhanced by the SspB adaptator protein....The idea is to add the DAS 4 tag to the proteins of one of the states of the...flip flop and express the Sspb under the promoter of the opposed state....expressed under the cI promoter and under the Lac promoter Sspb is expressed....is the case of the Salmonella OmpN gene whose translation is inhibited by...operons with their protein fusions and the promoter with the asRNA we show...each site. Finally the total length of our construction is indicated in the...Flop Module I the module II is necessary for the correct running. You...']]"},{"machine":"BBa_K785000","videoId":"BBa_K785000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15N - [ Coding,function, regulation, transcriptional, function, sensor, light ] ['This part code a protein as a light sensor and repressor. With the existence...of this protein expression downstream the PtetO promoter will be repressed...under the 450nm blue light. This protein which is actually a well designed...fusion protein includes two domains. The Lov domain is from Avena sativa...phototrophin1 AsLOV2 . The tetR is from the tetracycline resistance which...']]"},{"machine":"BBa_K592027","videoId":"BBa_K592027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15O - [ Measurement ] ['T5 lac promoter B0032 BFP...The promoter T5 lac...testing its promoter strength coupled with BFP...thereby determine the promoter strength. Theoretically the promoter should be...']]"},{"machine":"BBa_K801039","videoId":"BBa_K801039","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 15P - [ Coding,chassis, eukaryote, yeast, proteindomain, proteindomain, activation, proteindomain, binding, proteindomain, localization ] ['SV40NLS GAL4AD linker PIF3 part for GAL4 LexA based light switchable promoter...CDS for a synthetic hybrid fusion protein. This part is the second component... wiki images thumb 1 15 TUM12 light switchable promoter system.png 300px ...TUM12 light switchable promoter system.png.jpeg File TUM12 light ...switchable promoter system.png ... File TUM12 light switchable promoter system.png Enlarge ...']]"},{"machine":"BBa_K598010","videoId":"BBa_K598010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16A - [ Device ] ['This is a measurement with a theophylline responsive riboswitch and reporter...fluorescence intensity. In this part the theophylline responsive riboswitch... In this part of experiment we repeated the experiments conducted by...OD600. The growth curves of DE3 cells is displayed below ...absorbance is measured after the GFP fluorescence....plate. The distribution of the colonies cultured is displayed as below ...extended to 20 ms. The exact GFP fluorescent intensity of each well is listed...riboswitch designed to TPP. The activation ratio is fluorescence intensity...']]"},{"machine":"BBa_K575027","videoId":"BBa_K575027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16B - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0030 RFP Constitutive Promoter RBS...This construct contains a LasR PaI1 3 oxo C12 HSL inducible promoter with an...RBS and an RFP reporter. There is also constitutive transcription of the LasR...receptor protein. Thus the promoter will activate and fluorescence will be...']]"},{"machine":"BBa_K598011","videoId":"BBa_K598011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16C - [ Device ] ['This is a basic part that consists of pBAD promoter thiamine pyrophosphate...with Native RBS E0040 B0015. This part consists of pBAD promoter TPP ribozyme...from inactive TPP HHAz 2.5 1 which is kindly provided by Markus Wieland et...shown in fig.2. The inhibition ratio is the value of fluorescence intensity...']]"},{"machine":"BBa_K575029","videoId":"BBa_K575029","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16D - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0034 GFP Constitutive Promoter RBS... 3 oxo C12 HSL inducible promoter RBS Part B0034 and a GFP reporter....Characterization is one of major requirement to test the validity and...B0034 coupled with a LasR PAI1 AHL 3 oxo C12 HSL inducible promoter RBS...quantify the activation of LasR PAI1 inducible promoter we are using Green...From this there is a threshold for the induction of PAI1 on pLas which is...considered correct because LasR is driven to expression by a constitutive...promoter and its expression is constant. In addition a decrease in...']]"},{"machine":"BBa_K598012","videoId":"BBa_K598012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16E - [ Device ] ['This is a basic part that consists of pBAD promoter thiamine pyrophosphate...with Native RBS E0040 B0015. This part consists of pBAD promoter TPP ribozyme...from TPP HHAz 1.20 1 which is kindly provided by Markus Wieland et al. ...shown in fig.2. The activation ratio is the value of fluorescence intensity...']]"},{"machine":"BBa_K575031","videoId":"BBa_K575031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16F - [ Composite ] ['LasR PAI1 Inducible Promoter RBS B0034 RFP Constitutive Promoter RBS... 3 oxo C12 HSL inducible promoter RBS Part B0034 and an RFP reporter....']]"},{"machine":"BBa_K567013","videoId":"BBa_K567013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16G - [ Translational_Unit ] ['under the control of aspV promoter. This biobrick is constructed first by...This biobrick is constructed first by cloning the tRNAAsp from aspV in... E.coli then the anticodon region is site directed mutated. This part is...This part acts as a stop codon suppressor tRNA. It can be charged with Asp....as our Reporter. The amount of luciferase produced is reflected using the...are also transformed into the cell luciferase is produced. The results proved...']]"},{"machine":"BBa_K575032","videoId":"BBa_K575032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16H - [ Composite ] [' Pseudomonas Aeruginosa detector. The device is designed to fluoresce with...molecules. The promoter in front of GFP is activated by the combination of...RhlR PAI2 Inducible Promoter RBS B0030 GFP Constitutive Promoter RBS... C4 HSL inducible promoter RBS Part B0030 and a GFP reporter....']]"},{"machine":"BBa_K567016","videoId":"BBa_K567016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16I - [ Translational_Unit ] ['This biobrick is constructed by mutating the anticodon of tRNAMet to TCG base...pairing codon CGA . This tRNA can transfer fMet to CGA when it is used as the...start codon. KanR gene with start codon substituted for CGA is used to testify...cell is expected to survive Kanamycin....For more information concerning this part please see 2011 SJTU BioX ...']]"},{"machine":"BBa_K575033","videoId":"BBa_K575033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16J - [ Composite ] ['Pseudomonas Aeruginosa detector. The device is designed to fluoresce with GFP...molecules. The promoter in front of GFP is activated by the combination of...RhlR PAI2 Inducible Promoter RBS B0030 GFP Constitutive Promoter RBS... C4 HSL inducible promoter RBS Part B0030 and a GFP reporter....']]"},{"machine":"BBa_K543020","videoId":"BBa_K543020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16K - [ Conjugation ] []]"},{"machine":"BBa_K575036","videoId":"BBa_K575036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16L - [ Composite ] ['This construct is designed to report the presence of PAI2 part of the...allows us to use this part as a biosensor for the detection of Pseudomonas...RhlR PAI2 Inducible Promoter RBS B0034 GFP Constitutive Promoter RBS... C4 HSL inducible promoter RBS Part B0034 and a GFP reporter....']]"},{"machine":"BBa_K575037","videoId":"BBa_K575037","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16N - [ Composite ] ['This construct is designed to report the presence of PAI2 part of the...allows us to use this part as a biosensor for the detection of Pseudomonas...RhlR PAI2 Inducible Promoter RBS B0034 GFP Constitutive Promoter RBS... C4 HSL inducible promoter RBS Part B0034 and a GFP reporter....']]"},{"machine":"BBa_K574004","videoId":"BBa_K574004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16O - [ Signalling,classic, signalling, sender, function, cellsignalling ] ['This is a representative image from several independent replicates. S ...used in this particular replicate was an uninduced culture of strain...cultures above background in the 20 25 kDa range which is where the AHL...']]"},{"machine":"BBa_K575038","videoId":"BBa_K575038","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 16P - [ Composite ] ['RhlR PAI2 Inducible Promoter RBS B0034 RFP Constitutive Promoter RBS... C4 HSL inducible promoter RBS Part B0034 and an RFP reporter....']]"},{"machine":"BBa_K592029","videoId":"BBa_K592029","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17A - [ Measurement ] ['This construct is designed to enable a quantitative analysis of the CcaS CcaR...green light sensing system. The output is BFP...']]"},{"machine":"BBa_K864100","videoId":"BBa_K864100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17B - [ Coding,cds, reporter, yfp, Kit plates, chromoprotein, uppsala, function, reporter, fluorescence ] ['This part codes for the bright yellow fluorescent protein SYFP2. SYFP2 is a...This part is useful as a reporter....promoters with different strengths....conducted on pSB1A3 plasmid with J23100 promoter and B0034 RBS in living cells...different day of propagation and the shaded gray curve is a blank. Peaks to...different day of propagation and the shaded gray curve is a blank. Peaks to...']]"},{"machine":"BBa_K592024","videoId":"BBa_K592024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17C - [ Reporter,Kit plates, chromoprotein, uppsala ] ['B0034 RBS. One can add any promoter upstream of this gene....We hypothesized that the expression level of mTagBFP is affected by the...cautioned on the direct use of previous measurement data for promoters...']]"},{"machine":"BBa_K864600","videoId":"BBa_K864600","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17D - [ Terminator,terminator, single, direction, forward ] []]"},{"machine":"BBa_S04614","videoId":"BBa_S04614","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17E - [ Intermediate ] []]"},{"machine":"BBa_K864201","videoId":"BBa_K864201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17F - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['lexA is important in induction of recA...']]"},{"machine":"BBa_K592026","videoId":"BBa_K592026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17G - [ Measurement ] ['Reference promoter...the promoter strength coupled with BFP...this is cloned into pSB3K3 backbone one can measure the BFP output and use it...as reference value to measure the promoter strength of other promoters....']]"},{"machine":"BBa_K864400","videoId":"BBa_K864400","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17H - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Ptac trp lac regulated promoter...The Ptac promoter is a functional hybrid promoter derived from the trp and...lac promoters that are regulated by trp and lac 1 . This part also exist...The tac promotor we used is an established strong E. coli promotor. The...promotor is a hybrid between the trp and lac UV5 promotors BioCat GmbH ....with isopropyl beta D thiogalactoside IPTG so a high regulation is possible...greatest possible knowledge is everything in science. We worked with the tac...high. Figure 1 B shows that the more IPTG is used the more protein is in...de Boer HA Comstock LJ Vasser M. The tac promoter a functional hybrid...derived from the trp and lac promoters. Proc Natl Acad Sci U S A. 1983...This part has been improved to be the pPsiTac1 a strong psicose inducible...promoter. For more information on the improved part please go to the page of...This part is improved by SHSBNU China 2019 as... Figure 1.We constructed our reporter circuit with sfgfp and pTac promoter ... L of cell culture is added to 130 L of M9 medium which is followed by...Ptac trp lac regulated promoter br ...pTAC promoter was taken from part...hybrid of two operons the trp and lac operons. This promoter is inducible by...LacIq protein a strong pTAC promoter repressor. However in absence of IPTG ...promoter to characterize the promoter driven transcriptional noise....was placed in silico under the control of the pTAC promoter...coli NM522 strain. In order to study the efficiency of the pTAC promoter for...We studied the noise of the promoter by comparing the normalized fluorescence...Then we studied the induction of the promoter by comparing the normalized...In the case of RFP the pTAC promoter seemed to not enable a gene tune because...pTAC promoter was taken from part part...hybrid of two operons the trp and lac operons.This promoter is inducible by...the LacIq protein a strong pTAC promoter repressor. However in absence of...promoter to characterize the promoter driven transcriptional noise....was placed in silico under the control of the pTAC promoter...coli NM522 strain. In order to study the efficiency of the pTAC promoter for...We studied the noise of the promoter by comparing the normalized fluorescence...Then we studied the induction of the promoter by comparing the normalized...In the case of CFP the pTAC promoter seemed to enable a gene tune because... Team JUN China 2019 Fluorescent characterization of the Tac promoter...Tac promoter is a hybrid of two operons the trp and lac operons and it is...contains a large number of construct intermediates using the tac promoter. The...tac promoter is critical in our entire project so we used green and red...protein under the control of tac promoter by IPTG inducing at different times....containing the inducible tac promoter respectively and transfered eGFP and...capability of tac promoter was different at different induction times....protein excitation wavelength is 560 nm and the emission wavelength is 630... e PNs . The gene circuit includes this tac promoter which promotes the pilin...The e PN can be successfully expressed by express this part under the control... promoter ...control trp lac direction forward n a Hybrid promoter trp lac...']]"},{"machine":"BBa_K592023","videoId":"BBa_K592023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17I - [ Reporter,Kit plates, chromoprotein, uppsala ] ['Blue Fluorescent Protein with B0032 RBS this part can be added downstream to...any promoter assembled into pSB3K3 backbone and tested for promoter strength....B0032 is the standard RBS for promoter tests in pSB3K3 backbone. ...We hypothesized that the expression level of mTagBFP is affected by the...cautioned on the direct use of previous measurement data for promoters...']]"},{"machine":"BBa_K864202","videoId":"BBa_K864202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17J - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['MarR G95S multi antibiotic resistance repressor is the native repressor of...MarRAB which both is controlled by the operator MarO which MarR represses....MarR G95S is amplified from the E coli K 12 substrain MG1655 by nested PCR...']]"},{"machine":"BBa_K592008","videoId":"BBa_K592008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17K - [ Regulatory,promoter ] ['T5 lac Promoter...T5 lac promoter is a hybrid promoter made from the phage T5 early promoter and...LacIq strains where LacI is expressed in high levels. It is inducible by IPTG ...and recognizable by E coli RNA polymerase. Compared to the T7 promoters ...T5 lac promoter doesn t require the co expression of phage polymerase.... Promoter...characterization.png wiki images 3 34 Promoter characterization.png File Promoter characterization.png ... iGEM11 Uppsala Sweden Promoter characterization. We characterised the...reference promoter we used...used in every construct and we calculated the relative promoter units RPU ...Promoters Recognized by Escherichia Coli Rna Polymerase Selected by Function ...Highly Efficient Promoters from Bacteriophage T5. J Bacteriol 164 70 77....Promoters Largely Determine the Efficiency of Repressor Action. P Natl Acad... promoter...']]"},{"machine":"BBa_K864203","videoId":"BBa_K864203","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17L - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] []]"},{"machine":"BBa_S04616","videoId":"BBa_S04616","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17M - [ Intermediate ] []]"},{"machine":"BBa_K864204","videoId":"BBa_K864204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17N - [ Coding,cds, membrane, channel, chassis, prokaryote, ecoli ] ['Part information is collated here to help future users of the BioBrick...bacteriophage T2 and is the probable major receptor for colicin E5....Its native promoter is regulated by the dual transcriptional regulator OmpR ...']]"},{"machine":"BBa_S04617","videoId":"BBa_S04617","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17O - [ Intermediate ] []]"},{"machine":"BBa_K864440","videoId":"BBa_K864440","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 17P - [ RNA ] ['This part is a component of the Uppsala University iGEM 2012 modular small RNA...This is the small RNA spot42 from E coli MG1655 coupled to the strong promoter...']]"},{"machine":"BBa_K574007","videoId":"BBa_K574007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18A - [ Composite ] []]"},{"machine":"BBa_K575039","videoId":"BBa_K575039","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18B - [ Composite ] ['RhlR PAI2 Inducible Promoter RBS B0034 RFP Constitutive Promoter RBS... C4 HSL inducible promoter RBS Part B0034 and an RFP reporter....']]"},{"machine":"BBa_K518012","videoId":"BBa_K518012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18C - [ Reporter,classic, reporter, constitutive ] ['This part is an easy promoter assessment tool. The RFP reporter enabels you to...find out whether a promoter of your interest works. All you have to do is...']]"},{"machine":"BBa_K575040","videoId":"BBa_K575040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18D - [ Composite ] ['Genomic LasR PAI1 Inducible Promoter RBS B0034 GFP...Genomic LasR PAI1 3 oxo C12 HSL inducible promoter which expresses GFP....']]"},{"machine":"BBa_K561001","videoId":"BBa_K561001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18E - [ Regulatory ] ['vgb promoter microaerobic...vgb promoter is induced under microaerobic conditions....']]"},{"machine":"BBa_K575044","videoId":"BBa_K575044","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18F - [ Composite ] ['Genomic LasR PAI1 Inducible Promoter RBS B0034 GFP Cons. Promoter RBS...This construct contains a LasR PaI1 3 oxo C12 HSL inducible promoter from...the Pseudomonas genome with an RBS and a GFP reporter. There is also...constitutive transcription of the LasR receptor protein. Thus the promoter...']]"},{"machine":"BBa_K629003","videoId":"BBa_K629003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18G - [ Coding,cds, enzyme, phosphorylation, chassis, prokaryote, ecoli, function, motility ] ['Chemotaxis is the cell s system for directed movement which allows the cell to...chemotactic system is a complex chain of phosphorylation reactions. At the end...of the chain is the flagellum binding protein CheY. The phosphorylated CheY...']]"},{"machine":"BBa_K575045","videoId":"BBa_K575045","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18H - [ Composite ] ['Genomic LasR PAI1 Inducible Promoter RBS B0034 GFP Cons. Promoter RBS...This construct contains a LasR PaI1 3 oxo C12 HSL inducible promoter from...the Pseudomonas genome with an RBS and a GFP reporter. There is also...constitutive transcription of the LasR receptor protein. Thus the promoter...']]"},{"machine":"BBa_K594001","videoId":"BBa_K594001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18I - [ Coding,classic, signalling, sender ] ['systems one of them is sinR sinI system The sinI is responsible for the...As a autoinducer synthatase the use of sinI is the same with luxI namely to...']]"},{"machine":"BBa_K590027","videoId":"BBa_K590027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18J - [ Composite ] ['This part consists of Acyl ACP...This part produces AAR which catalyzes the firststep in the conversion of...aldehyde. To generate alkanes this part is paired with ADC in the...']]"},{"machine":"BBa_K594005","videoId":"BBa_K594005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18K - [ Coding ] ['R. leguminosarum bv. viciae is a best characterized organism in the nitrogen ...system is composed of rhiR a luxR homolog rhiI a luxI homolog and the...']]"},{"machine":"BBa_K590030","videoId":"BBa_K590030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18L - [ Composite ] ['This part consists of Aldehyde...construct is designed to produce branched odd chain alkanes. Use of this part...This part fails likely due to toxicity of FabH2. By lowering expression...']]"},{"machine":"BBa_K594007","videoId":"BBa_K594007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18M - [ Coding ] ['RaiI is responsible for the synthesis of 3 OH C8 HSL a kind of AHL. The rai...bv. vicae. RaiI is positively autoregulated by RaiR and 3 OH C8 HSL but is...']]"},{"machine":"BBa_K590053","videoId":"BBa_K590053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18N - [ Composite ] ['This part consists of Acyl ACP...high constitutive promoter for alkane production....When wild type Aldehyde Decarbonylase is co expressed with Acyl ACP Reductase ...odd chain length alkanes is produced from the cell s fatty acid biosynthetic...pathway. Alkane production is enhanced when growing expression strains using...']]"},{"machine":"BBa_K594008","videoId":"BBa_K594008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18O - [ Coding ] ['with the 3 OH C8 HSL and then bind the cassette in raiI promoter activating...']]"},{"machine":"BBa_K590054","videoId":"BBa_K590054","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 18P - [ Composite ] ['This part consists of Acyl ACP...high consititutive promoter for alkane production....When wild type Aldehyde Decarbonylase is co expressed with Acyl ACP Reductase ...odd chain length alkanes is produced from the cell s fatty acid biosynthetic...pathway. Alkane production is enhanced when growing expression strains using...']]"},{"machine":"BBa_K592002","videoId":"BBa_K592002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19A - [ Coding ] ['The response regulator ccaR is part of the two component system TCS involved...promoter PcpcG2. Within the N terminal GAF domain of ccaS the blue phycobilin...within the sequence of the output promoter PcpcG2. Transcription of the output...gene is then activated....']]"},{"machine":"BBa_K864101","videoId":"BBa_K864101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19B - [ Composite,Kit plates, chromoprotein, uppsala ] ['This part is the Super Yellow Fluorescent Protein 2 SYFP2 ...B0032 RBS is commonly used for promoter testing giving a wider dynamic range...This part is usable as a reporter especially for promoter or copy number...']]"},{"machine":"BBa_K592025","videoId":"BBa_K592025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19C - [ Reporter,Kit plates, chromoprotein, uppsala, function, reporter, color ] ['B0034 RBS. One can add any promoter upstream of this gene....requiring no instruments to observe. The strong color is readily observed in...This part is useful as a reporter....confirm if this was due to lack of expression unlikely given the promoter was...a strong constitutive promoter or because natural pigments mask its colour.... Streptococcus thermophilus promoter and transformed into S. thermophilus...invertase which is our new...which is a blue chromoprotein that is visible to the naked eye. With our...This is the graph that focuses at the sixth hour. It shows the results of our...with the trigger. The expression of our improved part is lower than the...one expressed better. The ON OFF ratio is 1.44 which was much higher than 1....']]"},{"machine":"BBa_K864102","videoId":"BBa_K864102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19D - [ Composite,Kit plates, chromoprotein, uppsala ] ['This part is the Super Yellow Fluorescent Protein 2 SYFP2 ...This part is usable as a reporter. The very strong fluorescence means that...under a UV table with most promoters....']]"},{"machine":"BBa_K592009","videoId":"BBa_K592009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19E - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['requiring no instruments to observe. The strong color is readily observed in...This part has been adaptated to B. subtilis with a LVA tail. by the UPMC ...This part is useful as a reporter. In the pictures below it s built into...Technologies IDT . The codon optimized basic AmilCP part is attached to a...A 6x his tag was added to this part to the C terminal end of the expressed...repressing transcription. Upon binding of an Acyl CoA to FadR the promoter...region is freed enabling gene expression. ...for example with a plate reader. Therefore this option is available for...The production of long chain fatty acids LCFA is regulated by the...backbone which lacked the lac promoter with the restriction sites EcoRI and... Fig. 3 PAR3 is fused to the reporter gene amilCP and cloned into a pBb...production of the chromoprotein is increased by a higher concentration of...C16 0. Here the EVC is lower than the samples with amilCP. By adding lauric...the EVC also increased in a similar manner close to amilCP so it is not...inaccurate. A dose response can still be observed but it is not as strong or...improved from amilCP which is a blue chromoprotein gene from Acropora... Figure.5 . As Figure. 5 there is no blue clony 0 356 on the amilCP plate...expression of yamilCP is more quickly than that of amilCP in S. cerevisiae ....chromoprotein. The predicted molecular mass of this protein is about 50160Da ...and the exact size is 52874.5 52874.7Da.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...of two putative constitutive promoters identified in the genome of B....subtilis 168 . Details about these promoters can be found under the parts...under the control of our two promoters we initially confirmed expression of...The graph shows that both our promoters drive expression of AmilCP but at...different times during growth. With our promoter 30...With our promoter 15...also had tried amilCP which is a blue chromoprotein that is visible to the...This is the graph that focuses at the sixth hour. It shows the results of our...with the trigger. The expression of our improved part is lower than the...one expressed better. The on off ratio is 1.44 which was much higher than 1....']]"},{"machine":"BBa_K774007","videoId":"BBa_K774007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19F - [ Reporter ] ['Mammalian Bacterial promoter with RFP reporter CArG promoter sequence ...Our hybrid promoter hopes to add to the systems already in the registry by...creating a hybrid promoter that combines the bacterial promoter PyeaR and the...interchangeably. The hybrid promoter has been attached to the reporter Red...Fluorescent Protein RFP . The hybrid promoter has been characterised by... E. coli containing this part were then grown in media at 0 mM 5 mM 10 mM ...to the response of the mammalian bacterial promoter to different...to RFP is between 600 650nm. The graph clearly demonstrates that between 0mN...and 15mM there is a proportional relationship between fluorescence intensity...apart from the mammalian bacterial promoter ligated to eCFP at a 20mM...hybrid promoters to RFP which may suggest there is a difference in the...molecular mechanisms that these promoters function by however at this point...the change in intensity at 20mM is inconclusive and is an area which we would...therefore we synthesised two hybrid promoters in the orientation bacterial ...intensities of these two promoters however both promoters do show a decrease...']]"},{"machine":"BBa_K592006","videoId":"BBa_K592006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19G - [ Regulatory ] ['FixK2 promoter...FixK2 promoter is the wild type promoter to which phospho FixJ binds. FixJ in...turn can be regulated by YF1 the blue light sensing protein. This promoter...We wanted to test the reliability of this promoter is there leaky...expression And if so how much is there ...Leaky expression is when a promoter initiates transcription of a downstream...region of DNA when it s not supposed to. In this case FixK2 is only supposed...of the chosen marker is a result of leaky expression. In our experiments we...2 . Positive Control Constitutive promoter RBS GFP Double Terminator...Because YF1 FixJ is sensitive to blue light we also exposed our three genetic...YF1 FixJ we don t expect the light condition to affect FixK2 promoter...Our results show that the FixK2 promoter has very little to no leaky...']]"},{"machine":"BBa_K774006","videoId":"BBa_K774006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19H - [ Reporter ] ['Mammalian Bacterial promoter with eCFP reporter CArG promoter sequence ...Our hybrid promoter hopes to add to the systems already in the registry by...creating a hybrid promoter that combines the bacterial promoter PyeaR and the...interchangeably. The hybrid promoter has been attached to the reporter ...enhanced Cyan Fluorescent Protein eCFP . The hybrid promoter has been... E. coli containing this part were then grown in media at 0 mM 5 mM 10 mM ...due to the response of the mammalian bacterial promoter to different...to eCFP is between 440 500nm. The graph clearly demonstrates that between 0mN...and 15mM there is a proportional relationship between fluorescence intensity...from the bacterial mammalian promoter ligated to eCFP as well as the hybrid...promoters to RFP which may suggest there is a difference in the molecular...mechanisms that these promoters function by however at this point the change...in intensity at 20mM is inconclusive and is an area which we would like to...therefore we synthesised two hybrid promoters in the orientation bacterial ...to eCFP. There is a distinct difference between the intensity of fluorescence...produced by the bacterial mammalian promoter and the mammalian promoter which...is something that we would like to look into further. It is particularly...interesting that at an intensity of 109a.u. the mammalian bacterial promoter...bacterial mammalian promoter at 40a.u....As the graph indicates the number of cells which fluoresce is proportional to...Suggesting that our hybrid promoter is functional as expected.... Flexibility of the hybrid promoter Mammalian Cells ...The hybrid promoterswere created to increase the flexibility of chassis a...promoter can be used in. To fully characterise the functionality of B M and...M B it was therefore important that the promoter could in fact work within...serum so later is treated with serum....SNAP is the nitric oxide donor. Unlike bacterial cells where potassium nitrate...could be used as a direct source. SNAP is metabolised by cells to produce NO.... LipoD293 which is the transfection agent. This creates a membrane around the...cell. This is much like endocytosis..... The chassis used was MCF7 which is a human breast cancer cell line. The...channels on the slide. Below is how our channels were labelled....synthase ecNOS which can produce low levels of NO. Perhaps it is endogenous...NO production which is inducing the M B promoter to express low levels of...We do not know for certain what these may be but a possibility is that the...transfection was successful and the MB promoter does work. It may be that due...Another possibility is that NO has induced the cells to apoptose and this has...1999 . In non transfected cells there is less fluorescent proteins compared... Aminopeptidase N is a receptor for tumour homing peptides and a target for...gene promoters for radiogenetic cancer therapy. Gene Therapy 9 ...synthetic CArG promoter for nitric oxide synthase gene therapy of cancer ...']]"},{"machine":"BBa_K592100","videoId":"BBa_K592100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19I - [ Coding,cds, reporter, Kit plates, chromoprotein, uppsala, function, reporter, fluorescence ] ['This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a...This part is useful as a reporter....When the fluorescent protein is excited an emission spectrum is generated ...containing 5 ml LB which is called 0h. At the same time we also inoculated...culture bacterial cells at 37 C 220 rpm. The sampling time point is 24h....microplate reader. Total fluorescence is divided by OD600 to obtain...control DH5 is close to zero....These results indicate that the absorbance value of the strain is produced by...']]"},{"machine":"BBa_K774004","videoId":"BBa_K774004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19J - [ Reporter ] [' Aim Our hybrid promoter hopes to add to the systems already in the...registry by creating a hybrid promoter that combines the bacterial promoter...promoter has been attached to the reporter enhanced Cyan Fluorescence Protein... eCFP . The hybrid promoter has been characterised by observing expression of...order to induce promoter activity at concentrations of 0 mM 10 mM 50 mM and...that 10 mM was equal to or above the maximum sensitivity level of this part.... E. coli containing this part were then grown in media at 0 mM 5 mM 10 mM ...due to the response of the bacterial mammalian promoter to different...to eCFP is between 440 500nm. The graph clearly demonstrates that between 0mM...and 15mM there is a proportional relationship between fluorescence intensity...increase gradually decreases so that there is only a small increase between...therefore we synthesised two hybrid promoters in the orientation bacterial ...to eCFP. There is a distinct difference between the intensity of fluorescence...produced by the bacterial mammalian promoter and the mammalian bacterial...promoter which is something that we would like to look into further. It is...bacterial promoter returns to the same level of intensity as the suggested...maxiumum of the bacterial mammalian promoter at 40a.u....and the sequencing data. There is a suggested mutation at bp 506 of the...sequences are due to N s in the sequencing dats which is due to unresolved...']]"},{"machine":"BBa_K592004","videoId":"BBa_K592004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19K - [ Coding ] ['YF1 is a fusion protein of YtvA B subtilis and FixL B japonicum ....']]"},{"machine":"BBa_K838000","videoId":"BBa_K838000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19L - [ Coding ] ['LovTAP VP16 is a light sensitive protein that binds to DNA. The protein is a...it s able to act as a transcriptional activator when it is bound to a TRP...promoter site....before the protein is exposed to blue light. After light activation the Lov...This part is an improvement of part...target gene is activated when cells are exposed to blue light....constructs it is highly recommended to cut out the CMV or other constitutive...promoter from the mammalian vector....Any promoters already present must be removed since we want only want...in the cells is to perform a Western Blot using an anti VP16 antibody and a...GAL4 VP16 positive control. It is also possible to exploit the...emission wave length of 500nm when the domain is excited at 380nm or 490nm....Flow cytometry is a good technique for this. Microscopy can be used to see if...the protein is imported in the nucleus. Look at the Experience page and our...']]"},{"machine":"BBa_K546003","videoId":"BBa_K546003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19M - [ Signalling,classic, signalling, receiver, function, cellsignalling ] ['Lux pL controlled LuxR lux pR promoter....']]"},{"machine":"BBa_K805015","videoId":"BBa_K805015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19N - [ Coding ] ['red assay stains biofilm red . B Stained biofilm is solubilized in ethanol....C Absorbance is measured at 500 nm. ...found that CsgG is around 30 kDa whereas CsgA B C E and F are all around...increases adhesion to glass surfaces. B Stained biofilm is solubilized in...ethanol. C Absorbance is measured at 500 nm. ...One of the goals we want to achieve is to attach our bacteria to the inner...Therefore we add csgA to the biobrick design and change the promoter into...size of CsgD is around 24 kDa and CsgA around 17 kDa. The results below have...Next to prove that our amount of biofilm production is increasing we did a...and csgA csgD . We presume that binding affinity is determined by the...when a greater force is given. Hence we are able to prove that not only...']]"},{"machine":"BBa_K530005","videoId":"BBa_K530005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19O - [ Regulatory ] ['BAP2 Yeast Promoter...BAP2 Promoter is used to regulate the expression of genes within the genome of...This is the sequencing for colony 7. Colony 7 is a perfect match with the...genomic DNA promoter....']]"},{"machine":"BBa_K805016","videoId":"BBa_K805016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 19P - [ Composite ] []]"},{"machine":"BBa_K823000","videoId":"BBa_K823000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20A - [ Regulatory,chassis, prokaryote, bsubtilis, promoter, regulation, constitutive, rnap, prokaryote, subtilis, sigmaa ] ['P liaG is the promoter of the liaG gene of Bacillus subtilis which is...P liaG is a weak constitutive promoter from B. subtilis . It is...which is important for the detection of cell wall antibiotics Jordan et...This part was also evaluated in the publication The Bacillus BioBrick Box ...The constitutive promoters P liaG and P lepA were evaluated in the...promoter activity leads to gene expression and to the production of the... Fig. 1 Luminescence measurement of the constitutive Bacillus promoters P...All clones show a normal growth behaviour. The activity of both promoters...about 400.000 Lumi OD600. Comparing these two constitutive promoters the...activity of P lepA is about four times higher than the activity of P liaG ....clone of the promoters P lepA and P liaG did not show any luminescence...The two constitutive promoters P liaG and P veg were evaluated...promoters P liaG black and P veg grey fused to lacZ ....Promoter activity leads to the expression of the galactosidase. The... galactosidase assay of the constitutive Bacillus promoters P veg and P...experiment. In the beginning of the growth curve both promoters show only low...activity of both promoters P veg and P liaG is very similar based on the...activity of the promoter P veg with a maximum of 65 Miller units can be...is about five times higher than the acitivity of the promoter P liaG with a...This part was amplified from the genome of B. subtilis . ... promoter ...']]"},{"machine":"BBa_K590056","videoId":"BBa_K590056","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20B - [ Composite ] ['This part consists of Acyl ACP...high consititutive promoter for alkane production....When wild type Aldehyde Decarbonylase is co expressed with Acyl ACP Reductase ...odd chain length alkanes is produced from the cell s fatty acid biosynthetic...pathway. Alkane production is enhanced when growing expression strains using...']]"},{"machine":"BBa_K823001","videoId":"BBa_K823001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20C - [ Regulatory,chassis, prokaryote, bsubtilis, promoter, rnap, prokaryote, subtilis, sigmaa ] ['P liaI promoter of Bacillus subtilis ...P liaI is the promoter of the liaHI operon of B. subtilis . It has a very...low basal activity and is inducible by bacitracin in a concentration dependant...P liaI is an inducible promoter from B. subtilis which is strongly induced...suitable stimulus the two component system LiaRS is activated. The activated...response regulator LiaR binds to the operator of the promoter and induces the...transcription of the lia locus. When the promoter is turned on the two...This promoter is evaluated with the reporters lux as well as lacZ . For...This part was also evaluated in the publication The Bacillus BioBrick Box ...The bacitracin inducible promoter P liaI was evaluated in the reporter...contains the lux operon. The promoter activity leads to gene expression and... Fig. 1 Luminescence measurements of the inducible B. subtilis promoter P...average of three neighboring values. t 0 is the time of induction. ...because the cells lyse. The promoter P liaI shows a basal activity of about...bacitracin. To see the induction of this inducible promoter in comparison to...an uninducible promoter we also did induction experiments with P liaG ...which should not be inducible by bacitracin. As expected there is no response... Fig. 2 Promoter activity of P liaI depending on the bacitracin...The inducible promoter P liaI was also evaluated with the reporter vector...bacitracin 20 g ml of strains carrying the promoter P liaI fused to...Promoter activity leads to the expression of the galactosidase. The... galactosidase assay of the inducible Bacillus promoter P liaI was...induction. After induction with bacitracin there is a strong promoter activity...Summing up the promoter activity after induction is about 500 times higher...To verify the function of PliaI promoter in our system we made a construct...cassette of PliaI RBS GFP Terminator to pBS0E which is a replicative plasmid...Our data showed that PliaI is a strong promoter with a low basal level which...induction with bacitracin GFP intensity is expressed 2.81 fold higher than...This part was amplified from the genome of B. subtilis . ... promoter ...']]"},{"machine":"BBa_K590057","videoId":"BBa_K590057","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20D - [ Composite ] ['This part consists of Acyl ACP...high consititutive promoter for alkane production....When wild type Aldehyde Decarbonylase is co expressed with Acyl ACP Reductase ...odd chain length alkanes is produced from the cell s fatty acid biosynthetic...pathway. Alkane production is enhanced when growing expression strains using...']]"},{"machine":"BBa_K823002","videoId":"BBa_K823002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20E - [ Regulatory,chassis, prokaryote, bsubtilis, promoter, regulation, constitutive, rnap, prokaryote, subtilis, sigmaa ] ['P lepA is the promoter of the lepA gene of Bacillus subtilis . It is a...constitutive promoter and does not contain a ribosome binding site....P lepA is constitutive promoter which is important for the transcription of...the bicistronic operon. One of the expressed proteins is the protein P lepA ...mRNA tRNA complex one step back in the ribosome which is expected to improve...This promoter was evaluated with the lux operon as a reporter. For more...This part was also evaluated in the publication The Bacillus BioBrick Box ...The constitutive promoters P liaG and P lepA were evaluated in the...promoter activity leads to gene expression and to the production of the... Fig. 1 Luminescence measurement of the constitutive Bacillus promoters P...All clones show a normal growth behaviour. The activity of both promoters...about 400.000 Lumi OD600. Comparing these two constitutive promoters the...activity of P lepA is about four times higher than the activity of P liaG ....clone of the promoters P lepA and P liaG did not show any luminescence...The two constitutive promoters P liaG and P veg were evaluated...promoters P liaG black and P veg grey fused to lacZ ....Promoter activity leads to the expression of the galactosidase. The... galactosidase assay of the constitutive Bacillus promoters P veg and P...experiment. In the beginning of the growth curve both promoters show only low...activity of both promoters P veg and P liaG is very similar based on the...activity of the promoter P veg with a maximum of 65 Miller units can be...is about five times higher than the acitivity of the promoter P liaG with a...This part was amplified from the genom of B. subtilis .... promoter ...']]"},{"machine":"BBa_K611012","videoId":"BBa_K611012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20F - [ Composite ] ['plasmid at EcoRI and XbaI and the mutant promoter at EcoRI and SpeI. Several...repressor can be measured after inducing the pBad promoter with arabinose....concentrations as long as AraC is present....']]"},{"machine":"BBa_K823003","videoId":"BBa_K823003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20G - [ Regulatory,chassis, prokaryote, bsubtilis, promoter, regulation, constitutive, rnap, prokaryote, subtilis, sigmaa ] ['P veg is a strong constitutive promoter of Bacillus subtilis ....P veg is known to show a strong constitutive activity during the vegetative...growth phase and sporulation. This promoter is important for the transcription...the Data of the constitutive promoters http 2012.igem.org Team LMU ...This part was also evaluated in the publication The Bacillus BioBrick Box ...The two constitutive promoters P liaG and P veg were evaluated...promoters P liaG black and P veg grey fused to lacZ ....Promoter activity leads to the expression of the galactosidase. The... galactosidase assay of the constitutive Bacillus promoters P veg and P...experiment. In the beginning of the growth curve both promoters show only low...activity of both promoters P veg and P liaG is very similar based on the...activity of the promoter P veg with a maximum of 65 Miller units can be...is about five times higher than the acitivity of the promoter P liaG with a...This part was amplified from the genom of B. subtilis .... promoter ...']]"},{"machine":"BBa_K611013","videoId":"BBa_K611013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20H - [ Composite ] ['plasmid at EcoRI and XbaI and the mutant promoter at EcoRI and SpeI. Several...repressor can be measured after inducing the pBad promoter with arabinose....concentrations as long as AraC is present....']]"},{"machine":"BBa_K823004","videoId":"BBa_K823004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20I - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23100...Anderson promoter J23100 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon...promoters.png wiki images thumb 4 44 Auswertung Anderson promoters.png 400px ...Auswertung Anderson promoters.png File Auswertung Anderson promoters.png ... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K611014","videoId":"BBa_K611014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20J - [ Composite ] ['cI Repressible Promoter Characterization Construct...end by cutting this plasmid at EcoRI and XbaI and the mutant promoter at...promoter with arabinose. Concentration of the repressor can be varied through...different arabinose concentrations as long as AraC is present....']]"},{"machine":"BBa_K823005","videoId":"BBa_K823005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20K - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23101...Anderson promoter J23101 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...operon or the lacZ reporter gene. This part was also evaluated in the...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K611016","videoId":"BBa_K611016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20L - [ Composite ] ['LacI Repressor and Promoter Wild Type Control...This part is can be used as a control for...arabinose regulated promoter for LacI was with a constitutive promoter....']]"},{"machine":"BBa_K823006","videoId":"BBa_K823006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20M - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23102...Anderson promoter J23102 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K611059","videoId":"BBa_K611059","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20N - [ Composite ] ['pTet Promoter Variant 9 in Characterization Construct...This part contains a variant of the wild type Tet repressible promoter and is...testing of this particular mutant promoter at various concentrations of...repressor. The mutated pTet promoter in this plasmid expresses GFP and is...followed by an arabinose inducible promoter pBad which expresses the TetR...inducing pBad with arabinose. This plasmid is very useful for the further...']]"},{"machine":"BBa_K823007","videoId":"BBa_K823007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20O - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23103...Anderson promoter J23103 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K642000","videoId":"BBa_K642000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 20P - [ Coding ] ['This is the repressor TetR from the Tn 10 tetracycline Tc resistance...and is inhibited in the presence of ATc 1 . This repressor is tagged with...yeast codon optimized BFP. BFP is a monomeric fluorescent protein that has an...']]"},{"machine":"BBa_K530014","videoId":"BBa_K530014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21A - [ Terminator ] ['KRE9 yeast UTR is used to regulate the expression of genes within the genome...This is the sequencing for colony 9. Both colony 1 and 9 were a perfect match...with the genomic DNA promoter....']]"},{"machine":"BBa_K886000","videoId":"BBa_K886000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21B - [ DNA,chassis, prokaryote, ecoli, function, recombination, cre ] ['The particularity of lox71 is that it has an altered sequence at the end of...']]"},{"machine":"BBa_K530008","videoId":"BBa_K530008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21C - [ Regulatory ] ['TDH3 Yeast Promoter...TDH3 Promoter is used to regulate the expression of genes within the genome of...This is the sequencing for colony 10. Both colony 1 and 10 were a perfect...match with the genomic DNA promoter.... iGEM Kyoto 2017 http 2017.igem.org Team Kyoto improved this part by...']]"},{"machine":"BBa_K851002","videoId":"BBa_K851002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21D - [ Regulatory ] ['pBAD pXyl is a combined promoter of D Xylose and L arabinose sugar sensor...systems which is designed to be activated only in the presence of both sugars...pXyl is an inducible promoter regulated by the transcriptional regulator XylR...In the presence of L arabinose expression from pBAD is turned on while the...repressing the promoter because the xylR binding sites corresponds to xylR of...An amount of 0.01 g ml of arabinose is enough for an increase of 4 times...the basal expression and the maximum production is approximately 5 times...Binding of AraC Protein to araI2 Activates the araBAD Operon Promoter. Proc....']]"},{"machine":"BBa_K554001","videoId":"BBa_K554001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21E - [ Regulatory,chassis, prokaryote, ecoli, Kit plates, probiotics, control ] ['flhDC promoter...flhDC promoter is a regulatory sequence found upstream the flhDC genes in...and activated transcription. Importantly this interaction is dependent on...flhDC promoter is used by UNICAMP EMSE Brazil...producing and secreting IL 12. The flhDC is essential to the functioning of...this device since it is responsible for the response induction being the...This part is shown in purple in the following schema ...']]"},{"machine":"BBa_K792009","videoId":"BBa_K792009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21F - [ Generator,chassis, eukaryote, yeast ] ['that is import enhanced thanks to a trojan peptide . This device is...intended to be used with Yeast chassis so it is composed by subparts... Payload this is the exported Histidine rich domain of the protein a His Tag ... Important note this part has been submitted to the registry using a...this part avoid direct contact with them or conditioned medium and discard...contact us for any question regarding this part. ...']]"},{"machine":"BBa_K554002","videoId":"BBa_K554002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21G - [ Coding,Kit plates, immune_regulation, devices ] ['The HlyA is a signal peptide found in the C terminal signal sequence of alpha ...hemolysin HlyA . It is used to target proteins for secretion via the Type I...it as a fusion protein that is attached to the interleukins such as IL 12 and...IL 10 and allows it to be secreted. Besides HlyA is itself a weak antigen ...target protein to be secreted is IL 12. ...A more realistic schema of ABC transport system is shown below ...The HlyA is a signal peptide found in the C terminal signal sequence of alpha ...hemolysin HlyA . It is used to target proteins for secretion via the Type I...the 14 strand antiparallel barrel there is a hydrophobic belt approximately...Hemolysin is a potential virulence factor produced by microorganisms which...use of the NLRP3 inflammasome which is responsible for inflammatory processes...']]"},{"machine":"BBa_K778003","videoId":"BBa_K778003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21H - [ DNA ] ['improved this part designing new stronger biobrick part that includes 8...']]"},{"machine":"BBa_K554003","videoId":"BBa_K554003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21I - [ Coding,Kit plates, immune_regulation, sense-control ] ['SoxR is a transcription factor found in bacteria and is activated during...superoxide or nitric oxide stress. SoxR protein in solution is a homodimer...transcription through binding at SoxS promoter. Thus in the presence of NO ...SoxR activates transcription of the gene regulated by SoxS promoter Hidalgo...The 2Fe 2S SoxR transcription factor a member of MerR family and is an...presence of superoxide and nitric oxide NO . SoxR is activated by reversible...activate transcription of genes containing SoxS promoter which have a long...the promoter DNA Watanabe et al. 2008 . The SoxR gene is used by UNICAMP ...senses NO levels and responds by producing and secreting IL 10 . This part is...protein bound to SoxS promoter DNA structure retrieved from PDB 2zhg ...Watanabe et al. 2008 . This is a jmol applet in which you can interactively...see part of the SoxS promoter bound to its regulatory protein SoxR in a 3D...The O2 superoxide radical is an ion that penetrates membranes poorly.... NO do cross lipid bilayers. NO is generated in short bursts for...survival was seen only after 4 h of phagocytosis when NO is being generated...Only Fe SoxR stimulated transcription in vitro from the soxS promoter up to...promoter but an allosteric effect that promotes open complex formation by...Studies showed that the 19 bp spacing is required for effective SoxR mediated...in vitro from a 180 bp wildtype promoter sequence Hidalgo et al. 1995 . A...similar analysis of the 149 bp promoter fragments using primer extension with...transcription from the wild type promoter active SoxR was not required for...transcription from the 18 bp spacing mutant promoter. Although apo SoxR did...not affect transcription from the pEH55 promoter detectably there was slight...Hidalgo E. Demple B. 1997 . Spacing of promoter elements regulates the...']]"},{"machine":"BBa_K805012","videoId":"BBa_K805012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21J - [ Coding ] ['Polyclonal antibody. Result of flow cytometry analysis is as follows ...vector is 1.14 with Ruxyn pPIC9k is 8.56....']]"},{"machine":"BBa_K554004","videoId":"BBa_K554004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21K - [ Coding,Kit plates, immune_regulation, inflammatory ] ['IL 10 is an anti inflammatory interleukin produced mainly by monocytes. It is...and the inflammatory response signals were reduced in 50 . IBD is an...This part is used by UNICAMP EMSE Brazil...senses NO levels and responds by producing and secreting IL 10. This part is...at 2.0 . This is a jmol applet in which you can interactively see the protein...IL 10 is a major immune regulatory cytokine that acts on many cells of the...excessive tissue disruption caused by inflammation. It is responsible for...IL 10 is also responsible for enhancing B cell survival proliferation and...limited sequence similarity it has been postulated that IL 10 is a member of...']]"},{"machine":"BBa_K805013","videoId":"BBa_K805013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21L - [ Coding ] []]"},{"machine":"BBa_K554000","videoId":"BBa_K554000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21M - [ Regulatory,Kit plates, immune_regulation, sense-control ] ['SoxS promoter...SoxS is a promoter regulated by the SoxR transcription factor which is...associated with SoxS promoter. Thus in the presence of NO ...gene regulated by SoxS promoter Hidalgo et al 1998 . The SoxS promoter is... This promoter is used by UNICAMP EMSE Brazil team http 2011.igem.org Team UNICAMP EMSE Brazil in the NO sensor device http 2011.igem.org Team UNICAMP EMSE Brazil Project Device2 Device 2 which senses NO levels and responds by producing and secreting IL 10. This part is shown in the red box in the following schema ... chain A and p40 chain B chains. This is a jmol applet in which you can...protein is a member of the AraC XylS family of transcriptional regulators....It is a pleiotropic regulator that binds many sites across the genome and...It has been shown that there is a rapid increase in transcription of soxS...repression is rapidly reinstated following removal of the stimuli. The pool of...pre produced transcriptional regulators is degraded by proteases including...membrane porin expression SoxS is important for initiating transcription of...regulator though it is not understood by which mechanism this is regulated....Binding of Fe SoxR to the wild type soxS promoter improved the subsequent...']]"},{"machine":"BBa_K737017","videoId":"BBa_K737017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21N - [ Coding ] ['This part conteins gvpC 20psi protein...This part conteins gvpA protein s coding sequence. This gene from Planktothrix...ligated on cloning vector pSB4A5 we didn t register this part. The gvpA...cl02594 . This gene is quiet conserved in most gvp s polycistron. According to...protein is a kind of small hydrophobic protein which forms the ribs of the...n a This part conteins gvpC 20psi protein...']]"},{"machine":"BBa_K554009","videoId":"BBa_K554009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21O - [ Coding ] ['This part was used to Device 3 testing Protein Secretion...TolC is part of the hemolysin secretion system Device 3 Protein Secretion...target protein to be secreted is IL 12. ...A more realistic schema of ABC transport system is shown below ...resolution. This is a jmol applet in which you can interactively see the...TolC is a specific outer membrane protein OMP and part of the hemolysin...bacteria and that must act in targets outside. TolC 55 kDa is a...TolC presents a new kind of OMP architecture. It is a trimeric protein ...into the periplasm. The molecule forms a tapering tube that is almost closed...proteins and is large enough to accommodate secondary structure elements or...It is studied that TolC operates together with the AcrAB proteins in the inner...indicated that tolC is required for survival in extremely acidic environments ...against oxidative stress indicating that TolC is involved in coping with...']]"},{"machine":"BBa_K747096","videoId":"BBa_K747096","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 21P - [ Regulatory,promoter ] ['CMV promoter At first we tried to use the CMV promotor that was included in...After numerous attempts to use this part we sequenced it and found out that...mammalian promoter was available on this year s distribution kit we designed...the following primers and amplified the CMV promoter from the vector pPhi ...After incorporation of these primers into the CMV promoter amplification...product the promoter is not only flanked by the iGEM prefix and suffix but...of this part done by the 2018 iGEM Calgary team. A SalI restriction site... sequence GTCGAC was added to the 5 end of the promoter which allows for...the promoter to be used within the 2018 iGEM Calgary s Multiple Cloning Site... promoter...']]"},{"machine":"BBa_K823008","videoId":"BBa_K823008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22A - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23106...Anderson promoter J23106 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K642002","videoId":"BBa_K642002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22B - [ Coding ] ['This is the cI repressor from phage lambda tagged with yeast codon optimized...']]"},{"machine":"BBa_K823009","videoId":"BBa_K823009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22C - [ Regulatory,chassis, prokaryote, bsubtilis, regulation, constitutive ] ['Anderson promoter J23107...Anderson promoter J23107 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ...']]"},{"machine":"BBa_K624001","videoId":"BBa_K624001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22D - [ Coding ] ['This part is composed of tetR and gfp ....microscope. The left graph is from the control group of E. coli strain DH5a....The middle is tetR RBS GFP in plasmid c3 in E. coli while the right is...time. Construct of tetR RBS GFP which emits light is thought to be a leak...correct and further sequencing work is under operation....The expression of GFP is measured precisely under excitation wavelength from...group surging far beyond normal condition. Thus 493nm is suggested as the...']]"},{"machine":"BBa_K823010","videoId":"BBa_K823010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22E - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23113...Anderson promoter J23113 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K581012","videoId":"BBa_K581012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22F - [ Coding ] [' promoter qrr was amplified by DNAWorks...']]"},{"machine":"BBa_K823011","videoId":"BBa_K823011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22G - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23114...Anderson promoter J23114 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K539623","videoId":"BBa_K539623","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22H - [ Intermediate ] []]"},{"machine":"BBa_K823012","videoId":"BBa_K823012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22I - [ Regulatory ] ['Anderson promoter J23115...Anderson promoter J23115 with two nucleotides different to the original...Anderson promoter sequence from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ...']]"},{"machine":"BBa_K539626","videoId":"BBa_K539626","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22J - [ Intermediate ] []]"},{"machine":"BBa_K823013","videoId":"BBa_K823013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22K - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23117...Anderson promoter J23117 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K539642","videoId":"BBa_K539642","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22L - [ Intermediate ] []]"},{"machine":"BBa_K823014","videoId":"BBa_K823014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22M - [ Regulatory,chassis, prokaryote, ecoli, chassis, prokaryote, subtilis, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Anderson promoter J23118...Anderson promoter J23118 from the Anderson...vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux ...The first group of promoters evaluated are the promoters of the Anderson...Anderson promoters were characterized in B. subtilis with the lux operon...as a reporter. In B. subtilis these promoters show quiet low activity. To...confirm these results some Anderson promoters were also evaluated with the...Here you can see the list with the Anderson promoters characterized in B....Eleven of the nineteen promoters of the Anderson...the BioBrickBox containing the lux operon as a reporter for promoter...activity. The promoter activity leads to the expression of the lux operon... Fig. 1 Luminescence measurement of Anderson promoters in the reporter...All clones show a usual growth behaviour. The activity of the promoters...reaches from 200Lumi OD600 promoter J23115 to a maximum of 1500 Lumi OD600...for the strongest promoter J23101 . Afterwards the activity goes down to the...promoter activity. One clone of J23107 and J23114 shows significantly lower...promoter activity. Therefore additional clones should be measured. In...comparison to all the other evaluated Bacillus promoters these Anderson...promoters showed a very low acitivity in B. subtilis ....promoters of the Anderson Kit plate were cloned into the reporter vector pSB...of the strength of these promoters in B. subtilis Fig. 2 . The...promoter.png wiki images thumb a a0 Beta gal anderson promoter.png 400px ...Beta gal anderson promoter.png File Beta gal anderson promoter.png ...promoters J23100 J23102 J23103 J23106 in B. subtilis . Results derive from...Verification of the promoter activity by galactosidase assays revealed that...the Anderson promoters do not seem to be as weak as measured by luminescence... Fig. 1 . For direct comparison we should measure a constitutive promoter ...This part is a modified BioBrick. We got the DNA from the Partsregistry ... promoter anderson ...']]"},{"machine":"BBa_K539641","videoId":"BBa_K539641","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22N - [ Intermediate ] []]"},{"machine":"BBa_K774000","videoId":"BBa_K774000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22O - [ Regulatory,promoter ] [' 1 PyeaR CArG nitric oxide nitrate nitrite sensing hybrid Bacterial Mammalian promoter...Mammalian promoter...further by ligating it to its mammalian counterpart CArG promoter sequence...NdeI were added between the 2 promoters. The genes were synthesised in two...of the PyeaR promoter so that it could be used in both mammalian and bacterial...systems. This is something that we thought was important as sensing nitric...carried out by ligating the promoters to fluorescent reporters and studying...transformation with the bacterial mammalian promoter as well as the...promoters on its growth over time. The promoters E.coli was transformed with...were PyeaR M B and B M. These promoters all react to nitrogenous species. By...comparison between all three of these promoters on the growth of E.coli . To...see if the presence of novel promoters caused any significant changes in...have been transformed will be referred to as the promoter with which they were...the absorbances ranges within 0.005 so the range is actually 0.3 0.1. The...that there is little difference between the growth rates. Using statistical...For this sample the sequencing data is exactly as predicted. ... promoter...']]"},{"machine":"BBa_K539643","videoId":"BBa_K539643","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 22P - [ Intermediate ] []]"},{"machine":"BBa_K517000","videoId":"BBa_K517000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23A - [ Regulatory ] ['GAL galactose inducible yeast promoter...Promoter can be induced for gene expression when exposed to galactose in the...Reference This promoter is commonly used in several yeast vectors including...The GPD promoter...promoter... FACS Analysis of GFP expression as regulated by GPD and GAL Promoters... wiki images a a9 Ubcigem2011Promoterfacs.jpg File Ubcigem2011Promoterfacs.jpg ... FACS Analysis of GFP expression as regulated by GPD and GAL Promoters S....in SC raffinose instead of YPD dextrose media which is expected since...dextrose is known to more strongly repress the GAL promoter....Promoters... wiki images 8 8e Ubcigem2011Promoterimages0.jpg File Ubcigem2011Promoterimages0.jpg ...Promoters S. cerevisiae yeast strains containing either the GPD GFP or...GPD promoter results in constitutive high expression while the GAL promoter is...']]"},{"machine":"BBa_K143012","videoId":"BBa_K143012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23B - [ Regulatory,rnap, prokaryote, subtilis, sigmaA, direction, forward, chassis, prokaryote, bsubtilis, promoter, regulation, constitutive ] [' Promoter veg Constitutive Promoter for B. subtilis ...Pveg is a constitutive promoter that constitutively expresses the P43 protein...sites to cause high expression of genes 2 however this Pveg is lacking the...it is not known how 3. The context with which we used the promoter Pveg is as... promoter ...']]"},{"machine":"BBa_K517001","videoId":"BBa_K517001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23C - [ Regulatory ] ['GPD constitutive yeast promoter...Promoter for constitutively high expression....Reference This promoter is commonly used in several yeast vectors including...The GPD promoter...promoter... FACS Analysis of GFP expression as regulated by GPD and GAL Promoters... wiki images a a9 Ubcigem2011Promoterfacs.jpg File Ubcigem2011Promoterfacs.jpg ... FACS Analysis of GFP expression as regulated by GPD and GAL Promoters S....in SC raffinose instead of YPD dextrose media which is expected since...dextrose is known to more strongly repress the GAL promoter....Promoters... wiki images 8 8e Ubcigem2011Promoterimages0.jpg File Ubcigem2011Promoterimages0.jpg ...Promoters S. cerevisiae yeast strains containing either the GPD GFP or...GPD promoter results in constitutive high expression while the GAL promoter is...We used this promoter in order to express long hairpin RNA in yeast. Long...downstream of the promoter and introduced into the 2 micron high copy number...As a result it was revealed that the constitutive GPD promoter had low RNA...expression from Gal1promoter. We conducted another experiment with a longer...500 bp promoter which contains this GPD promoter sequence we used TDH3...it was confirmed that the longer promoter has stronger expression. Therefore... iGEM Kyoto 2017 http 2017.igem.org Team Kyoto has modified this part...In order to kill pine wood nematodes by feeding RNAi we used this part as a...promoter to express hairpin dsRNA in yeast. Then we confirmed the expression...We attached a hairpin loop sequence to this part so that you can easily make...between the promoter and loop parts then cleaving with the restriction enzyme...']]"},{"machine":"BBa_K813000","videoId":"BBa_K813000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23D - [ Other ] []]"},{"machine":"BBa_K656010","videoId":"BBa_K656010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23E - [ Regulatory ] ['Anabaena pSac Promoter...Anabaena vegetative cell promoter linked to photosystem I. Can be used to...This promoter sequence is derived from a region upstream of the pSac operon in...Anabaena 7120. The operon belongs to photosystem I therefore the promoter s...activity is effectively constitutive in that organism in growth conditions....control of the pSac promoter but the heterocyst cells will not....Transformed Anabaena carrying a GFP reporter controlled by psaC promoter part...Transformed Anabaena carrying a GFP reporter controlled by psaC promoter part...']]"},{"machine":"BBa_K813001","videoId":"BBa_K813001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23F - [ Other ] []]"},{"machine":"BBa_K577006","videoId":"BBa_K577006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23G - [ Reporter ] ['This is device that includes an inducible promoter but requires the insertion...of AraC to be able to induce the promoter with arabinose....']]"},{"machine":"BBa_K813002","videoId":"BBa_K813002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23H - [ Other ] []]"},{"machine":"BBa_K577004","videoId":"BBa_K577004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23I - [ Reporter ] []]"},{"machine":"BBa_K576004","videoId":"BBa_K576004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23J - [ RNA ] []]"},{"machine":"BBa_K620000","videoId":"BBa_K620000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23K - [ Coding ] ['Also known as Glutathione S transferase 1 1 this protein is supposed to...GCMS. There is a peak at 105 g mol and a peak at 133 g mol....GCMS. There is a peak at 191g mol and a peak at 206 g mol...enzyme File DDT blank.jpg File DDT blank.jpg there is a clear band at...235 g mol. DDT s molar mass is 355. This indicates that the original... File MSDDT205.png . There is another mass spec band in this reading at 191...']]"},{"machine":"BBa_K576006","videoId":"BBa_K576006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 23L - [ Reporter ] []]"},{"machine":"BBa_J04450","videoId":"BBa_J04450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24P - [ Reporter,cds, reporter, chromoprotein, classic, reporter, pret, function, reporter, color, function, reporter, pigment ] ['contain a degradation tag and the RBS is strong....LacI and induced by IPGT. Plac is one of the most common promoter in life...science research field. It is mainly composed of Lac operon containing LacO...the binding of RNA polymerase to the promoter. So the expression of downstream...genes is blocked. Serving as inducer IPTG can bind with LacI repressor ...making the latter s conformation changes so LacI is detached from LacO site ...generator driven by Plac promoter however there is no LacI gene in it....Although the E. coli could express some LacI it is not enough for inhibition...promoter. It contains LacI gene which can lower significantly the RFP leakage...expression so that no excessive LacI expression which is considered as waste...identification result is showed in Fig.1. ...fluorescent intensity is fluorescence per OD600 standardized with fluorescence...leakage expression is very low and it is sensitive to the IPTG induction. ...induction. Relative fluorescent intensity is fluorescence per OD600...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...very sensitive to the IPTG induction and the RFP leakage expression is very... 4. Add 100 l bacteria culture medium into a sterile 96 well plate. IPTG is added to final concentrations of 1 2 5 10mM. M9 medium is the blank control. The colony without RFP expression is the negative control....This part is commonly used but can fail if the system contains LacI or CAP... Team TU Munich 2012 http 2012.igem.org Team TU Munich improved this part... Team Warwick 2015 http 2015.igem.org Team Warwick improved this part by...characterisation of this part by showing equal functionality in simulated...contributed to the characterisation of this part by testing the time of...apparition of fluorescence in presence of IPTG or not because the promoter...leaks as well as they contributed to the improvement of this part by using...contributed to the characterization of this part by showing decreased...contributed to the characterization of this part by analyzing the rate of...contributed to the characterisation of this part by testing the delay before...contributed to the characterisation of this part by testing the fluorescence...part by replacing the induced promoter lacI with the strong constitutive pf 5...promoter PampC. see ...Alpes Contribution contributed to the characterisation of this part by...testing the effect of cAMP on the promoter s leakages and protein expression...charazterization of this part by testing the effect of different media...the characterization of this part by introducing it in Trans10 to observe its...contributed to the charazterization of this part by testing the effects of...characterization of this part by testing the effect of glucose on the protein...contributed to characterization of this part by testing radiation tolerance of...replication that could explain this effect. This part is a reversion of this...successfully produce colonies. In these results is the negative control...plate streaked with pSB1C3 containing J04450 RFP . This is the most...origin which has expression in vibrio. However pGGA is not compatible with...plasmid per genome. These values indicate that K3445002 is effective in both...in a plasmid that is still capable of replication in E. coli but now also...Escherichia coli Nissle 1917 EcN is widely used as a probiotic since it s...contains a CAP sensitive promoter and glucose can inhibit its expression. ...We then investigate whether this phenomenon is influenced by the strain and...amount of IPTG added for respective treatment is 500 M. ... The red color absorbance under 588 nm wavelength is recorded around 2.5 3 OD units....the role of RBS and Promoter parts in giving rise to intrinsic noise in E....of this part as a cloning tool. When ligating any part or part assembly into...any standard backbone that contains this part the non restricted and single ...insert the size of the BioBrick insert and whether the insert is an assembly...we characterized its expression under lac promoter. We did the transformation...Violaceum competent cells with the protocol that is in our wiki we concluded...that the best O.D. for the heat shock transformation is 0.5 since it showed...expression. This part is useful for characterizing the expression of different...proteins using the lacI sensitive promoter. For better application of this...promoter in controlling protein expression the effects of different hosts...fluorescence intensity at different temperature is much higher than those of...leak appeared in 34 oC. This finding is different from our expectation where...medium containing flask is significantly higher than others indicating that...oxygen is an important factor which will affect the protein expressin and cell...by using different IPTG induction Fig 3 . However it is interesting that the...driven by PrplJ promoter and expressed in DH10B. In addition we also applied...weaker E.coli endogenous promoters PdapA and PcaiF Figure 1 ....PcaiF promoter....However it is difficult for us to perform additional experiments with... The goal was to characterize the effect of cAMP on the promoter s leakages...without production of cAMP. BTH101 strain is streptomycin resistant. ...inducible promoter lactose promoter to create an auto amplifier system. ...It is apparent that without IPTG there is a visible difference between strains...the leakage of the promoter. ...data suggest that the promoter does not leak in that condition. ...lactose promoter has almost no leakage suggesting that the leakage of the...lactose promoter is due to cAMP in absence of IPTG. When the cAMP production...is restored the promoter is activated and the protein is expressed. It is also...expression if no IPTG is added. ...SHuffle strains. In order to test this lacI regulated promoter in our chassis ...functionality of the promoter. Protein expression was analysed through an SDS ...leakiness in the promoter. IPTG concentrations were chosen based on conditions...worked previously when using a T7 promoter 0.2 mM and recommendations of the...show bands if the promoter lacked leakiness nevertheless a faint band can be...stronger bands compared to the uninduced control. Thus the promoter is...promoter....and have been excluded. In case of 532 605 the noise is disturbing the...EcN. The lag phase is shorter compared to the other two media while the...logarithmic phase is longer. In TB Media the lag phase is extended and the...growth is not as high as before but still exhibits a clear logarithmic phase....In sharp contrast to that the lag phase in LB Media is almost double and the...exponential phase is quite brief. These results are expected since the media...the RFP production in LB is significantly lower. For E. coli BL21 DE3 Figure...lowest RFP levels. The expression in LB media is only slightly higher than in...Enriched media. The protein expression in TB Media however is notably higher...the control of a lactose promoter is a good alternative to produce inducible...could divide 24h into three different growth phases 0 2h is lag phase 2 15h...is an exponential phase 15 24 is a stationary phase. ...spectra for mCherry ranges from 551 nm to 800 nm. There is an overlap of 77 nm...each fluorescent protein is accurate....showed the highest fluorescence readings. This is probably because cell...concentration of 87 5 which is 3 5 times higher than the recommended...We transformed the plasmid which RFP is inserted in psB1C3 into DH5 and...We transformed DH5 with the plasmid which RFP is inserted in psB1C3 and... At first the cells are cultured in liquid medium and the medium is replaced...with Butterfield s Phosphate Buffer BPB . This is because when the gamma ray...versus 10 Gy. From this result we concluded that E. coli is highly...sensitive to gamma irradiation when it is irradiated with 50 and more doses of...This graph shows that the number of cells is significantly reduced with...']]"},{"machine":"BBa_K539651","videoId":"BBa_K539651","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24B - [ Generator ] ['promoter lacI regulated a RBS B0032 Alss with a RBS B0030 ilvC...n a promoter lacI regulated a RBS B0032 Alss with a RBS B0030 ilvC...']]"},{"machine":"BBa_K847061","videoId":"BBa_K847061","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24C - [ Coding,chassis, prokaryote, ecoli ] [' Saccharomyces cerevisiae baker s yeast is remarkably resistant to...']]"},{"machine":"BBa_K539672","videoId":"BBa_K539672","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24D - [ Generator ] ['promoter lacI regulated RBS Alss with a RBS B0032 ilvC a RBS B0032 ilvD...n a promoter lacI regulated RBS Alss with a RBS B0032 ilvC a RBS...']]"},{"machine":"BBa_K847004","videoId":"BBa_K847004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24E - [ Coding,chassis, prokaryote, ecoli ] [' Deinococcus radiodurans is an extremely radiation resistant bacterium while...']]"},{"machine":"BBa_K539621","videoId":"BBa_K539621","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24F - [ Intermediate ] []]"},{"machine":"BBa_K731000","videoId":"BBa_K731000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24G - [ Coding ] ['CysE is an enzyme involved in cysteine biosynthesis also known as SAT. It...the biosynthesis of cysteine. Some O acetylserine is also converted to...This part has been successfully operated while controlled by araC pBAD both in...This part was cloned by the iGEM Trento 2012 team for the creation of an...marble stones. Further information about this part and its characterization...In Escherichia coli conversion of L serine to L cysteine is mediated by the...of L serine by acetyl CoA. Its product 0 acetyl L serine OAS is then...uptake and reduction is regulated by induction as well as by repression 2 ....documentation on characterization of this Part.... Then 0.7 ml 95 ethanol is added in each centrifuge tubes and mixed thoroughly. A reagent blank without cysteine is prepared under the same condition. ... The pipette is used to shift 200 microliter solutions of each mixture to 96 well plates so that solution can be tested by infinite 200Pro spectrophotometer with light absorption at 560 nm.... 0.1 ml supernatant of each EcN solution is taken from Deep well Multiwell Plate and added to 1.5 ml centrifuge tubes respectively. The same operation is repeated as testing standard samples and then use spectrophotometer with light absorption at 560 nm to test the concentration of cysteine in the solutions....']]"},{"machine":"BBa_K539627","videoId":"BBa_K539627","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24H - [ Intermediate ] []]"},{"machine":"BBa_K731010","videoId":"BBa_K731010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24I - [ Coding ] ['CysE is an enzyme involved In cysteine biosynthesis also known as SAT. It...precursor. Some O acetylserine is also converted to N acetylserine which in...M256I CysE shows enhanced secretion of cysteine and is not inhibited by...This part has been successfully operated while controlled by araC pBAD both in...This part was cloned by the iGEM Trento 2012 team for the creation of an...marble stones. Further information about this part and its characterization...In Escherichia coli conversion of L serine to L cysteine is mediated by the...of L serine by acetyl CoA. Its product 0 acetyl L serine OAS is then...uptake and reduction is regulated by induction as well as by repression 2 ....the medium.This particular mutant thus would overproduce cysteine ...documentation on characterization of this Part....']]"},{"machine":"BBa_K539731","videoId":"BBa_K539731","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24J - [ Generator ] ['kivd alpha ketoisovalerate decarboxylase under TetR repressible promoter...This is the coding sequence of kivd from Lactococcus lactis subsp. It encodes...alpha ketoisovalerate decarboxylase which is responsible for the...pathway. This part kivd is under TetR repressible promoter that...']]"},{"machine":"BBa_K731721","videoId":"BBa_K731721","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24K - [ Terminator ] [' 0.008 with T7 promoter 0.80 0.01 with Ptac...The characterization of this part was done by the Trento iGEM team 2012 using...mVenus was excitated at 485 nm excitation peak is at 515 nm and the...mCherry was read at 615 nm as opposed to the maximum at 609 nm. Here is a...The activity of this part was analyzed both with T7 and E. coli RNA... Vs is the A206K Venus peak s intensity of the construct with the terminator of interest inserted in the prefix suffix linker ... Vc is the A206K Venus peak s intensity of the control construct without intervening terminator ... Cs is the mCherry peak s intensity of the construct with the terminator inserted ... Cc is the mCherry peak s intensity of the control construct ...T7 lysozyme is a natural inhibitor of T7 RNA polymerase activity thus...behind a lacUV5 promoter....It is worth to highlight that the apparent and the raw transcriptional...termination efficiency is determined just by the expression of the downstream...0.008 with T7 promoter 0.80 0.01 with Ptac... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be... 0.008 with T7 promoter 0.80 0.01 with Ptac...']]"},{"machine":"BBa_K539742","videoId":"BBa_K539742","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 1, 24L - [ Composite ] ['The part is built in kivd and TetR repressible promoter that constitutively ON...coding sequence of kivd is from Lactococcus lactis subsp. It encodes alpha ...ketoisovalerate decarboxylase which is responsible for the decarboxylation...In traditional genetic engineering method Figure 1 we use strong promoter to...This is also a problem in the production of isobutanol which is poisonous to...advantage of our new method is that the precursors are much less toxic for...get through biosynthetic pathway and we can harvest isobutanol which is the... which is inserted in pSB4A5 into DH5 and EPI300 and collect the bacteria...After the analysis of GC we find out that DH5 is much better than EPI300 for... Figure 4. This diagram indicates that DH5 is very suitable for this...We construct two devices. The first one is normal butanol synthetic device...temperature. However the tendency is much more significant in low temperature...']]"},{"machine":"BBa_K649303","videoId":"BBa_K649303","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3A - [ Generator ] ['This work is done by Yuto Sugiuchi....']"},{"machine":"BBa_B0012","videoId":"BBa_B0012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1B - [ Terminator,direction, forward, terminator, single ] [' This is a bad terminator ... It is a promoter in the reverse direction. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...Protein anti CRISPR associated 1 Aca1 is expressed by T7 promoter Aca1 will...subsequently inhibit the anti CRISPR promoter so the gene expression...inhibit Aca1 found by SUSTech Shenzhen is added artificially. Without the...inhibition from Aca1 the expression of genes downstream anti CRISPR promoter...We characterised the efficiency of this part of terminating an inhibitor and a...intensity in the composite part using this terminator is measured ...']"},{"machine":"BBa_K598014","videoId":"BBa_K598014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1C - [ Device,chassis, prokaryote, ecoli, direction, forward, plasmidbackbone, copynumber, high ] ['It is the positive control of the theophylline inducing experiment. For... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_B0013","videoId":"BBa_B0013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1D - [ Terminator,direction, forward, terminator, single ] [' But notice that the measurement indicates it is a strong promoter in the reverse direction.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K598019","videoId":"BBa_K598019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1E - [ Device,chassis, prokaryote, ecoli, direction, forward, plasmidbackbone, copynumber, high, regulation, negative ] ['This part was constructed to demonstrate the applicability of RNA toolkit...applications. Besides this biosynthetic pathway is more characterized ...our project four enzymes are involved Fig. 1 . VioA is an FAD dependent...increase as TPP is added to the culture Fig.2B . Similarly increasing the...']"},{"machine":"BBa_B0023","videoId":"BBa_B0023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1F - [ Terminator,direction, reverse, terminator, single ] [' This part is the reverse of terminator B0013 a bacteriophage T7 terminator which was engineered to be bidirectional. Contains a poly A insertion upstream of a 20 bp stem loop.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K598020","videoId":"BBa_K598020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1G - [ Device,chassis, prokaryote, ecoli, direction, forward, plasmidbackbone, copynumber, high, regulation, negative ] ['applications. Besides this biosynthetic pathway is more characterized ...our project four enzymes are involved Fig. 1 . VioA is an FAD dependent...increase as TPP is added to the culture Fig.2B . Similarly increasing the...']"},{"machine":"BBa_B0031","videoId":"BBa_B0031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1H - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['Registry and two consitutive Anderson Family Promoters... Galactosidase is an enzyme that is commonly used as a reporter marker to...monitor gene expression. It is encoded by the LacZ gene and its function in...the cell is to cleave lactose to glucose and galactose. Galactosidase assay...splits into two peptides LacZ and LacZ neither of which is active by...DH5 and XL1 Blue the mutated LacZ fragment is naturally found in the...bacterial genome so when a vector containing the LacZ fragment is inserted...o nitrophenyl beta d galactopyranoside ONPG . This synthetic compound is also...ONPG is in excess over the enzyme in a reaction the production of...o nitrophenol per unit time is proportional to the concentration of beta ...function is immediately related to gene expression....Constructs containing the universal promoter were followed by the rest of the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K567001","videoId":"BBa_K567001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1I - [ Composite ] ['The tRNAArg is under the control of promoter trc. tRNAArg expression is...This part is used to control the translation process by over expressing...In this part we have overexpressed rare tRNAArg AGG in the cell. The rare tRNA...tRNAArg AGG is over expressed under the control of trc promoter induced by... Over expressed tRNA Arg AGG is charged by native Arginyl tRNA... Over expressed tRNA Arg AGG is charged by native Arginyl tRNA...When rare tRNAArg AGG is not over expressed RFP expression is hindered. When...tRNAArg AGG is over expressed this tRNA can recognize the AGG codon on the...mRNA so a large amount of RFP is produced....In this part we want to explore the influence of the number of rare codons...after the start codon in luciferase gene. T7 promoter or bla promoter 1 are...number of AGG codons and strength of promoters to characterize regulation 1 ....1 bla promoter luciferase weaker promoter ...A tandem of 2 4 6 or 8 AGG codons is inserted after the ATG codon of wild...2 T7 promoter luciferase stronger promoter ...A tandem of 2 4 6 or 8 AGG codons is inserted after the ATG codon of wild...biosynthesis is shown below ... Influence of different strengths of target protein promoters...We examined the influence of different Reporter promoters on the working curve...of our device which is reflected by luciferase activity. The working range of...our device is pre defined by the strength of target protein promoter T7...promoter and bla promoter in our project....rare tRNA with lacI Ptrc tRNAArg. Luciferase production is reflected by...strong weak promoter in luciferase production. Strong promoter T7 of target...under strong target protein promoters....Experiment results showed that when there is 111bp interval between the two ...copy 4AGG background is lower than there is a 30bp interval. In another... Fig.6 A. When there is 111bp interval between the two copy 4AGG background...is lower than there is a 30bp interval. B. Protein production can be induced...Ulrich Deuschlel. et al. Promoters of Escherichia coli a hierarchy of in...']"},{"machine":"BBa_B0032","videoId":"BBa_B0032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1J - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to...Global non modularity towards promoters protein coding parts and relative...Characterization of this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter coding... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K567008","videoId":"BBa_K567008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1K - [ Reporter,cds, enzyme ] ['This biobrick is constructed by putting modified enzyme luciferase under...promoter T7 and controlled by lac operator. 2 AGG codons and 2 GCG codons are...oxyluciferin during which bioluminescence will emit. This part is one of the...regulating protein biosynthesis. This part is used as a measurement to testify...liquid medium. When the OD600 of the culture reaches 0.3 IPTG is added to make... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_B0033","videoId":"BBa_B0033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1L - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['is the weakest and whose RBS strength is 0.35 of...number of purines in the RBS sequence which is beneficial to the binding of... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K567015","videoId":"BBa_K567015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1M - [ Translational_Unit,cds, enzyme ] ['T7 promoter metG truncated . This biobrick is constructed by putting the...truncated metG MetRS under the control of T7 promoter and lac operator. We...truncated. KanR gene with start codon substituted for CGA is used to testify...recognition domain. The structure of the truncated protein is shown below....Fig. This design is based on the crystal structure of methionyl tRNA...structure after kinetics optimization. Above is the picture showing E.coli ...recognition domain is deleted thus losing anticodon specificity while...transformed into the cell the cell is expected to survive Kanamycin. We...For more information concerning this part please see 2011 SJTU BioX ...without the anticodon recognition domain. We have improved this part by... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_C0012","videoId":"BBa_C0012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1N - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['improve the switch time for High to Low performance of this part....This particular LacI protein was derived from E. coli and contributed by...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...that the biobrick part is not of potential allergen status. In 80 amino acid...this biobrick. This also means that there is not of potential allergen status....BioBrick part also has 4 possible internal priming site between this part and...site is on the 207 214 base number of the BioBrick and on the 1 8 base number...of the VF2 primer. The first location of the internal priming site is on the...primer. The second location of the internal priming site is on the 947 941...third location of the internal priming site is on the 778 784 base number of...of the internal priming site is on the 1015 1021 base number of the BioBrick...intensity is fluorescence per OD600 standardized with fluorescence per OD600... 4. four Add 100 l bacteria culture medium into a sterile 96 well plate. Add IPTG to final concentrations of 0 1 5 10 20 mM. Fresh M9 medium serves as blank control. Positive control is colony constantly expressing sfGFP and negative control is colony without sfGFP expression. Place the 96 well plate into an automatic microplate reader. Incubate at 16 overnight and record the fluorometric value at 510 nm and OD600 for each well every 30 minutes....According to our experiment our Lac operon is improved in the following three...from lac operator which means that it is induced in a relatively low but... Figure 1 is the measurement of the fluorescence of EGFP controlled by wild ...type and improved Lac operon. It shows that when 4mM arabinose is added ...oLacI wild type LacI is induced at a significantly high level while...iLacI improved LacI is induced at a lower level....LacI and inducers or under different promoters. The origin point indicates...The title of the graph shows which kind of inducer is added to the culture....wavelength 485 nm detection wavelength 528 nm is quantified by the...promoter constitutes a LacO sequence. Control is the negative control plasmid... Figure 2 is the measurement of the fluorescence of EGFP controlled by wild ...type and improved Lac operon. It shows that when 1mM IPTG is added EGFP...promoters. The induction level is calculated by dividing the fluorescence...our improved version of LacI. LacO indicates that the promoter constitutes a...The uninduced leakage level is also an important parameter of an operon....figure below Figure 3 is the measurement of the fluorescence of EGFP...added the fluorescence of EGFP controlled by improved Lac operon is under the...with no inducer in the culture. The fluorescence level is quantified as in...version of LacI. Control is below the detection level and not shown. Error bar... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...This operator can not only be used in prokaryotic promoters but also in...eukaryotic promoters when inserted downstream of TATA box....promoter ...1.If a lac operator site lacO is positioned appropriately downstream of the...TATA box gene expression from a nmt lacO promoter hybrid promoter can be...2.Insertion of the operator sequence into the nmt promoter 5 bp downstream of...promoter. Yeast. 2015 Jun 32 6 469 78. doi 10.1002 yea.3073. Epub 2015 Mar...']"},{"machine":"BBa_K567018","videoId":"BBa_K567018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1O - [ Reporter ] ['GFP and RFP linked with a flexible chain and a stop codon TAG is inserted in...the flexible chain. This biobrick is under the control of T7 promoter and lac...promoter controlling the expression of T7 RNA Polymerase. The GFP in this part...significant leaky expression of GFP. This is likely due to the fact that this...expression of T7 RNAP. As such significant amounts of T7 RNAP is present in... Figure 2. Plates with E. coli containing this part visualized under...from this picture even with no IPTG induction this part causes cells with...Expanded genetic code is a technique where one of an organism s codons for...example a stop codon is reprogrammed to code for a non canonnical amino acid...a tRNA synthetase with ncAA recognizing TAG codons is expressed. Also...able to produce the reporter which is why we ordered just the GFP TAG RFP...and 1 of arabinose which is probably the point where the pAzF tRNA...production is optimal....0 5 arabinose there is not that much difference in the effect of IPTG... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_C0040","videoId":"BBa_C0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 1P - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...the biobrick part is not of potential allergen status. In the 80 amino acid...initiation phase including ribosome binding of translation is the rate ...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K909007","videoId":"BBa_K909007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2A - [ Protein_Domain,proteindomain, dnabinding ] ['to bind TetR responsive promoter efficiently and unable to repress...restores TetR DBD promoter binding.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S03156","videoId":"BBa_S03156","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2B - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K777113","videoId":"BBa_K777113","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2C - [ Coding,cds, membrane, chassis, prokaryote, ecoli, function, motility ] []"},{"machine":"BBa_E0036","videoId":"BBa_E0036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2D - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K777117","videoId":"BBa_K777117","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2E - [ Coding,cds, membrane, chassis, prokaryote, ecoli, function, motility ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E0024","videoId":"BBa_E0024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2F - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K812032","videoId":"BBa_K812032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2G - [ Reporter ] ['Tadpole 1 is 2 days stage 36 38 the expression of CFP is localized in...intestine. Tadpole 2 is 4 days stage 45 46 the expression of CFP is... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E0026","videoId":"BBa_E0026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2H - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K936013","videoId":"BBa_K936013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2I - [ Composite ] ['in this part most likely exhibits its intended function as an esterase....length corresponding to cutinase 30 kDa is being secreted from the cell. ...measured by the absorbance at 405 nm. It is clearly shown that the activity of...cells expressing cutinase is much higher the background negative control .... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E0034","videoId":"BBa_E0034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2J - [ Reporter,function, reporter, function, reporter, fluorescence ] ['the same promoter and terminator connected GFP. Culture the E. coli in 5 mL...1 . We successfully connected the gene fragment between the promoter and...fluorescence but the fluorescence is very weak....in the same vector with the same promoter and terminator. The fluorescent...From the curve we can see that using these two promoter and terminator the...We are not sure if it can express higher using other promoter and terminator....GFP using the same promoter and terminator E0034 and E0032 has a very low...level of expression. Other promoters and terminators are not tried this...conclusion is only based on the results of this experiment.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K936000","videoId":"BBa_K936000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2K - [ Coding ] ['This is the LC Cutinase gene used to break PET into terephthalic acid and...ethylene glycol. The enzyme Cutinase is a lypolytic esterolytic enzyme that...degrades cutin which is found in most plant and fungi cuticles. They enzyme...itself is more commonly found in plants and bacteria. Cutinase also can...It should be noted that ethylene glycol is moderately toxic to humans and...in this part most likely exhibits its intended function as an esterase....length corresponding to cutinase 30 kDa is being secreted from the cell. ...measured by the absorbance at 405 nm. It is clearly shown that the activity of...cells expressing cutinase is much higher the background negative control . ...Mono 2 hydroxyethyl terephthalate MHET is an immediate product of PET...This data illustrates that cutinase is clearly performing its function of...leading to the conclusion that this difference is a result of MHET produced...and LC Cutinase is effectively degrading PET.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_C0160","videoId":"BBa_C0160","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2L - [ Coding,cds, cds, enzyme, function, cellsignalling, function, degradation, ahl ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...they are frequently used to decide whether the enzyme is good or not...according to specific situation. And what is also important is the conditions... 4 The organic layer is separated collected and dried using anhydrous sodium... 6 The residue is reconstituted in chromatographic grade methanol... 7 The sample is analyzed by HPLC to quantify the AHL concentration in the...14 . Decide whether the enzyme is suitable for our project...']"},{"machine":"BBa_K876000","videoId":"BBa_K876000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2M - [ Composite ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E5501","videoId":"BBa_E5501","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2N - [ Translational_Unit,classic, composite, uncategorized ] []"},{"machine":"BBa_K773002","videoId":"BBa_K773002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2O - [ Coding ] ['This part carries the gene for a proteorhodopsin pump which can generate a...This part was improved by Silvia Galvan of the iGEM UniTN Trento 2015 team....This part was previously found by other users to not express protein nor...produce ATP. We improved this part by adding a strong RBS and using a...different inducible promoter arabinose araC pBAD . We were able to express...experience page of this part to see our data.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_E5503","videoId":"BBa_E5503","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 2P - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_C0051","videoId":"BBa_C0051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3B - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['An alternate version of this part is available without a barcode ...site is on the 606 599 base number of the BioBrick and on the 4 11 base number...of the VF2 primer. The the second location of the internal priming site is on...primer. The third location of the internal priming site is on the 484 490 base...final location of the internal priming site is on the 214 208 base number of...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K519030","videoId":"BBa_K519030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3C - [ Composite ] ['This part consists of photocontrol genes ho1 pcyA and cph8....']"},{"machine":"BBa_C0052","videoId":"BBa_C0052","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3D - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['The 434 cI repressor protein coding sequence is a 710 base pair sequence with...434 cI is a member of the lamboid cI protein family....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K574005","videoId":"BBa_K574005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3E - [ Signalling,classic, signalling, sender, function, cellsignalling ] ['3OC12HSL is under the control of pBad ...']"},{"machine":"BBa_C0053","videoId":"BBa_C0053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3F - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['The P22 c2 repressor protein coding sequence is a 720 base pair sequence with...P22 c2 is a member of the lamboid cI protein family....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K574006","videoId":"BBa_K574006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3G - [ Device,classic, signalling, sender, function, cellsignalling ] ['This part acts as a sender of 3OC12HSL. L arabinose acts as an inducer and...TetR acts as a repressor. This is also 2 3 of the Oscillator we design....']"},{"machine":"BBa_C0060","videoId":"BBa_C0060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3H - [ Coding,cds, function, biosynthesis, ahl, function, cellsignalling, function, degradation, ahl ] ['it is believed that it is not secreted. This is supported by the observation...V1001 or Bacillus 240B1 cells no autoinducer inactivation is detected in...well conserved motifs it is believed that it is a metalloenzyme....One of the fundamental Biobricks of this project is the aiiA gene it...mentioned is reported as being putative while the latter s confirmed to...codify for our protein of interest nonetheless no information is known about...this is what was theoretically proposed based on the previous biographical...As it can be seen in Figure 1 there is an appreciable band present at the...the protocol used is not specifically designed for this bacteria and since...where the protein of interest is expressed was done correctly because of the...protein s function which is quorum quenching this affects the production of... Erwinia amylovora is a poorly studied bacteria....codify for a N Acyl homoserine lactonase aiiA. This part is a new addition to...that this band is indeed the enzyme aiiA. With this we establish that we...of the disease was inhibited which is composed of the amylovoran and levan...EPS and the infection that is presented by the type III secretion system...The gene expressed is an N Acyl homoserine lactonase which is involved in the...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K658001","videoId":"BBa_K658001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3I - [ Device ] [' Due to patent issues samples of this part cannot be requested. iGEM...The device is designed to build a programmed bacterial death circuit which is...killer gene ccdB under the control of a promoter lux pR. Sufficiently high...levels of CcdB which is a bacterial toxin that targets DNA gyrase cause cell...LuxR AHL complex to activate the promoter lux pR. The programmed death circuit...concentration the death circuit is restarted. Back and forth the programmed...death is achieved in the dynamic process of growth and death.In that way the...bacteria population is programmed to maintain one certain cell density....']"},{"machine":"BBa_C0061","videoId":"BBa_C0061","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3J - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] ['The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the Lux Lux Lux repressor ...site on the promoter increasing the rate of transcription....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...means that the biobrick part is not of potential allergen status. In 80 amino...for this biobrick. This also means that there is not of potential allergen...site is on the 155 149 base number of the BioBrick and on the 10 16 base...VR primer. The third location of the internal priming site is on the 98 104... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K561000","videoId":"BBa_K561000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3K - [ Device ] ['The expression of YFP and tetR is under the control of microaerobic promoter...']"},{"machine":"BBa_C0062","videoId":"BBa_C0062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3L - [ Coding,cds, cds, transcriptionalregulator, activator, cds, transcriptionalregulator, repressor, function, cellsignalling, function, regulation, transcriptional ] ['In complex with HSL LuxR binds to the Lux promoter activating transcription...The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the Lux activator LuxR complexed...palindromic site on the promoter increasing the rate of transcription....We improved this part by using it in a part which allows for the constitutive...This part also includes the pLux promoter so that genes placed downstream the...promoter will be expressed when induced with 3OC6 AHL. We also made a part...part is currently being characterised....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...that the biobrick part is not of potential allergen status. In 80 amino acid...this biobrick. This also means that there is not of potential allergen status....site is on the 628 634 base number of the BioBrick and on the 14 20 base...characterization studies is LuxR protein....The plasmid consists of promoter one of J23102 J23105 J23109 RBS... B0032 luxR terminator B1002 luxPR promoter gfp coding sequence...by luxPR promoter by artificially adding different concentrations of HSL and...be detected by luxPR promoter. The higher intensity of GFP expressed by...Fluorescence is expected to occur in all three cultures as all of these...the three promoters J23102 J23105 and J23109 we predict that the...fluorescence intensity of the same promoter should increase with the increase...concentration should increase as the intensities of the promoter arise....kit and the promoter RBS and terminator are ligated between the parts by...overlap extension PCR and the constructed fragment is ligated to PSB1C3 by...homologous recombination. The correct construction is confirmed by sequencing....well is 0.05 0.08 measured by the plate reader....HSL is from 10 8 to 0.1 mmol L. Add 1 L DMSO without HSL served as positive...bacteria is different and the growth of bacteria with different constitutive...promoters is different. Therefore it is difficult to find a time point of the...From figure 1 for each constitutive promoter the ratio of fluorescence...the lowest. When the concentration of HSL is higher than 101nM the ratio of...the promoters increase at the same HSL concentration. At higher concentrations...put excessive metabolism pressure on the bacteria. Because it is 103 104nm L...In conclusion the binding ability of LuxR and HSL is strong and only a...bacteria so an appropriate concentration of HSL is very necessary . The...most appropriate concentration of HSL is about 103 nM as we determined....We character the ability of this part LuxR binding to...We used promoter J23101 to promoter LuxR and its binding promoter...']"},{"machine":"BBa_K629005","videoId":"BBa_K629005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3M - [ Coding,cds, membrane, transporter, chassis, prokaryote, ecoli, classic, other, uncategorized, proteindomain, transmembrane, ribosome, prokaryote, ecoli, terminator, single ] ['Protein TrkD belongs to Kup system is responsible for the low affinity...The test of function of TrkD is not easy so we sent the sample to the test...']"},{"machine":"BBa_E0020","videoId":"BBa_E0020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3N - [ Coding,function, reporter, function, reporter, fluorescence ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...the biobrick part is not of potential allergen status. In 80 amino acid...this biobrick. This also means that there is not of potential allergen status....site is on the 111 118 base number of the BioBrick and on the 1 8 base number...of the VF2 primer. The second location of the internal priming site is on the...In iGEM 2018 Fudan CHINA improves this part by taking it apart using BiFC...data the excitation is found out to be 429 nm while the emission... is observed to be 478 nm ....sulphate is dissolved in PBS and stored at 4oC. ...obtain the darkest band on the polyacrylamide gel is the percentage saturation... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K775000","videoId":"BBa_K775000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3O - [ Coding,chassis, eukaryote, yeast ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E0022","videoId":"BBa_E0022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 3P - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K773003","videoId":"BBa_K773003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4A - [ Translational_Unit ] ['This part contains the fluorescent protein mCherry attached to a degradation... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E5504","videoId":"BBa_E5504","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4B - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_K773004","videoId":"BBa_K773004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4C - [ Translational_Unit ] ['This part holds the fluorescent protein mCherry attached to a degradation tag ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S01022","videoId":"BBa_S01022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4D - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K880005","videoId":"BBa_K880005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4E - [ Generator ] ['Strong promoter strong RBS combination for high expression levels of proteins...The part is composed of sub parts J23100 and B0034....This is a strong promoter strong RBS combination for high expression levels...of proteins. It has a consensus constitutive promoter and RBS sequence ... Use of this Part by Team Michigan 12...Team Michigan 12 used this part as their primary protein generator. Our data... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_R0084","videoId":"BBa_R0084","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4F - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized ] ['Promoter OmpR positive ...Positively regulated OmpR controlled promoter. This promoter is taken from...In nature this promoter is upstream of the ompF porin gene and is both...activating and repressing. The regulation of ompF is determined by the EnvZ ...transcription. At high osmolarity however EnvZ is more active creating a... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K801010","videoId":"BBa_K801010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4G - [ Regulatory,chassis, eukaryote, yeast, promoter ] ['TEF2 constitutive yeast promoter...Constitutive yeast promoter of medium strength compared to TEF1 promoter.... promoter...']"},{"machine":"BBa_R0078","videoId":"BBa_R0078","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4H - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, CinR ] ['Promoter cinR and HSL regulated ...This promoter is the intergenic region from the CinRI locus. In Rhizobium...transcriptional elements. There is a short 200bp intergenic region between...cinR and cinI. The cinR intergenic cinI structure is conserved for the cinRI...The intergenic region is thought to contain a terminator for cinR a promoter... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K801012","videoId":"BBa_K801012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4I - [ Terminator,chassis, eukaryote, yeast, terminator, single ] []"},{"machine":"BBa_R0082","videoId":"BBa_R0082","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4J - [ Regulatory,chassis, prokaryote, ecoli, classic, regulatory, uncategorized, Kit plates, probiotics, control, direction, forward, function, coliroid, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter OmpR positive ...Positively regulated OmpR controlled promoter. This promoter is taken from...In nature this promoter is upstream of the ompC porin gene. The regulation of...ompC is determined by the EnvZ OmpR osmosensing machinery. EnvZ phosphorylates...OmpR to OmpR P. At high osmolarity EnvZ is more active creating more OmpR P....To determine the noise of the OmpR promoter we measured the expression of our... Leaky Expression by the OmpR Regulated Promoter on Different Vectors... Leaky expression by the OmpR regulated promoter is reduced when cloned into...The expression properties of the OmpR regulated promoter were investigated...background generated by stimulation of the intrinsic OmpR system is removed ...that the OmpR regulated promoter mediated gene expression even in the absence...promoter on a high copy vector in E. coli strain S 928 ompR ....promoter required a low copy plasmid or insertion into the chromosome. Protein...promoters the experiment was carried out in both LB medium and M9 minimal...of RFP expressed by the the OmpR regulated promoter on the high copy vector ...WT E. coli MG1655 and the weak and strong constitutive promoters are...included as references. Standard error of mean is shown but are in several...that mediated by the strong constitutive promoter. On the low copy vector the...expression mediated by the weak constitutive promoter. On the other hand ...All things considered the OmpR regulated promoter was found to exhibit leaky...promoters. When cloned into a low copy vector the leaky expression was...the OmpR dependent promoter a low copy vector is required....influence of this part in the growth kinetics of a wild type NEB 5 alpha... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K784006","videoId":"BBa_K784006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4K - [ Composite,function, reporter, function, reporter, fluorescence ] ['This part is a direct fusion of the theophylline riboswitch... Assembly pcr http openwetware.org wiki Assembly pcr . This part was to be... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R0083","videoId":"BBa_R0083","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4L - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized ] ['Promoter OmpR positive ...Positively regulated OmpR controlled promoter. This promoter is derived from...This promoter contains upstream regions of the ompC porin gene. The regulation...of ompC is determined by the EnvZ OmpR osmosensing machinery. EnvZ...phosphorylates OmpR to OmpR P. At high osmolarity EnvZ is more active ...OmpR binding region provided that the C1 region is placed next to the 35...signal Maeda and Mizuno 1990 . This promoter is a truncated version of... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K784013","videoId":"BBa_K784013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4M - [ Composite ] ['This sequence is the product of restriction cloning of the theophylline... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R0077","videoId":"BBa_R0077","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4N - [ Regulatory,classic, regulatory, uncategorized ] ['Promoter cinR and HSL regulated RBS ...this promoter and activates transcription....This promoter contains the RBS TGGAGG...This promoter is the intergenic region from the CinRI locus....separate transcriptional elements. There is a short 200bp intergenic region...between cinR and cinI. The cinR intergenic cinI structure is conserved for the...sphaeroides. The intergenic region is thought to contain a terminator for...cinR a promoter and RBS for cinI and a dna binding domain for cinR and its...safe this part includes the RBS. R0078 is the same part but with the RBS...']"},{"machine":"BBa_K784014","videoId":"BBa_K784014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4O - [ Composite ] ['This sequence is the product of restriction cloning of the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R0074","videoId":"BBa_R0074","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 4P - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter PenI regulated ... Expression Level of the Mnt and PenI Regulated Promoters... The PenI regulated promoter exhibits a stronger expression than the Mnt ...regulated promoter. ...Applicability of two different promoters was studied for the expression of...and Mnt regulated promoters on pSB1C3 in E. coli MG1655 at OD600 0.3 0.5....From the data obtained it was evident that the PenI regulated promoter...promoter as seen in Figure 1. Furthermore the PenI regulated promoter...Sequence is taken from Figure 3 of Himeno et al. J. Bact. 168 1128 1986 ....Sequence is extended to 50 conservative truncation during harvesting ... promoter ...']"},{"machine":"BBa_K775001","videoId":"BBa_K775001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5A - [ Coding ] ['receptor is composed of the ligand binding domain of the mouse Olfr154 ...']"},{"machine":"BBa_E0032","videoId":"BBa_E0032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5B - [ Reporter,function, reporter, function, reporter, fluorescence ] ['the same promoter and terminator connected GFP. Culture the E. coli in 5 mL...1 . We successfully connected the gene fragment between the promoter and...fluorescence but the fluorescence is very weak....in the same vector with the same promoter and terminator. The fluorescent...From the curve we can see that using these two promoter and terminator the...We are not sure if it can express higher using other promoter and terminator....GFP using the same promoter and terminator E0034 and E0032 has a very low...level of expression. Other promoters and terminators are not tried this...conclusion is only based on the results of this experiment.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K775002","videoId":"BBa_K775002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5C - [ Coding ] ['receptor is composed of the ligand binding domain of the mouse OR1G1 flanked...']"},{"machine":"BBa_R0011","videoId":"BBa_R0011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5D - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter lacI regulated lambda pL hybrid ...etc. The PLlac 0 1 promoter is a hybrid regulatory region consisting of the...promoter P L of phage lambda with the cI binding sites replaced with lacO1....Strong promoter. jb 5 24 04 ...which is commonly used to express protein. Then by measuring the EGFP... DE3 with pSB1C3 as the plasmid skeleton it is leaky . We measured the EGFP...except for the condition where IPTG concentration is 0 mM the green...fluorescence intensity at 25 is always higher than that at other two culture...temperatures which may be because the 25 is conducive to the growth of...E.coli BL21 DE3 compared with 18 and is conducive to the expression of...plasmid skeleton . The Blank is the E.coli BL21 DE3 which containes...1.32 times that at the IPTG concentration of 0 mM which is the highest value... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K775003","videoId":"BBa_K775003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5E - [ Coding,chassis, eukaryote, yeast ] ['RI7 odr10 diacetyl chimeric GPCR with promoter and terminator...part is an improvement of...university. A GPD promoter Kozak sequence and CYC1 terminator have been...']"},{"machine":"BBa_R0040","videoId":"BBa_R0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5F - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, negative, rnap, prokaryote, ecoli, sigma70 ] ['TetR repressible promoter...Sequence for pTet inverting regulator. Promoter is constitutively ON and...repressed by TetR. TetR repression is inhibited by the addition of...Medium strength promoter. jb 5 24 04 ... In contrast to tetracycline anhydrotetracycline is a particularly useful... antibiotic activity is 100 fold lower and concentrations of 50 ng ml as...University of Groningen has improved the pTet promoter in E. voli using a...R0040 is a highly characterized part and many teams before have already...ptetR is determined by the expression and combination on particular promotor...explicating how the expression level of tetR influence ptetR is essential to...to set up gradient for tetR expression. Since the best inducer aTc is not...accessible to us tetracycline is chosen as an alternate. Besides a GFP...tetracycline of different concentration by time is plotted....As a well characterized promoter PtetR has been studied thoroughly with its...expressing system here we take a unique idea to created a new promoter fusion...to create a new promoter that are regulated by tetracycline while with a...desired expression intensity. It is a fusion of tetO operon and the 35...upstream 35 10 parts 10 downstream of the stronger PL promoters in lambda...phages to create a improved promoter with proper expression level while... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K847060","videoId":"BBa_K847060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5G - [ Coding,chassis, prokaryote, ecoli ] [' Saccharomyces cerevisiae baker s yeast is remarkably resistant to...']"},{"machine":"BBa_R0062","videoId":"BBa_R0062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5H - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, function, cellsignalling, LuxR, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter luxR HSL regulated lux pR ...Promoter activated by LuxR in concert with HSL...The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the LuxR activator protein...promoter increasing the rate of transcription....This Plux promoter pointing to the right is the same sequence but inverted ...discovered that this part promotes backwards transcription when LuxR protein...is present and AHL 3OC6 is absent. You can read the paper that documents this...unexpected backwards promoter...of promoter activity which may not be convenient in quorum sensing because...before. In other words bacteria is unable to secrete so much AHL molecules to...process is also important for designers to optimize their synthetic circuits...3OC6HSL LuxR is the wild type pair of Plux. However from this result we can...activate it. What is more the quorum sensing needs more than 30 hours to...cloned three receptor promoter combinations to pSB6A1. The three receptors are...promoter RBS and terminator as AHL synthases . Sensor promoter Plux...terminator as above to detect the response of the promoters to AHL molecules...them is shown in Fig. 2 ...used to indicate the intensity of the promoter response to AHL molecule via...back again. The excitation wavelength is 584nm emission wavelength is 607nm....promotor is not supposed to be activated without AHL. Meanwhile we also...Experiment data is shown in the figures below. Figure.1 ... wiki images thumb 8 8f T Tsinghua LuxpRPromoter 26MutsLeakage 26AHLStimulation.png 600px T Tsinghua LuxpRPromoter 26MutsLeakage 26AHLStimulation.png File T Tsinghua LuxpRPromoter 26MutsLeakage 26AHLStimulation.png ... File T Tsinghua LuxpRPromoter 26MutsLeakage 26AHLStimulation.png...It is observed that high expression intensity is accompanied by high level of...almost the same intensity as wild type but the leakage is significantly... wiki images thumb 4 49 T Tsinghua LuxpRMut5 2610PromotersLeakage 26AHLStimulation.png 600px T Tsinghua LuxpRMut5 2610PromotersLeakage 26AHLStimulation.png File T Tsinghua LuxpRMut5 2610PromotersLeakage 26AHLStimulation.png ... File T Tsinghua LuxpRMut5 2610PromotersLeakage 26AHLStimulation.png...5 is transferred into E.coli DH5 . The bacteria were treated without or with...Mutant 10 is transferred into E.coli DH5 . The bacteria were treated without...hypotheses and explanations. It is reported that 35 to 37 sites are last...three bases of lux box which is upstream of the lux promotor and bound...to 37 which is same to our result. Besides G 36T is not involved in the two... 4. four Add 100 l bacteria culture medium into a sterile 96 well plate. Add AHL to final concentrations of 0 10 10 10 9 10 8 M. Fresh LB medium serves as blank control. Positive control is colony constantly expressing sfGFP and negative control is colony without sfGFP expression. Place the 96 well plate into an automatic microplate reader. Incubate at 16 overnight and measure the fluorometric value at 510 nm and OD600 of each well every 30 minutes.... luxPR promoter is the key element to quorum sensing circuits for it... luxPR promoter is a 70 dependent promoter with an upstream regulatory...resulting in the activation of the promoter. 1 So far lots of teams have...made effort on improving luxPR promoter but they ve all focused on mutating... lux box to change its dynamic characteristics. Since lux box is the...low leakage. When the wild type promoter began to express sfGFP significantly ...the promoter. Since the leakage of the mutant was very low and the threshold...to activate this promoter was high the mutant needed more time and a higher...base pairs are mutated in luxPR 4G12T . And luxPR is the plasmid with the...ampicillin to a total of 100 L and make sure the OD600 of each well is close...AHL is from 10 2 to 106 nmol L. Add 1 L DMSO without AHL served as positive...the luxI promoter J . Molecular microbiology 1999 31 4 1197 1204....The following gene circuit is designed to test the sensitivity of pLux sensing...promoter will trigger the regulation of the downstream circuit. Since we use...To test this part s function we transferred DH10B bacteria with plasmids...same time. LuxI LuxR is a upstream regulation box which produces signal that...bacteria grow to a higher concentration luxpR HS is activated and...HS is predictable according to the fitting analysis results....We substituted the 35 to 10 region of the original promoters luxpR and...luxpR HS with the one from constitutive promoter family members...knowledge of lux box 1 and the method of constructing hybrid promoters 2 ....Fig.2 Hybrid promoter diagram. As the figure shows we substituted the 35 to... 10 region of the original promoter luxpR with the one of J23100 a strong...constitutive promoter. This region is rarely concerned as it s rather...conservative in promoters with the same function but it has crucial...behavior of the regulatory promoter....Fig. 3 Microplate reader data of quorum sensing promoters time as X axis ....It shows the overall status of the promoters....Fig. 4 Microplate reader data of quorum sensing promoters OD600 as X axis ....The downward curve before OD600 0.1 is due to the parental fluorescence and...the dilution effect after proliferation. It is shown that luxpR fus100 has a...promoters into 3 ml LB medium with 50 mg ml kanamycin and 100 mg ml ampicillin... 2 de Boer HA Comstock LJ Vasser M. The tac promoter a functional hybrid...derived from the trp and lac promoters. Proc Natl Acad Sci U S A.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...It is very important for us to select the inducible promoter with low...transcriptional leakage and high dynamic range. These promoters are essential...parts of building the logic gates. These promoters also played a crucial role...The Lux promoter fluorescence data in E. coli BL21 DE3 at different HSL...0.002mg mL 0.01mg mL 0.1mg mL and 1mg mL . The Lux promoter showed the... promoter ...']"},{"machine":"BBa_K731020","videoId":"BBa_K731020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5I - [ Composite ] ['Inducible araC pBAD promoter regulating WT CysE...regulated by the araC pBAD promoter...This part has been successfully operated both in pSB1C3 K731020 and the low...A mutated version of this construct is available as Part...This part was cloned by the iGEM Trento 2012 team for the creation of an...marble stones. Further information about this part and its characterization... This Part is also available into the medium copy vector pSB3C5. They are...of cysteine. Some O acetylserine is also converted to N acetylserine which in...In Escherichia coli conversion of L serine to L cysteine is mediated by the...of L serine by acetyl CoA. Its product 0 acetyl L serine OAS is then...uptake and reduction is regulated by induction as well as by repression 2 ....The pBAD promoter is active in presence of L arabinose. L arabinose binding to...AraC is also negatively regulated by cAMP via CRP formerly known as CAP ...transcription when arabinose in not needed which is when it s not present...and or when glucose the primary energy source is available....corresponding not induced culture. The pBAD promoter is active in presence of...which is controlled by pBAD. AraC is also negatively regulated by cAMP via CRP...function to limit its transcription when no arabinose is present and or when...glucose the primary energy source is available. When grown in MOPS B cells...can use glucose. cysE which is regulated by araC pBAD should not be...cysteine is at 560nm. Cysteine concentration was calculated referring to a...Serial dilutions data is confirmative of conclusions coming from growth...']"},{"machine":"BBa_R0063","videoId":"BBa_R0063","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5J - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized, function, cellsignalling, LuxR ] ['Promoter luxR HSL regulated lux pL ...The lux cassette of V. fischeri contains a left and a right promoter. The left...promoter gives weak constitutive expression of downstream genes.This...expression is down regulated by the action of the Lux repressor LuxR. Two...the promoter increasing the rate of transcription from Pr repressing...Medium strength promoter in the absence of LuxR HSL. jb 5 24 04 ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K731030","videoId":"BBa_K731030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5K - [ Composite ] ['Inducible araC pBAD promoter regulating M256I CysE...is here regulated by the araC pBAD promoter...This part has been successfully operated both in pSB1C3 K731030 and the low...This part was cloned by the iGEM Trento 2012 team for the creation of an...marble stones. Further information about this part and its characterization... This Part is also available into the medium copy vector pSB3C5. They are...CysE is a serine acetyltransferase that mediates the production of cysteine....Its product 0 acetyl L serine OAS is then subsequently converted to...The catalytic activity of CysE is sensitive to feedback inhibition by...secretion into the medium.This particular mutant thus would overproduce...The M256I cysE gene is here regulated by the araCpBAD promoter which is...AraC is also negatively regulated by cAMP via CRP formerly known as CAP ...intensity peak for cysteine is at 560nm. Cysteine concentration was calculated...infact that in the presence of glucose the expression of CysE is significantly...that in glucose there was always cysteine production that is often surpassed...bar is K731020 while the red one is K731030. MOPS A medium supplemented with...']"},{"machine":"BBa_R0065","videoId":"BBa_R0065","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5L - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, negative, regulation, multiple, classic, regulatory, uncategorized ] ['Promoter lambda cI and luxR regulated hybrid ...cI repressor negatively regulates this promoter and LuxR activates its...transcription.The effect of cI is dominant over LuxR. This part is based on...the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron...This promoter is leaky in the sense that some transcription is seen in the... LuxI cI activity of promoter ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K731250","videoId":"BBa_K731250","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5M - [ Composite ] ['Inducible araC pBAD promoter with GFPmut3b strong RBS...This part has been used for testing and characterization of araC pBAD promoter...This part was successfully operated and characterized both in pSB1C3 and...']"},{"machine":"BBa_R1062","videoId":"BBa_R1062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5N - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, LuxR ] ['Promoter Standard luxR and HSL regulated lux pR ... Note This is the same part as R0062 except that the 10 and 35 sites and...Promoter activated by LuxR in concert with HSL...The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the LuxR activator protein...promoter increasing the rate of transcription....Medium strength promoter in the absense of LuxR HSL. May not be well matched...with other 10 series promoters. jb 5 24 04 ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K731255","videoId":"BBa_K731255","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5O - [ Composite ] ['Inducible araC pBAD promoter with GFPmut3b weak RBS...This part has been used for testing and characterization of araC pBAD promoter...This part was successfully operated and characterized both in pSB1C3 and...']"},{"machine":"BBa_E0422","videoId":"BBa_E0422","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 5P - [ Reporter,classic, reporter, ret ] ['This part can be used to test promoter strength or the proper functioning of a...regulator device. The LVA tail is particularly useful when testing a...In this experiment the E0422 part was associated with a cI regulated promoter...fluorescence excitation curve by connecting it to the combined promoters...We did not detect the fluorescence excitation corresponding to this part ...which may be due to incorrect culture conditions or some problems of this part...itself. We have sent this part to be sequenced for analysis but until the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K876010","videoId":"BBa_K876010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6A - [ Composite ] ['Inducible promoter for TetR...']"},{"machine":"BBa_S03119","videoId":"BBa_S03119","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6B - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K876014","videoId":"BBa_K876014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6C - [ Composite ] ['Constitutive promoter for LuxI which can be repressed by LacI...']"},{"machine":"BBa_R0079","videoId":"BBa_R0079","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6D - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, function, cellsignalling, LasR, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter LasR PAI regulated ...Abstract from above The enzyme elastase is an important virulence factor of...the lasB promoter region to learn more about lasB activation by LasR and PAI....We report that the lasB transcriptional start is located 141 nucleotides...lasB promoter region contains two putative operator sequences OP1 and OP2 ...located directly upstream from and may overlap with the lasB promoter...region and OP2 is centered 102 nucleotides upstream from the lasB... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K876015","videoId":"BBa_K876015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6E - [ Composite ] ['Constitutive promoter for LasR which can be repressed by TetR...']"},{"machine":"BBa_R0071","videoId":"BBa_R0071","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6F - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, RhlR ] ['Promoter RhlR C4 HSL regulated ...Promoter activated by RhlR in concert with C4 HSL. C4 HSL is produced by RhlI ...This is the natural sequence taken from Pseudomonas aeruginosa....Crosstalk this promoter is also activated at a low level by LasR with its...RhlR binds to the promoter region and activates transcription when in the...C4 HSL which is produced by RhlI....RhlR C4 HSL to the las box is a necessary condition for rhlAB expression...From Medina03 i The LasR 3 O C12 HSL complex can activate rhlAB promoter...From the data in Pearson97 the activation by LasR is about 3 of that by...Promoter and obtain our original improved Prhl included in...Our purpose is to create strong Prhl for our final genetic circuits. This...for this result is unclear....obtained 198 Prhl mutants and chose the two Prhl mutants of which promoter...characters indicate the scar sequence and a single point mutation is colored... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K876057","videoId":"BBa_K876057","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6G - [ Composite ] []"},{"machine":"BBa_R0080","videoId":"BBa_R0080","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6H - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter AraC regulated ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...expression level under 30 . And the optimum concentration under 30 is 0.1 of...to see if the EGFP is expressed ... promoter ...']"},{"machine":"BBa_K876069","videoId":"BBa_K876069","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6I - [ Intermediate ] []"},{"machine":"BBa_I13025","videoId":"BBa_I13025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6J - [ Project,classic, project, uncategorized ] []"},{"machine":"BBa_K876070","videoId":"BBa_K876070","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6K - [ Reporter ] ['Constitutive promoter with GFP...previous part the expression of the new part is particularly good....']"},{"machine":"BBa_I13027","videoId":"BBa_I13027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6L - [ Project,classic, project, uncategorized ] []"},{"machine":"BBa_K817000","videoId":"BBa_K817000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6M - [ Coding ] ['This is the GLP 1 coding part along with the signal peptide sequence....it through 0.22 m filter to exclude bacteria. Since the secreted GLP 1 is too... 1. 310 L Bacterial culture was cultured in 5mL LB at 37 with suitable concentration of antibiotics shaking till 600 nm absorbance in cuvette is 1.5 usually it takes about 18 hr ....The upper dot is from the lyzed bacterial pellet which represents the GLP 1...inside the bacteria. The middle part is from bacterial culture supernatant ...which means the secreted GLP 1 and the left dot is the media we did 10X...concentration the right dot is the one we did 100X concentration. The lower...dot is from pure GLP 1 solution as positive control....The left bar is from the lyzed bacterial pellet which represents the GLP 1...inside the bacteria. The right bar is from 10X concentrated bacterial culture...Our data indicates that although there is much GLP 1 inside the bacteria some...of GLP 1 is secreted by our signal peptide design. The secreted GLP 1 can be...Glucagon like peptide 1 GLP 1 is a peptide hormone and is derived from...proglucagon. It is an incretin molecule therefore it can decrease the blood...about 1 2 minutes in humans as it is degraded by dipeptidyl peptidase 4...']"},{"machine":"BBa_I13028","videoId":"BBa_I13028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6N - [ Project,classic, project, uncategorized ] []"},{"machine":"BBa_K844000","videoId":"BBa_K844000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6O - [ Tag ] ['IMPORTANT NOTE This part uses Assembly Standard 23 Silver...sequence data below and on composite parts using this part will not reflect...This part is a 10x Histidine tag with two stop codons on the 3 end. It is...This part is also an improvement over existing histidine tags as it includes...produced by the 2012 Utah State iGEM Team. Below is a Coomassie stained SDS...Nickel affinity resin column. The protein in the lane is nearly pure with...from the sample. Also below is a Western blot utilizing an antibody that...10x histidine tag is functioning and is compatible with staining and antibody...the cell lysate sample. The second lane is the flowthrough from the column ...high affinity of the 10x His tag. The third lane is the eluted spider silk...band with only very minor contaminating bands. The last lane is the Bio Rad...coli DH5a cells without spider silk construct. Marker lane is Bio Rad... yellow asterisk is 20 kDa and 21 kDa for CRYAB HIS blue asterisk . Adding...Protein concentration is measured using nanodrop. After running through a...More information on the procedure is shown in TAS Taipei 2016 under Wiki...His tags exist prior to the creation of this part. The vast majority of parts...a brief description of the ones we found and a discussion of how this part...part is a 6x His tag with a single stop codon. It contains additional glycine...part is an E. coli codon optimized 6x His tag and has the prefix and suffix...CAT 62 of the time and CAC 38 of the time so neither codon is extremely...part is a 6x His tag usable in Assembly Standard...tag improves on this part by extending the His repeat region to 10x....part is a 10x His tag with a downstream stop codon compatible with Assembly...Standard 21 http parts.igem.org Assembly standard 21 . When this part is...10x His tag improves on this part by removing the upstream stop codon ...']"},{"machine":"BBa_I13202","videoId":"BBa_I13202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 6P - [ Signalling,function, cellsignalling ] ['3OC6HSL Sender Controlled by Lac Repressible Promoter...A lac repressible promoter driving production of an untagged LuxI enzyme which...']"},{"machine":"BBa_K731520","videoId":"BBa_K731520","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7A - [ Composite ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S0100","videoId":"BBa_S0100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23H - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808032","videoId":"BBa_K808032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7C - [ Composite,cds, enzyme ] ['This is a composite of 2 different BioBricks formed by a standard assembly ...is an operon being induced by adding 0.02 to 0.5 of L Arabinose. It is made...Est13 which is anchored C terminal to EstA....Of course the first step for showing any kind of functionality is to perform a...The resulting supernatant is loaded but the cell debris pellet is treated with...bound protein and is loaded as well. We were able to express our protein and...To be sure that our protein is expressed we performed a Western...tag is used for detecting whether our surface expression is successful or not....4 and slightly lane 6. Lane 8 is a myc positive probe and worked too.... Flow cytometry http en.wikipedia.org wiki Flow cytometry Labels is good...The second antibody is biotinylated and can be conjugated to streptavidin ...there is no maxima of absorption at the same wavelength of the negative...relative absorbance of 50000 cells was meassured and is shown in this plot....This part misses the arabinose inducible promotor. A clear lysis area is...activity is quantified by the slope of the respective straight line in Figure...activity is quantified by the slope of the respective straight.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S0107","videoId":"BBa_S0107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7D - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808000","videoId":"BBa_K808000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, other ] ['araC Pbad Arabinose inducible regulatory promoter repressor unit...This part contains the promoter as well as the coding sequence for the...repressor AraC which is transcribed in the opposite direction. upstream By... L Arabinose is a sugar and is harmless. For overexpression of proteins the concentration of 0 001 0 02 Arabinose can be used. ... We designed this biobrick in order to get a promoter with low background activity so that our expressed membrane proteins wouldn t damage the cells before induction. ... Can with success be combined with a promoter from pBAD SPL http parts.igem.org PBAD SPL to obtain a very low leakiness and an appropriate strength. This is very efficient for expressing lethal proteins....data. We also used this promoter to express our PET cleaving enzyme pNB Est13 ...which is anchored C terminal to EstA. E. Coli membrane anchor protein ....Figure 1. Cells grown in GFP medium containing the arabinose promoter...The promoter was characterized using GFP to measure gene expression at...containing 0.01 w v of arabinose. The response of the promoter to...Figure 2. Cells grown in LB medium containing the arabinose promoter...To characterize the promoter s leakiness we amplified our constructs...To characterize the promoter s response to varying arabinose concentrations ... Induction of pBAD promoter in V. natriegens ...min. As is the case for the better studied but slower growing E. coli V....high rRNA gene copy number strong promoters that contain near consensus 10 ...addition V. natriegens rRNA promoters exhibit the relatively short lived...open complex characteristic of rRNA promoters in E. coli potentially...contributing to the regulation of these promoters in vivo....in V. natriegens . The pBad promoter was characterized at different time...best version of the promoter was determined based on fold change in the...a tightly regulated promoter that can be induced by arabinose in V....natriegens . Fluorescence is normalized to OD600 and presented here on a...logarithmic scale. The course of fluorescence is presented for different... http openwetware.org wiki Titratable control of pBAD and lac promoters in individual E. coli cells pBAD promotersOpenWetWare ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...pBad araC promoter negative regulators o h o l positive regulators ...']"},{"machine":"BBa_S0108","videoId":"BBa_S0108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7F - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808002","videoId":"BBa_K808002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7G - [ Coding ] ['protein with 11 alpha helical spanners Fig. 1 . The N teminus is with a...']"},{"machine":"BBa_S0109","videoId":"BBa_S0109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7H - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808004","videoId":"BBa_K808004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7I - [ Coding ] []"},{"machine":"BBa_S0110","videoId":"BBa_S0110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7J - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808007","videoId":"BBa_K808007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7K - [ Composite ] []"},{"machine":"BBa_S0116","videoId":"BBa_S0116","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7L - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808012","videoId":"BBa_K808012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7M - [ Coding ] [' TphA2 is coding for the lagre terephthalate 1 2 dioxygenase subunit from...TphA2 consists of 414 amino acids and has a molar mass of 46.35 kDa. It is a...Rieske protein with a iron sulfuric center. The Rieske center is located in...the active site and is typical for oxygenases. Figure 1 shows TphA1 with the...']"},{"machine":"BBa_S0117","videoId":"BBa_S0117","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7N - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K808014","videoId":"BBa_K808014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7O - [ Coding ] ['ssp. pneumonie . It has a molecular mass of 57 kDa and is reported to form a...AroY is reported to catalyze the reaction of protocatechuate... 3 4 Dihydroxybenzoate to catechol under anaerobic conditions. This is the...']"},{"machine":"BBa_P0152","videoId":"BBa_P0152","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 7P - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K844006","videoId":"BBa_K844006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8A - [ Coding ] ['IMPORTANT NOTE This part uses Assembly Standard 23 Silver...sequence data below and on composite parts using this part will not reflect...et al. 2008 which is based on the native sequence of the MaSp2 silk gene in...details. This part contains an added Met ATG codon at the 5 end and is... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_A340620","videoId":"BBa_A340620","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8B - [ Inverter,classic, inverter, uncategorized ] []"},{"machine":"BBa_K844007","videoId":"BBa_K844007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8C - [ Coding ] ['IMPORTANT NOTE This part uses Assembly Standard 23 Silver...sequence data below and on composite parts using this part will not reflect...This subunit is based on the 2E subunit from MaSp2 silk gene from Argiope...details. This part contains an added Met ATG codon at the 5 end and is...construct is preceded by a lactose IPTG inducible promoter.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I13602","videoId":"BBa_I13602","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8D - [ Reporter,classic, reporter, pret ] ['This part can be used to test the classical Tet repression system with a CFP...reporter. The Ptet promoter used is a medium strength promoter.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K844008","videoId":"BBa_K844008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8E - [ Coding,Kit plates, silk ] ['IMPORTANT NOTE This part uses Assembly Standard 23 Silver...sequence data below and on composite parts using this part will not reflect...This subunit is based on the 2E subunit from MaSp2 silk gene from Argiope...details. This part contains an added Met ATG codon at the 5 end and is...protein generator is driven by a lactose IPTG inducible promoter coupled with... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I13450","videoId":"BBa_I13450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8F - [ DNA,dna, cloningsite ] []"},{"machine":"BBa_K779500","videoId":"BBa_K779500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8G - [ Other ] [' MIT iGEM 2012 is still collecting data on this part. ...nucleotide bulge which is supposed to protect the annealed complex below ...']"},{"machine":"BBa_I732815","videoId":"BBa_I732815","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8H - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K779501","videoId":"BBa_K779501","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8I - [ Other ] ['For controls No Transfection is a well which only received cells. The No...data. The red line dsROX is a positive control that acts as the product of a...above figure it is clear that the cells that received reporter and input...reporter green line . This is compatible with the hypothesis that the...red fluorescence dsROX is our positive control . these experiments are at...early stage and further investigation is needed. ... This is a graph of flow cytometry data showing Texas Red in A.U. on the... This is a graph of flow cytometry data with FITC on the x axis in A.U. and...Texas Red on the y axis in A.U. The No transfection is our negative control....The dsROX is a well of HEK293 cells that were nucleofected with the product of...transfection efficiency and is shifted far right on the FITC axis. When we...Sequence is designed to be orthogonal to the HEK293 transcriptome see...']"},{"machine":"BBa_I732904","videoId":"BBa_I732904","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8J - [ Intermediate ] ['As blank or negative control when testing promoter activity with repressor ...']"},{"machine":"BBa_K779503","videoId":"BBa_K779503","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8K - [ Other ] ['For controls No Transfection is a well which only received cells. The No...data. The red line dsROX is a positive control that acts as the product of a...above figure it is clear that the cells that received reporter and input...reporter green line . This is compatible with the hypothesis that the...red fluorescence dsROX is our positive control . these experiments are at...early stage and further investigation is needed. ... This is a graph of flow cytometry data showing Texas Red in A.U. on the... This is a graph of flow cytometry data with FITC on the x axis in A.U. and...Texas Red on the y axis in A.U. The No transfection is our negative control....The dsROX is a well of HEK293 cells that were nucleofected with the product of...transfection efficiency and is shifted far right on the FITC axis. When we...']"},{"machine":"BBa_I732807","videoId":"BBa_I732807","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8L - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K779504","videoId":"BBa_K779504","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8M - [ Other ] ['strand of the reporter. Thus this scrambled input is a negative control to...150 000 HEK293 cells in supplemented DMEM. For controls No Transfection is a...']"},{"machine":"BBa_I732074","videoId":"BBa_I732074","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8N - [ Intermediate ] ['Promoter Adaptor LacZ alpha Reporter...This part containing two gene fragments Adaptor LacZ alpha which is added...by the BioBrick Prefix and Suffix for standard assembly. The Promoter Adaptor...lacZ alpha is used for birthing reporter protein LACZ alpha for further assay.... The adaptor contains two restriction sites XbaI and BglII because we ever used the promoters with the restriction site XbaI which is not a member in a standard biobrick prefix or suffix. So the adaptor is designed for this purpose....']"},{"machine":"BBa_K743002","videoId":"BBa_K743002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8O - [ Regulatory ] ['PCaa3 promoter and native rbs from Synechocystis PCC6803...This is the 100 bp sequence upstream Caa3 gene start codon. It contains...putative rbs and promoter regions. Caa3 codes for a putative cytochrome aa3...']"},{"machine":"BBa_I732812","videoId":"BBa_I732812","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 8P - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K808033","videoId":"BBa_K808033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9A - [ Composite ] []"},{"machine":"BBa_P0153","videoId":"BBa_P0153","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9B - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K808034","videoId":"BBa_K808034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9C - [ Composite ] []"},{"machine":"BBa_P0440","videoId":"BBa_P0440","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9D - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K823016","videoId":"BBa_K823016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9E - [ Reporter ] ['I732017 . Only here the part is cloned in the standard vector pSB1C3 ...']"},{"machine":"BBa_I6030","videoId":"BBa_I6030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9F - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0010.E0430...']"},{"machine":"BBa_K850000","videoId":"BBa_K850000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9G - [ Coding ] ['of UDP N acetylglucosamine UDP GlcNAc biosynthesis 1 This enzyme is part...']"},{"machine":"BBa_I6031","videoId":"BBa_I6031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9H - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0011.E0430...']"},{"machine":"BBa_K850002","videoId":"BBa_K850002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9I - [ Coding ] ['homolog of S. cerevisiae Qri1p alkaline upregulated. This gene is part of the...']"},{"machine":"BBa_I6032","videoId":"BBa_I6032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9J - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0040.E0430...']"},{"machine":"BBa_K748003","videoId":"BBa_K748003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9K - [ Coding,cds, enzyme, cds, enzyme, dnase, chassis, prokaryote, ecoli ] ['WspR. This part is a protein that has a domain that increases levels of c di ...This part is originated from Pseudomonas aeruginosa. In our project we used...cyclase is more efficient in biofilm formation. We use this and others...Cyclic di GMP c di GMP is recognized as an intracellular signaling molecule...This part is originated from Pseudomonas aeruginosa. In our project we used...cyclases is more efficient in biofilm formation. We use this and others... Figure 1 Each column is the mean value of a sample with 5 identical...column is the mean value of a sample with 5 identical experiments made in the...heterogeneous growth in the 24 hour plate. We can infer that this is a form of...a longer timespan is necessary to evaluate wspR biofilm production....In the end of our experiments we came to the conclusion that Wspr is the less...']"},{"machine":"BBa_I6040","videoId":"BBa_I6040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9L - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0053.E0430...']"},{"machine":"BBa_S05051","videoId":"BBa_S05051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9M - [ Intermediate ] []"},{"machine":"BBa_I6042","videoId":"BBa_I6042","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9N - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0062.E0430...']"},{"machine":"BBa_K819012","videoId":"BBa_K819012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9O - [ Generator,cds, transcriptionalregulator, repressor, chassis, prokaryote, ecoli, function, cellsignalling ] ['LacI mutant protein is placed under SulA408 promoter ...repress lac promoter. So this part can work as a connection between two...']"},{"machine":"BBa_I6044","videoId":"BBa_I6044","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 9P - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0063.E0430...']"},{"machine":"BBa_K737031","videoId":"BBa_K737031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10A - [ RNA ] ['Spot42 is a multitarget small RNA that mediates the discoordinate expression...presently unclear way. The base pairing is initiated by the recognition of...Small RNA chaperone Hfq is an abundant protein that has 40000 50000 copies...I put R0011 the simplfied lac promoter in the upstream of the small RNA so...']"},{"machine":"BBa_I732912","videoId":"BBa_I732912","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10B - [ Intermediate ] ['Promoter Adapter LacI...']"},{"machine":"BBa_K737032","videoId":"BBa_K737032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10C - [ RNA ] ['Spot42 is a multitarget small RNA that mediates the discoordinate expression...unclear way. The base pairing is initiated by the recognition of seed...Small RNA chaperone Hfq is an abundant protein that has 40000 50000 copies...I put R0040 the tet promoter in the upstream of the small RNA so that its...']"},{"machine":"BBa_I732097","videoId":"BBa_I732097","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10D - [ Reporter ] ['Promoter Activity Reporter RFP ...Promoter can be inserted into the adapter containing BglII and BamHI sites....The activity of inserted promoter can be quantificationally measured using...']"},{"machine":"BBa_K737033","videoId":"BBa_K737033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10E - [ RBS ] ['galK is the leader sequence of galactokinase GalK ...galK is the leader sequence of galactokinase GalK and Spot42 sRNA controls...RBS.The repression is modest about 2.6 fold maybe there is no subsequent...Note The ClaI site is blocked by GATC methylation due to a mistake.It should...n a galK is the leader sequence of galactokinase GalK ...']"},{"machine":"BBa_I732081","videoId":"BBa_I732081","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10F - [ Translational_Unit,function, regulation, transcriptional ] []"},{"machine":"BBa_K778006","videoId":"BBa_K778006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10G - [ DNA ] []"},{"machine":"BBa_I732801","videoId":"BBa_I732801","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10H - [ Intermediate ] []"},{"machine":"BBa_K916000","videoId":"BBa_K916000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10I - [ Coding ] [' NOTE This part has no promoter and so can be used with any BioBrick...promoter in the registry. See the list of...promoters here http parts.igem.org cgi partsdb pgroup.cgi pgroup Regulatory ....TraR is the A. tumefaciens transcriptional regulator responsible for its...']"},{"machine":"BBa_I715039","videoId":"BBa_I715039","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10J - [ Reporter ] ['The fluorescence intensity of cells is usually characterized by relative...of OD600 cells.The specific measurement process is as follows ...process.This result indicates that the lac promoter is leaked without the...']"},{"machine":"BBa_K747094","videoId":"BBa_K747094","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10K - [ Protein_Domain,proteindomain, dnabinding ] ['This part can be used to synthesize a 14 nucleotide Transactivator like TAL ...Every Direpeat is able to bind two specific nucleotides and is determined by...The position of the Direpeat inside a TAL Protein is determined by the sticky ...This Part allows you to predefine the binding affinity of the 12. nucleotide...therefore are oriented towards the cutting site. So if a part is flanked by 4...align in a predefined order. In case a destination vector is added that...clones. Golden Gate Cloning is typically performed as an all in one pot... trapped in the desired construct. This is the reason why Golden Gate Cloning... SEAP . The product of the reporter gene SEAP is as the name tells a...phosphatase that is secreted by the cells into the surrounding media. The...First of all the SEAP is secreted into the cell culture media therefore we...two different points in time. Another advantage is the measurement via...did not have to clone a TALE binding site upstream of the minimal promoter...toolkit to produce a TAL protein which is fused to a VP64 transcription...transcription of the repoter gene SEAP. The phosphatase is secreted an...As it is observable in the graph co transfection of cells with TAL and SEAP...performed a t test Table to prove if our experiment is statistically...significant. As it is clearly observable the p values range below a value of...0 05 which indicates that our TAL transcription factor is able to elevate the...']"},{"machine":"BBa_I746320","videoId":"BBa_I746320","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10L - [ Reporter ] ['GFP under control of PF promoter...This part is used to screen the level of induction of the PF promoter... I746360 . The PF promoter is induced by a class of phage activators P2 ogr ...']"},{"machine":"BBa_K747095","videoId":"BBa_K747095","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10M - [ Protein_Domain,proteindomain, dnabinding ] ['This part can be used to synthesize a 14 nucleotide Transactivator like TAL ...Every Direpeat is able to bind two specific nucleotides and is determined by...The position of the Direpeat inside a TAL Protein is determined by the sticky ...This Part allows you to predefine the binding affinity of the 12. nucleotide...therefore are oriented towards the cutting site. So if a part is flanked by 4...align in a predefined order. In case a destination vector is added that...clones. Golden Gate Cloning is typically performed as an all in one pot... trapped in the desired construct. This is the reason why Golden Gate Cloning... SEAP . The product of the reporter gene SEAP is as the name tells a...phosphatase that is secreted by the cells into the surrounding media. The...First of all the SEAP is secreted into the cell culture media therefore we...two different points in time. Another advantage is the measurement via...did not have to clone a TALE binding site upstream of the minimal promoter...toolkit to produce a TAL protein which is fused to a VP64 transcription...transcription of the repoter gene SEAP. The phosphatase is secreted an...As it is observable in the graph co transfection of cells with TAL and SEAP...performed a t test Table to prove if our experiment is statistically...significant. As it is clearly observable the p values range below a value of...0 05 which indicates that our TAL transcription factor is able to elevate the...']"},{"machine":"BBa_I746324","videoId":"BBa_I746324","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10N - [ Reporter ] ['GFP under control of Psid promoter...This part is used to screen the level of induction of the Psid promoter... I746364 . The Psid promoter is induced by a class of phage activators P2...']"},{"machine":"BBa_K911003","videoId":"BBa_K911003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10O - [ Measurement,rna, riboswitch ] ['Riboswitch that is highly sensitive to the F ion. We have characterized this...Characterisation data can be found in the experience tab of this part....This riboswitch is a positive regulator. The riboswitch originally isolated...repression is lifted. In B. cereus this serves to permit translation of a...riboswitch is in the 0uM to 100uM range when using galactosidase as the...']"},{"machine":"BBa_I746105","videoId":"BBa_I746105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 10P - [ Reporter ] ['GFP with agr P2 promoter...This is composed of a promoter and a GFP reporter gene. This can produce green...fluorescence and in theory the strength of the green flourence is much...stronger when there is phosphorylated AgrA in the cell. This is used to test...the basal activity of agr P2 promoter....Summary In this contribution we characterized this part in S.aureus ....be functional in S.aureus when the Agr system is present....plateau. This result is consistent with the autoinduction prediction of the...']"},{"machine":"BBa_S05055","videoId":"BBa_S05055","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11A - [ Intermediate,classic, device, uncategorized ] ['Pre half of the collins toggle switch which include a lac promoter ROO1O ...']"},{"machine":"BBa_I6046","videoId":"BBa_I6046","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11B - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0065.E0430...']"},{"machine":"BBa_K934001","videoId":"BBa_K934001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11C - [ Composite ] ['Poly 3 hydroxybutyrate P 3HB a kind of PHAs is synthesized by three... Ralstonia eutropha H16 is shown in Fig1. Pyruvic acid is metabolized from...in phaA . Acetoacetyl CoA is transformed into R 3 hydroxybutyl CoA by NADPH...dependent acetoacetyl CoA reductase coded in phaB . P 3HB is then...products using GC MS the products are methylated because 3HB is difficult to...different conditions for 48h. Each condition is shown in Fig.5. Composition of...LB and TB medium is shown in Fig.6....Pantothenic acid PA also called vitamin B5 is required to synthesize...The culture result is shown in Fig.8.... Dried cells g L is the amount of the cells in the medium after culturing.... Polymer content rate is the rate of the polymer in the dried cells.... Polymer concentration g L is the amount of the polymer in the medium after culturing. This value is calculated by multiplying Dried cells and Polymer content rate ....even if the number of microorganism is less tha the aerobic conditions. We...the pyruvate obtained is metabolized in PHB....']"},{"machine":"BBa_I6050","videoId":"BBa_I6050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11D - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R1051.E0430...']"},{"machine":"BBa_K934023","videoId":"BBa_K934023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11E - [ Composite ] ['This part generates LasI which generate 3OC12HSL in the presence of 3OC6HSL....By using this part and K934013 positive feedback system will be completed....That is to say 3OC12HSL activate synthesis of 3OC6HSL and 3OC6HSL activate...']"},{"machine":"BBa_I6056","videoId":"BBa_I6056","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11F - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R1062.E0430...']"},{"machine":"BBa_K733002","videoId":"BBa_K733002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11G - [ Regulatory ] [' xylR PxylA A xylose inducible promoter with its transcriptional...The xylose inducible promoter used to construct this part is amplified from...inducible promoter which is originated from Bacillis megaterium . The xylose...inducible promoter we constructed contains promoter PxylA which located...promoter located at upstream of xylose operon is also included in our parts....binding site of xylose on XylR. In addition glucose itself is also supposed...']"},{"machine":"BBa_I6060","videoId":"BBa_I6060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11H - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0010.E0432...transformed it into E. coli BL21. Since there is LacI gene inside the...promoter typically. If we use IPTG to induce the bacteria the LacI promoter...We plan to separate our experiment into two parts first is colony PCR which...are used to see if we produce our target gene or not. The second part is the...In this part we confirmed the nucleotide sequence size and protein size by...Confirming the size of the sequence and the protein size is not enough for us...fluorescence. The parameter for fluorescence is shown below ...Figure 1 The result of PCR. In the first well is the 1kb DNA ladder and the...constant speed but the other cure eYFP IPTG since there is no IPTG to open...lac promoter the growth seems to be restricted. Therefore we can conclude...that and the trend is similar to the OD value we guess it s because it has a...constitutive promoter so the amount of protein will be highly related the lac...promoter is really functioning....of the sample eYFP IPTG is 0.692 and it belongs to moderate correlated....highly correlated so we think the error here is just because of the mistakes...successfully produce yellow fluorescence protein when IPTG is induced. We hope...minipreped the DNA. As you can see from the gel there is a good correlation...It is interesting to think that different colonies can carry different loads...of plasmid and this is responsible for the difference in fluorescence. img...']"},{"machine":"BBa_K733018","videoId":"BBa_K733018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11I - [ Composite ] ['This construct is built to measure the relative efficiency of xylose inducible...promoter in E. coli . We intend to use GFP as an indicator to characterize...this xylose inducible promoter derived from Bacillus megaterium ...on xylose inducible promoter and use GFP intensity changes over certain period...of time to represent the regulatory effect of this promoter in different... Promoter characterization...2..JPG wiki images 5 53 Promoter characterization 2..JPG File Promoter characterization 2..JPG ...The reason for using the xylose inducible promoter is to enable control on the...expression of toxin and BMP2. Xylose is not toxic and normally not present in... Objective On characterization we want to test whether the promoter works...in E. coli DH10B strain and if it works what is the absolute promoter...1 . Xylose inducible promoter is functional in E.coli ....The absolute promoter activity was measured with respect to xylose...plotted following which the respective absolute promoter activities were...8 . Plotting a graph to demonstrate the absolute promoter activity under...4 . Absolute promoter activity for the promoter under different inducer...5 . Averaged absolute promoter activity was then obtained by averaging the...respective sets of absolute promoter activity values....increased. This tells us that the xylose inducible promoter is functional in...suggests that the xylose inducible promoter is to some extent leaky....1 . It is quite obvious that addition of xylose induces GFP expression in this...xylose inducible promoter is leaky. It should be noteworthy that this version...of the xylose inducible promoter has undergone mutagenesis on 3 different...mutagenesis is done while preserving an identical codon translation. As such ...similar to the Ptms promoter activity of the xylR PxylA promoter might be...heterologous system. Further characterization on this promoter in B. subtilis...2 . Another interesting fact to note is that the E. coli strain used is one in...level particularly at 1 or 2 is not the true upper limit since there...error higher concentrations of xylose was used and the promoter activity does...reflects the maximum promoter activity. While this problem is solved due to...maximum promoter activity was achieved at 1 xylose implying that we are...maximum activity. Based on the current result it is safe for us to make a...reason is that the high osmotic pressure caused by the xylose in the medium...We designed three different xylose inducible promoter constructs. The...optimized B. subtilis repressor binding site in the promoter sequence was...Sequence for the optimized promoter was obtained from Lin et al. part of... Generation of promoter constructs...Construct 1 entire promoter sequence replaced ...Construct 2 part of promoter replaced ...Construct 3 new promoter right upstream of translation start ... 3 was tested 5 times for GFP expression on the Biolector. The Biolector is a...samples. It is interesting to note that all samples grown in 1 xylose had a...The optimized promoter for expression control in Bacillus subtilis did not...have the proposed function in E. coli . Whether this is the same in Bacillus...findings the promoter is optimized for control in B. subtilis . While we set...']"},{"machine":"BBa_I6064","videoId":"BBa_I6064","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11J - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0050.E0432...']"},{"machine":"BBa_K750000","videoId":"BBa_K750000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11K - [ Signalling ] ['This part contains pBAD promoter RBS of 1.0 strength GFP lva producer and...this part in our 0 1 dispaly system....arabinose which effect on promoter PBAD an E.coli promoter see more 4 . In...the absence of arabinose cI regulated promoter PcI expresses GFP with LVA...repressor CI protein is translated and represses PcI....called Dual input BCD Decoder. Once the construction is completed Engineered...In order to achieve a better visual impact first thing we concerned is to...optimize conditions for the display device. Concentration of inducers is a...of added additional inducers on circuit. We chose this part as the...strong T7 promoter and empty BL21 DE3 Codon cells. Plotted are the mean...']"},{"machine":"BBa_I6066","videoId":"BBa_I6066","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11L - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0051.E0432...']"},{"machine":"BBa_K750009","videoId":"BBa_K750009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11M - [ Signalling ] ['promoter pBAD which will cause production of protein LuxI and LuxR. The...expression of our reporter GFP under the control of a promoter lux pR ....changed. When expression of LuxI is weak speed of AHL production will go...thrshold of the promoter lux pr. In the time delay part of our project...producer to construct a time delay device. And this part TD1.0 reacts faster...In order to prove that there is a time delay phenomenon when these 3 circuits...We chose the value of fluorescence 5000 to compare. Here is a column chart to...']"},{"machine":"BBa_I6070","videoId":"BBa_I6070","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11N - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0053.E0432...']"},{"machine":"BBa_K750010","videoId":"BBa_K750010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11O - [ Signalling ] ['promoter pBAD which will cause production of protein LuxI and LuxR. The...expression of our reporter GFP under the control of a promoter lux pR ....changed. When expression of LuxI is weak speed of AHL production will go...thrshold of the promoter LuxPR. In the time delay part of our project...In order to prove that there is a time delay phenomenon when these 3 circuit...We chose the value of fluorescence 5000 to compare. Here is a column chart to...']"},{"machine":"BBa_I6076","videoId":"BBa_I6076","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 11P - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0065.E0432...']"},{"machine":"BBa_J202000","videoId":"BBa_J202000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12A - [ Regulatory ] []"},{"machine":"BBa_I715032","videoId":"BBa_I715032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12B - [ Coding,cds, transcriptionalregulator, repressor ] []"},{"machine":"BBa_J202002","videoId":"BBa_J202002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12C - [ Regulatory ] []"},{"machine":"BBa_I714031","videoId":"BBa_I714031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12D - [ Conjugation,DNA, conjugation, function, conjugation ] ['OriT R751 Origin of Transfer for the R751 type conjugative plasmid is the... This part was further characterized by repair the point mutation by...There is a point error G A in No.108bp which may potentially cause...realize point mutation so the key point is the primer design. The forward...primer is 5 cgcctcgtctctcatgccggcggtagccggctgcc 3 and the reverse primer is...5 gcgaggcagccggctaccgccggcatgagagacgaggcg 3 . The PCR experiment is as...see whether PCR is successful which used 15kb marker and 1 gel to run for...']"},{"machine":"BBa_J202003","videoId":"BBa_J202003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12E - [ Regulatory ] []"},{"machine":"BBa_I714044","videoId":"BBa_I714044","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12F - [ Composite ] ['This is I714031 with R0010 Promoter in the front....']"},{"machine":"BBa_J202004","videoId":"BBa_J202004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12G - [ Regulatory ] []"},{"machine":"BBa_I714036","videoId":"BBa_I714036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12H - [ RNA ] []"},{"machine":"BBa_J202005","videoId":"BBa_J202005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12I - [ Regulatory ] []"},{"machine":"BBa_I763015","videoId":"BBa_I763015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12J - [ Intermediate ] []"},{"machine":"BBa_J202006","videoId":"BBa_J202006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12K - [ Regulatory ] []"},{"machine":"BBa_I716208","videoId":"BBa_I716208","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12L - [ Composite,function, recombination, cre ] []"},{"machine":"BBa_J202007","videoId":"BBa_J202007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12M - [ Regulatory ] []"},{"machine":"BBa_I716210","videoId":"BBa_I716210","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12N - [ Coding,cds, enzyme, endonuclease, restriction ] []"},{"machine":"BBa_J202008","videoId":"BBa_J202008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12O - [ Regulatory ] []"},{"machine":"BBa_I716211","videoId":"BBa_I716211","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 12P - [ Coding,cds, enzyme ] []"},{"machine":"BBa_K750012","videoId":"BBa_K750012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13A - [ Signalling ] ['promoter pBAD which will cause production of protein LuxI and LuxR. The...expression of our reporter GFP under the control of a promoter lux pR ....changed. When expression of luxI is weak speed of AHL production will go...thrshold of the promoter lux pR . In the time delay part of our project...In order to prove that there is a time delay phenomenon when these 3 circuit...We chose the value of fluorescence 5000 to compare. Here is a column chart to...']"},{"machine":"BBa_I6080","videoId":"BBa_I6080","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13B - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R1051.E0432...']"},{"machine":"BBa_K763005","videoId":"BBa_K763005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13C - [ Regulatory ] ['1 . A transcription factor binding site inside the promoter UAS1 ...We used the ADH2 promoter which is regulated by two trans acting elements ...both necessary for maximal promoter activity in the absence of a fermentable...When is the protein synthesized Our construction is repressed several...is initiated once the glucose in the medium is depleted....The molecular mechanism underlying this phenomenon is as follows there are...two transcription factors which regulate the promoter ADR1 a carbon source ...in the promoter are bound cooperatively by the transcriptional activators....the ADH2 promoter4. The presence of glucose downregulates the levels of the...production of YAP1 protein by the repression of the ADH2 promoter....express ZsGreen1 and show fluorescence when there is no glucose in the medium....there is presence of ethanol. ...that is in presence of ethanol when glucose is absent. Figure 4 shows...intracellular expression of our protein. Moreover there is such a great level...']"},{"machine":"BBa_I6084","videoId":"BBa_I6084","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13D - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R1053.E0432...']"},{"machine":"BBa_K769020","videoId":"BBa_K769020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13E - [ Composite ] ['Promoter Pbad lux operon DT lumP K769019 ...Bacterial luciferase derived from Vibrio fischeri which is a strain of...luminous bacteria shows brue green light emission wavelength is 495 nm ....phosphoreum and Photobacterium leiognathi . It is known that blue shift of...these luminous bacterium is caused by lumazine protein LumP . LumP shifts the...6 7 dimethyl 8 1 D ribityl lumazine DMRL and its size is about 21kDa. ...The flask on the very right the brightest strain is the strain that is...']"},{"machine":"BBa_I6086","videoId":"BBa_I6086","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13F - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R1062.E0432...']"},{"machine":"BBa_K769022","videoId":"BBa_K769022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13G - [ Composite ] ['transits from high energy state to low energy state light is emitted. ...Resonance Energy Transfer BRET occurs. BRET is a phenomenon that can be...observed when a fluorescence substance is excited by obtaining energy from the...The flask on the very left is the strain that is expressing both lux operon...']"},{"machine":"BBa_I6101","videoId":"BBa_I6101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13H - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0071.E0430...']"},{"machine":"BBa_K863000","videoId":"BBa_K863000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13I - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['bpul laccase from Bacillus pumilus with T7 promoter RBS and HIS tag... Team TU Munich 2013 http 2013.igem.org Team TU Munich improved this part...family of the blue copper proteins. This specific blue copper ion is essential...reaction the electron from the oxidation is transferred to the other three...molecular oxygen is finally reduced to water. ...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...the biobrick part is not of potential allergen status. In 80 amino acid...this biobrick. This also means that there is not of potential allergen status....copper which is needed for the active center of the laccase. Based on the...laccases is illustrated...The chromatogram of the BPUL elution is shown in Figure 2 ...PAGE analysis. The corresponding SDS PAGE is shown in Figure 3....beginning of the deceleration phase. There is no visible break in cell growth...reached after 8 hours of cultivation which is similar to the 3 L fermentation...The chromatogram of the BPUL elution is shown in Figure 5....between the processing volumes of 832 mL and 900 mL there is remarkable...of the UV signal is caused by the increasing imidazol concentration during the...elution gradient. Towards the end of the elution procedure there is a constant...to detect BPUL. The SDS PAGE is shown in Figure 6....fingerprint and the single masses is shown. ...therefore the BPUL concentration is 25 1 g mL 1....enzyme. Still it is expensive to be reliant on CuCl2 and a potential risk...The pH of the medium containing the enzyme is of high importance for its...activity. The pH optima of BPUL are pH 4 and pH 5. This is the result of...this laccase in a waste water treatment plant where the average pH is a pH of...substrates. The bought laccase TVEL0 which is used as positive control is able...control TVEL0 is able to degrade 100 estradiol and ethinyl estradiol. The...graph it is shown that the bought laccase TVEL0 which was used as positive...control is able to degrade more than 90 percent of the used substrates. None...but estradiol is degraded in a range from 16 ECOL to 55 TTHL . The...commercial laccase TVEL0 which was used as positive control is able to degrade...In figure 27 the enzymatic activity of BPUL in the supernatant is compared to...in the supernatant this activity is low compared to the original. ...concentration and iPTG concentration. The protein expression is calculated by...vector signifying that OD 0.4 IPTG 0.4mM and 30 is comparably the best...quality fades it. This band would indicate that the Bpul enzyme is not...shows that not only is the enzyme able to function at these temperatures but...induction is visible....plates containing chloramphenicol 50 g ml .Since BPUL is under the T7...promoter 0.5 mM IPTG was used to induce the bpul gene. The duration of...induction was for 8 hours and the level of protein induced is seen to increase...protein is not significantly higher in induced samples as compared to... http mordred.bioc.cam.ac.uk rapper rampage.php which is visualized from...']"},{"machine":"BBa_I6102","videoId":"BBa_I6102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13J - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0073.E0430...']"},{"machine":"BBa_K863001","videoId":"BBa_K863001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13K - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...means that the biobrick part is not of potential allergen status. In 80 amino...for this biobrick. This also means that there is not of potential allergen...copper which is needed for the active center of the laccase. Based on the...laccases is illustrated...The chromatogram of the BPUL elution is shown in Figure 2 ...PAGE analysis. The corresponding SDS PAGE is shown in Figure 3....beginning of the deceleration phase. There is no visible break in cell growth...reached after 8 hours of cultivation which is similar to the 3 L fermentation...The chromatogram of the BPUL elution is shown in Figure 5....between the processing volumes of 832 mL and 900 mL there is remarkable...of the UV signal is caused by the increasing imidazol concentration during the...elution gradient. Towards the end of the elution procedure there is a constant...to detect BPUL. The SDS PAGE is shown in Figure 6....fingerprint and the single masses is shown. ...therefore the BPUL concentration is 25 1 g mL 1....enzyme. Still it is expensive to be reliant on CuCl2 and a potential risk...The pH of the medium containing the enzyme is of high importance for its...activity. The pH optima of BPUL are pH 4 and pH 5. This is the result of...this laccase in a waste water treatment plant where the average pH is a pH of...substrates. The bought laccase TVEL0 which is used as positive control is able...control TVEL0 is able to degrade 100 estradiol and ethinyl estradiol. The...graph it is shown that the bought laccase TVEL0 which was used as positive...control is able to degrade more than 90 percent of the used substrates. None...but estradiol is degraded in a range from 16 ECOL to 55 TTHL . The...commercial laccase TVEL0 which was used as positive control is able to degrade...In figure 27 the enzymatic activity of BPUL in the supernatant is compared to...in the supernatant this activity is low compared to the original. ...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...means that the biobrick part is not of potential allergen status. In 80 amino...for this biobrick. This also means that there is not of potential allergen...hole and check if there is any leakage. Add marker to the first and last...electrophoresis. The voltage is adjusted to 160V....']"},{"machine":"BBa_I6103","videoId":"BBa_I6103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13L - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0074.E0430... Expression Level of the Mnt and PenI Regulated Promoters... The PenI regulated promoter exhibits a stronger expression than the Mnt ...regulated promoter. ...Applicability of two different promoters was studied for the expression of...and Mnt regulated promoters on pSB1C3 in E. coli MG1655 at OD600 0.3 0.5....From the data obtained it was evident that the PenI regulated promoter...promoter as seen in Figure 1. Furthermore the PenI regulated promoter...']"},{"machine":"BBa_K863005","videoId":"BBa_K863005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13M - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['ecol laccase from E. coli with T7 promoter RBS and His tag...family of the blue copper proteins. This specific blue copper ion is essential...reaction the electron from the oxidation is transferred to the other three...molecular oxygen is finally reduced to water. ...allergenicity. This information is important to the people using these parts...biobricks and the proteins the more likely the biobrick is allergenic cross ...means that the biobrick part is NOT of potential allergen status. In 80 amino...for this biobrick. This also means that there is NOT of potential allergen...0.25 mM CuCl2 to provide a sufficient amount of copper which is needed for...max is lower. In the following hours the OD600 and the agitation speed...This is caused by the cell toxicity of ECOL reference DBU final...The chromatogram of the ECOL elution is shown in Figure 2 ...which is comparable to the 3 L fermentation of E. coli KRX with...induction of protein expression there is a break in cell growth. The death...phase started which is indicated by an increasing pO2 and a decreasing OD600....typical chromatogram of purified laccases is shown...The chromatogram of the ECOL elution is shown in Figure 5 ... except from fraction 11 12 is shown. The red arrow indicates the band of...wash step and the elution are shown this is because of the high UV detection...product peak. A typical chromatogram of purified laccases is illustrated...The chromatogram of the ECOL elution is shown in Figure 8....first peak can be detected. At this point it is not clear which peak contains...our product and which peak is caused by impurities. The corresponding...analytics it is recommended not to use high concentrations of MeOH or...laccase activities and the literature is possible. To find the optimal...make sure that the substrate saturation is given 9 mM ABTS have been used in...since the water in the waste water treatment plants is in average of pH 6.9. ...conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH...a difference of 9 U mg 1 could be detected. One unit is defined as the amount...25 C show a negligible oxidation of ABTS. The activity of ECOL is decreased...substrates. The bought laccase TVEL0 which is used as positive control is able...control TVEL0 is able to degrade 100 estradiol and ethinyl estradiol. The...graph it is shown that the bought laccase TVEL0 which was used as positive...control is able to degrade more than 90 percent of the used substrates. None...but estradiol is degraded in a range from 16 ECOL to 55 TTHL . The...commercial laccase TVEL0 which was used as positive control is able to degrade...In figure 28 the enzymatic activity of ECOL in the supernatant is compared to...in the supernatant this activity is low compared to the original. ...']"},{"machine":"BBa_I6105","videoId":"BBa_I6105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13N - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0077.E0430...']"},{"machine":"BBa_K863006","videoId":"BBa_K863006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13O - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['family of the blue copper proteins. This specific blue copper ion is essential...reaction the electron from the oxidation is transferred to the other three...molecular oxygen is finally reduced to water. ...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...biobrick part is NOT of potential allergen status. In the 80 amino acid...0.25 mM CuCl2 to provide a sufficient amount of copper which is needed for...max is lower. In the following hours the OD600 and the agitation speed...This is caused by the cell toxicity of ECOL reference DBU final...The chromatogram of the ECOL elution is shown in Figure 2 ...which is comparable to the 3 L fermentation of E. coli KRX with...induction of protein expression there is a break in cell growth. The death...phase started which is indicated by an increasing pO2 and a decreasing OD600....typical chromatogram of purified laccases is shown...The chromatogram of the ECOL elution is shown in Figure 5 ... except from fraction 11 12 is shown. The red arrow indicates the band of...peptid mass fingerprint and the single masses is shown with a sequence...coverage of 26 1 . It can be assumed that the isolated protein is ECOL. ...Figure 10. A distinct pH optimum can be seen at pH 5. Saturation is reached...seen at a pH of 5 after 5 hours 15 ABTS is oxidized by CuCl2 alone....With regard to our project knowledge of the optimal pH is useful. Since waste...kept in mind that a adjustment of the pH is necessary for optimal laccase...2 difference in oxidized ABTS is observable. The negative control without the...expected the observed reduction in enzyme activity is problematic for the...laccase activities and the literature is possible. To find the optimal...make sure that the substrate saturation is given 9 mM ABTS have been used in...since the water in the waste water treatment plants is in average of pH 6.9. ...conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH...a difference of 9 U mg 1 could be detected. One unit is defined as the amount...25 C show a negligible oxidation of ABTS. The activity of ECOL is decreased...coverage of 26 1 . It can be assumed that the isolated protein is ECOL....substrates. The bought laccase TVEL0 which is used as positive control is able...control TVEL0 is able to degrade 100 estradiol and ethinyl estradiol. The...it is shown that the bought laccase TVEL0 which was used as positive control...estradiol is degraded in a range from 16 ECOL to 55 TTHL . The original...commercial laccase TVEL0 which was used as positive control is able to degrade...In figure 21 the enzymatic activity of ECOL in the supernatant is compared to...in the supernatant this activity is low compared to the original. ...']"},{"machine":"BBa_I13503","videoId":"BBa_I13503","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 13P - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] []"},{"machine":"BBa_J202009","videoId":"BBa_J202009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14A - [ Regulatory ] []"},{"machine":"BBa_I716106","videoId":"BBa_I716106","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14B - [ T7 ] ['T7 Promoter Mutant D ...This is a T7 Promoter which is transcribed only when the T7 RNA Polymerase is...']"},{"machine":"BBa_J202010","videoId":"BBa_J202010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14C - [ Regulatory ] []"},{"machine":"BBa_I716107","videoId":"BBa_I716107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14D - [ T7 ] ['T7 Promoter Mutant E ...This is a T7 Promoter which is transcribed only when the T7 RNA Polymerase is...']"},{"machine":"BBa_J202011","videoId":"BBa_J202011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14E - [ Regulatory ] []"},{"machine":"BBa_I718009","videoId":"BBa_I718009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14F - [ Project ] []"},{"machine":"BBa_J202012","videoId":"BBa_J202012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14G - [ Regulatory ] []"},{"machine":"BBa_I718011","videoId":"BBa_I718011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14H - [ Translational_Unit ] []"},{"machine":"BBa_J202013","videoId":"BBa_J202013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14I - [ Regulatory ] []"},{"machine":"BBa_I718012","videoId":"BBa_I718012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14J - [ Project ] []"},{"machine":"BBa_J202014","videoId":"BBa_J202014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14K - [ Regulatory ] []"},{"machine":"BBa_I718013","videoId":"BBa_I718013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14L - [ Project ] []"},{"machine":"BBa_K909009","videoId":"BBa_K909009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14M - [ Coding,cds, receptor ] ['UVR8 UV resistance locus 8 is UV B photoreceptor found in plants as a...light is absorbed by these triptophanes and later used to break dimer cross ...']"},{"machine":"BBa_I718014","videoId":"BBa_I718014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14N - [ Translational_Unit ] []"},{"machine":"BBa_K909014","videoId":"BBa_K909014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14O - [ Composite ] ['PABA is derived from the aromatic branch point precursor chorismate in two...leads to overproduction of pABA. ADC synthase is composed of two subunits ...pABA is synthesized from chorismate in a 2 step process unsing pabA pabB and...']"},{"machine":"BBa_I718015","videoId":"BBa_I718015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 14P - [ Project ] []"},{"machine":"BBa_K863010","videoId":"BBa_K863010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15A - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['tthl laccase from Thermus thermophilus with T7 promoter RBS and His tag...Slovenia HS characterized this part in 2015....knowledge there is no functional IPTG regulated fungal laccase in the iGEM...']"},{"machine":"BBa_I13519","videoId":"BBa_I13519","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15B - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_K863011","videoId":"BBa_K863011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15C - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['sufficient amount of copper which is needed for bilding the active center....which has a constitutive promoter instead of the T7 promoter system....molecular weight of 53 kDa and the corresponding band is marked with a red...under the control of a T7 promoter. Activity tests of...constitutive promoter did reveal TTHL laccases capable of oxidizing ABTS. The...second best fraction which is fraction 5 3 was added to fraction 50 1....Figure 5 the substrate saturation is not reached with 5 mM ABTS. An...The pH of the medium containing the enzyme is very important for its activity....The pH optimum of TTHL is at pH 5. This is the result of activity measurements...than pH 5 the activity of TTHL is decreased considerably. The resulting Units...calculated for TTHL. At pH 4 and 6 the activity is decreased to 42 and at pH...7 even to 14 in comparison to pH 5. But still TTHL is active at this pH...the average pH is a pH of 6.9. However a combination with a more effective...conditions. The highest specific enzyme activity for ABTS is under pH 5...temperatures a difference of 2 U mg 1 could be detected. One unit is defined...difference observed between the two samples is great news for the possible...substrates. The bought laccase TVEL0 which is used as positive control is able...control TVEL0 is able to degrade 100 estradiol and ethinyl estradiol. The...graph it is shown that the bought laccase TVEL0 which was used as positive...control is able to degrade more than 90 percent of the used substrates. None...but estradiol is degraded in a range from 16 ECOL to 55 TTHL . The...commercial laccase TVEL0 which was used as positive control is able to degrade...']"},{"machine":"BBa_I14044","videoId":"BBa_I14044","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15D - [ Translational_Unit,function, regulation, transcriptional ] []"},{"machine":"BBa_K863020","videoId":"BBa_K863020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15E - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['bhal laccase from Bacillus halodurans with T7 promoter RBS and His tag...transformed with these parts each of which contained a T7 promoter and...']"},{"machine":"BBa_I13013","videoId":"BBa_I13013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15F - [ Measurement,classic, measurement, uncategorized ] ['consists of Lac or Tet promoter one of the four RBS s B0030 B0033 a YFP...']"},{"machine":"BBa_K861031","videoId":"BBa_K861031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15G - [ Coding ] ['FadJ is the anaerobic counterpart of FadB. This protein is shown to have...']"},{"machine":"BBa_J61016","videoId":"BBa_J61016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15H - [ Other ] ['the process the OnRFP cassette is destroyed allowing Red to White screening...The registry sequence is blunt relative to XbaI SpeI....']"},{"machine":"BBa_K861042","videoId":"BBa_K861042","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15I - [ Coding ] [' E.coli . S is used to distinguish FadA gene in E.coli ...']"},{"machine":"BBa_J37019","videoId":"BBa_J37019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15J - [ Project ] []"},{"machine":"BBa_K907000","videoId":"BBa_K907000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15K - [ Coding,function, recombination ] ['Bxb1 is a phage integrase that mediates unidirectional site specific...event is hereon referred to as a flip. Bxb1 belongs to the family of serine...K2116024 with a promoter flanked between attB and attP sites... TetR was expressed under the control of medium strength constitutive promoter Part Bba J23118 wiki index.php title Part Bba J23118 action edit redlink 1 Part Bba J23118 page does not exist and cloned onto a low copy plasmid with pSC101 Rep101 replication of origin and Kanamycine resistance. ...the used positive controles is reached at around 11 hours under these...to the control where there is no TetR we see 6 fold less flipping. This... Figure 1 Time and dose response of bxb1 flipping a directional promoter....between the two constructs is that the non codon optimised bxb1 has a weaker...efficiency. Test constructs have Bxb1 expressed under the Tet promoter with...This part has been improved by iGEM Peking 2017. The improved Part is... To reduce leakage when not induced AraC is expressed under a constitutive promoter cloned on a high copy plasmid with pUC19 replication of origin and Ampicillin resistance....Due to the leakage before inducing the LR rate changing is not obvious which...means the Bxb1 integrase is highly efficient and the leakage may be reduced...']"},{"machine":"BBa_R2109","videoId":"BBa_R2109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15L - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative ] ['Promoter with operator site for C2003...This promoter is designed to bind to C2003.... promoter ...']"},{"machine":"BBa_K733012","videoId":"BBa_K733012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15M - [ Composite,function, celldeath ] ['This construct is for the characterization of the cell growth inhibition...device. pTms RBS ydcD is for the stabilization of the cell growth...However as long as the induction level is strong enough and reaches a...Xylose inducible promoter with ydcE gene ...The rationale for including this growth inhibition device is that over dose of...2012 Thus a growth inhibition device is introduced and will be...The objective of this characterization is to find out what is the minimal...regulator for the xylose inducible promoter....promoter....constitutive promoter....carbon source is that glucose can repress the induction of xylose. Kim Mogk...']"},{"machine":"BBa_J61051","videoId":"BBa_J61051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15N - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive ] [' Psal1 J61051 pSB1A2 Bca9015 Salicylate promoter... sal promoters to activate transcription in response to the inducer...degrades naphthalene Naphthalene is degraded into salicylate by enzymes...encoded by the upper operon salicylate is further degraded to enter TCA...naphthalene Naphthalene is degraded by a series of enzymatic reactions each...domain is putatively involved in multimerization of NahR during the... Promoter Structure ... Figure.3 Schematic diagram for the NahR regulated promoters nah and... sal . Alignment of sal and nah promoter is shown and the consensus... nah promoter by NahR in the presence of inducer salicylate. 1 . The DNA...structure of sal promoter A B C and D represent the binding sites for the...tetramer of NahR the yellow arrow shows the direction of sal promoter.... 2 . RNAP and 70 bind to the sal promoter by recognizing 35 and 10...boxes 3 . Transcription factor NahR tightly binds to sal promoter and...forms a tetramer no matter whether there is salicylate or not 4 . When...salicylate is present NahR DNA complex undergoes a conformational change....After the hydrolysis of ATP DNA is opened and transcription is activated.... Fig.5 . NahR is constitutively expressed by a constitutive promoter ... Pc and the expression of sfGFP is positively regulated by NahR in the...Promoters are presented in orange RBS in light green coding sequence in dark...spectrum. The structure formula of typical inducer is also listed around the...which is one of the main features we expect for our aromatics sensing toolkit ...inducer A. It s x coordinate represents the fluorescence when inducer B is 0...and the y coordinate represents the fluorescence when the cell is exposed to a...points are supposed to be aligned in a line whose slope is one.... Characterization of the Inducible Promoter...The NYMU Taipei igem team characterize this part as an inducible promoter with... http parts.igem.org wiki images 4 4e Promoter test.jpg ...The inducible promoter was induced with different concentration 0 1.50E 07 ... http parts.igem.org wiki images 4 4f Nymu taipei Promoter.jpg ...The inducible promoter was induced with different concentration 0 1.50E 07 ...maximal promoter activity and K is the salicylic acid concentration while P... Characterization of the Inducible Promoter...The Uppsala igem team characterize this part as an inducible promoter with the...We tested the NahR Psal promoter system with dTomato on a pSB1C3 plasmid. The...binding to nah and sal promoters. J. Bacteriol . 171 2 837 4 Jianzhong... promoter ...']"},{"machine":"BBa_K797000","videoId":"BBa_K797000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15O - [ Coding ] ['This part is involved in TAT protein export pathway of E.coli. The part...']"},{"machine":"BBa_J04421","videoId":"BBa_J04421","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 15P - [ Reporter,classic, reporter, pret ] ['ECFP Coding Device with Promoter RBS Coding Sequence and Terminator...IPTG Inducible Promoter RBS ECFP with LVA tag Terminator...This part will be made using standard digestion and ligation techniques...']"},{"machine":"BBa_K909015","videoId":"BBa_K909015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16A - [ Composite ] ['p ABA overproduction composite without promoter...p ABA is derived from the aromatic branch point precursor chorismate in two...leads to overproduction of p ABA. ADC synthase is composed of two subunits ...pABA is synthesized from chorismate in a 2 step process unsing pabA pabB and...']"},{"machine":"BBa_S03855","videoId":"BBa_S03855","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16B - [ Intermediate ] []"},{"machine":"BBa_K909005","videoId":"BBa_K909005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16C - [ Composite ] ['operon. eYFP serves as a real time indicator of cI expression. This part...']"},{"machine":"BBa_S03857","videoId":"BBa_S03857","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16D - [ Intermediate ] []"},{"machine":"BBa_K812010","videoId":"BBa_K812010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16E - [ Device ] ['This part is a GFP coding sequence fused to an AID tag for its recognition by...the eukaryote cell. This is designed to be used in pSB1C3 vector....This part is a part of a device patented by Kanemaki Masato Kakimoto Tatsuo ...']"},{"machine":"BBa_S03858","videoId":"BBa_S03858","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16F - [ Intermediate ] []"},{"machine":"BBa_K812020","videoId":"BBa_K812020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16G - [ Coding ] ['This part contains the coding sequence for Indoleacetamide hydrolyase IaaH ....This part is from...']"},{"machine":"BBa_S03859","videoId":"BBa_S03859","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16H - [ Intermediate ] []"},{"machine":"BBa_K936020","videoId":"BBa_K936020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16I - [ Composite ] ['in this part most likely exhibits its intended function as an esterase....length corresponding to cutinase 30 kDa is being secreted from the cell. ...measured by the absorbance at 405 nm. It is clearly shown that the activity of...cells expressing cutinase is much higher the background negative control ....the protein. More detailed information on our methods is available here ...at an imidazole concentration of 10mM. Usually this elute is used to remove...that the band is present on the Western Blot suggests that the his tag is able...']"},{"machine":"BBa_I742109","videoId":"BBa_I742109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16J - [ Translational_Unit,classic, generator, RC, function, biosynthesis, function, odor ] ['aromatic ring to produce ferulic acid. COMT is the third gene in the artifical...']"},{"machine":"BBa_K876002","videoId":"BBa_K876002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16K - [ Composite ] ['Constitutive promoter for LacI repressed by TetR...']"},{"machine":"BBa_S03877","videoId":"BBa_S03877","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16L - [ Intermediate ] []"},{"machine":"BBa_K876004","videoId":"BBa_K876004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16M - [ Composite ] []"},{"machine":"BBa_I13452","videoId":"BBa_I13452","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16N - [ DNA,dna, cloningsite ] []"},{"machine":"BBa_K909003","videoId":"BBa_K909003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16O - [ Coding ] ['Cph8 is the fusion of Cph1 a red light sensitive phytochrome and the EnvZ...function in the ompC promoter region....']"},{"machine":"BBa_I13500","videoId":"BBa_I13500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 16P - [ Composite,classic, composite, uncategorized ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K759012","videoId":"BBa_K759012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17A - [ Composite ] ['eCFP E. coli aggregation Ag43 device induced by pBAD promoter....In the presence of L arabinose pBAD promoter is induced and then wildtype...aggregation function of this part....']"},{"machine":"BBa_J13023","videoId":"BBa_J13023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17B - [ Regulatory,classic, regulatory, uncategorized, plasmidbackbone, expression, inducible ] []"},{"machine":"BBa_K786002","videoId":"BBa_K786002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17C - [ Device,cds, membrane, receptor, chassis, prokaryote, ecoli, classic, signalling, sender, function, sensor, light, plasmid, expression ] ['phototaxis. CheA is able to phosphorylate CheY where phosphorylated CheY is a...HtrII is the transducer protein of SRII and belong to the M ethyl ...']"},{"machine":"BBa_J06504","videoId":"BBa_J06504","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17D - [ Reporter,cds, reporter, rfp, function, reporter, fluorescence ] ['mCherry is one of several second generation monomeric fluorescent proteins...internal RBS start. The 10th amino acid is a Met which is preceded by...AGGAGGA NNNN . This is almost a perfect consensus RBS so it seems quite likely...acids is not expected to have much effect on fluorescence. If this is truly a...The copy as provided in the 2010 distribution is incorrect it contains 500...bp of something that is not mCherry between the VF2 and VR sites. You can get...This part has been improved to be the mCHERRY UNIT including a degradation tag...successfully tested as a reporter in this chassis. We have used this part to...other bands visible so the purity is not optimal. However the contrast...between the huge blobs and the other bands is very big....It is expressed in pEZ 15A plasmid with a PlacUV5 promoter. LAS Z was used to...were able to create the red fluorescent protein mCherry. mCherry is a 26.7 kDa...helices. The chromophore is made of methionine tyrosine and glycine who...during the IMPACT purification is mediated through incubation of the column...The results show that there is no significant decrease in the fluorescence...An often stated advantage of mCherry is its low acid sensitivity. To analyze...while the pH optimum is 6 7. Interestingly the fluorescence intensity seems to...']"},{"machine":"BBa_K786003","videoId":"BBa_K786003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17E - [ Device,cds, membrane, receptor, chassis, prokaryote, ecoli, classic, signalling, sender, function, sensor, light, plasmid, expression ] ['phototactic effect which is sensitive to orange light with sensing spectra...phototaxis. CheA is able to phosphorylate CheY where phosphorylated CheY is a...HtrII is the transducer protein of SRII and belong to the M ethyl ...']"},{"machine":"BBa_J06602","videoId":"BBa_J06602","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17F - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K863021","videoId":"BBa_K863021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17G - [ Coding,cds, enzyme, function, degradation, proteindomain, degradation ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...that the biobrick part is NOT of potential allergen status. In 80 amino acid...this biobrick. This also means that there is NOT of potential allergen status....has a molecular weight of 56 kDa and is marked with an arrow....corresponds to the elution fraction 2 a faint band of 56 kDa is visible....this is because of the high UV detection signal of the loaded samples and to...of purified laccases is illustrated...The chromatogram of the BHAL elution is shown in Figure 3 ...BHAL is not as suitable as thought for an application at a waste water...temperatures a difference of 3 U mg 1 could be detected. One unit is defined...substrates. The bought laccase TVEL0 which is used as positive control is able...control TVEL0 is able to degrade 100 estradiol and ethinyl estradiol. The...graph it is shown that the bought laccase TVEL0 which was used as positive...control is able to degrade more than 90 percent of the used substrates. None...but estradiol is degraded in a range from 16 ECOL to 55 TTHL . The...commercial laccase TVEL0 which was used as positive control is able to degrade...']"},{"machine":"BBa_I13457","videoId":"BBa_I13457","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17H - [ DNA,dna, cloningsite ] []"},{"machine":"BBa_K895002","videoId":"BBa_K895002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17I - [ Coding ] ['This is a coding part comprising the full open reading frame of the gene...TssI . VgrG is an important component of bacterial Type VI Secretion Systems...and is believed to locate at the very tip of the Type VI secretion device....']"},{"machine":"BBa_I13541","videoId":"BBa_I13541","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17J - [ Temporary,classic, temporary, uncategorized ] ['Intermediate in two promoter screening plasmid...']"},{"machine":"BBa_K861110","videoId":"BBa_K861110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17K - [ Coding,function, biosynthesis, cellulose ] ['cellulose in Escherichia coli . BcsB is involved in biosynthesis of...cellulose which is a significant constituent of the extracellular matrix...']"},{"machine":"BBa_I13523","videoId":"BBa_I13523","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17L - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K741002","videoId":"BBa_K741002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17M - [ Generator ] ['Lac promoter with GFP gene downstream. LacI or glucose can repress the...Initially we use IPTG to activate the promoter plac. However we find that...the leak expression of plac is quite high. Even without the existence of IPTG ...GFP expresses. This is because there are no lacI genes on the plasmid bones...groups with glucose added is lower than the blank group because glucose...which we ascribe to the unstability of the promoter plac. About 90 minutes...groups with different concentrations of glucose added is not strictly related...Plac is one of the most common promoter in life science research field. It is...promoter so the genes downstream expression are blocked. Serving as inducer ...so LacI is detached from LacO site which enables the transcription of...however there is no LacI gene in it. Although the E.coli could express some...LacI it is not enough for inhibition GFP expression. So this GFP generator...the downstream of Plac which is regulated by LacI inhibitor and IPTG inducer....which is considered as waste of resources. We detected the response of this...fluorescent intensity is fluorescence per OD600 standardized with fluorescence...under IPTG existance. The leakage expression is very low and it is sensitive...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...very sensitive to the IPTG induction and the GFP leakage expression is very... 4. Add 100 l bacteria culture medium into a sterile 96 well plate. IPTG is added to final concentrations of 1 2 5 10mM. M9 medium is the blank control. Constantly expressing EGFP colony is the positive control and colony without EGFP expression is the negative control. ...We characterized this part using fluorescence at different concentrations of...is very leaky as expression is high even in samples where no IPTG was added....expression is highly leaky in cells that don t have a lacIQ inhibitor....lactose and IPTG can activate it. The lac promoter with GFP gene downstream...to GFP expression. The strains used in this characterization is TOP10 BL21 ...fluorescence is measured using plate reader. ...in the solution. The plasmids in the solution is precipitated and spun in...shown in bars and tables below. Optical Density is repeatly measured after 15... cAMP is inversely proportional to that of glucose. It binds to the CAP ...concentration is high and binding of CAP cAMP to the DNA significantly...and the GFP system is deactivated. On the other hand IPTG works almost...lactose hydrolysis thus the GFP system is activated. ...the leak expression of plac is quite high. E. coli can not express enough lacI...expressed. This is why the control group 0 mM glucose produced the highest...control for 1 hour. The DNA band is not parallel to any of the marker. That s...as the highest molecular weight. Whereas the pSB1C3 is 2070 bp and the...both strains might be lower. Hence the isolated DNA is less or there may be...']"},{"machine":"BBa_I13542","videoId":"BBa_I13542","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17N - [ Composite,classic, composite, uncategorized ] ['Intermediate in two promoter screening plasmid...']"},{"machine":"BBa_K741008","videoId":"BBa_K741008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17O - [ Generator ] []"},{"machine":"BBa_I7108","videoId":"BBa_I7108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 17P - [ Measurement,classic, measurement, uncategorized ] ['p22 cII is a member of the lamboid cI protein family. Weak medium promoter.... jb 5 24 04 Note p22 cII is not compatible with B0030 rbs due to likely...']"},{"machine":"BBa_K909006","videoId":"BBa_K909006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18A - [ Coding ] []"},{"machine":"BBa_I13502","videoId":"BBa_I13502","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18B - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K880002","videoId":"BBa_K880002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18C - [ Measurement ] [' IRR K137008 inverted tetR promoter K137047 IRL K137010 GFP I13504 MI275 GFP fluorescence reporter to assay the activity of FimE K137007 and HbiF K880000 recombinases. ...It is a GFP fluorescent reporter capable of assaying the functionality of fim...Repeat sequence in this part exist in the correct wild type orientation.... Use of this Part in Characterizing the FimE Recombinase...Team Michigan 12 used this part to characterize its recombinase based switch...the IRL and IRR is the determinative factor to the inversion negative results....']"},{"machine":"BBa_I13504","videoId":"BBa_I13504","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18D - [ Reporter,classic, reporter, ret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K847101","videoId":"BBa_K847101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18E - [ Composite ] ['forms the outer surface of the filament and is highly variable....to express metal binding sequences and our part is an improvement on the...']"},{"machine":"BBa_I15016","videoId":"BBa_I15016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18F - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] ['This part accepts POPS to produce ECFP under the medium RBS B0032...']"},{"machine":"BBa_K801070","videoId":"BBa_K801070","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18G - [ Coding,cds, cds, biosynthesis, chassis, eukaryote, yeast ] ['This part encodes for xanthosine methyltransferase CaXMT1 from Coffea...This part is based upon the mRNA sequences having been isolated out of coffea...This part is characterized in Saccharomyces cerevisiae by having cloned it...Caffeine is a purine alkaloid and its biosynthesis occurs in coffee plants and...tea plants. Its chemical structure is similar to that of the ribonucleoside...activity it is used as a means to stay awake. On average one cup 150 ml of...coffee or tea leading to physiological effects is usually a little bit...methyl donor and is located in the cytoplasm of the plants. Furthermore it...enzymes.info . Besides the enzyme CaXMT1 is highly imaginable to work in a...the intermediate 7 methylxanthine which is the substrate for the second...a matter of fact a single N methyl nucleosidase as it is shown on the... according to N end rule and the yeast consensus sequence for improved ribosome binding the first triplet after ATG GAG was exchanged with TCT serine to optimize both protein stability and mRNA translation. This decision was made after proofing the 3D structure of the enzyme CaDXMT1. Due to the fact that the first two residues of the amino acid sequence are not shown in the crystalized structure probably because of high flexibility we chose to exchange this amino acid because it is probably not necessary for the uptake of the ligands uniprot http www.uniprot.org uniprot Q9AVK0 entry further shows that it is not immediately involved in ligand binding . Because of the high similarity of the enzyme sequences we also exchanged this amino acid....']"},{"machine":"BBa_I15017","videoId":"BBa_I15017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18H - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] ['This part accepts POPS to generate EYFP under the medium strength RBS B0032.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K801071","videoId":"BBa_K801071","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18I - [ Coding,cds, cds, biosynthesis, chassis, eukaryote, yeast ] ['This part encodes for 7 methylxanthine N methyltransferase CaMXMT1...This part is based upon the mRNA sequences having been isolated out of coffea...This part is characterized in Saccharomyces cerevisiae by cloning it into a...Caffeine is a purine alkaloid and its biosynthesis occurs in coffee plants and...tea plants. Its chemical structure is similar to that of the ribonucleoside...activity it is used as a means to stay awake. On average one cup 150 ml of...coffee or tea leading to physiological effects is usually a little bit... S Adenosyl Methionine als methyl donor and is located in the cytoplasm of... according to N end rule and the yeast consensus sequence for improved ribosome binding the first triplet after ATG GAG was exchanged with TCT serine to optimize both protein stability and mRNA translation. This decision was made after proofing the 3D structure of the enzyme CaDXMT1. Due to the fact that the first two residues of the amino acid sequence are not shown in the crystalized structure probably because of high flexibility we chose to exchange this amino acid because it is probably not necessary for the uptake of the ligands uniprot http www.uniprot.org uniprot Q9AVJ9 entry further shows that it is not immediately involved in ligand binding . Because of the high similarity of the enzyme sequences we also exchanged this amino acid....']"},{"machine":"BBa_B0040","videoId":"BBa_B0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18J - [ DNA,classic, other, uncategorized, DNA, spacer ] ['BioBrick part containing the promoter of the new gene. Please use the AlignX...It is not clear if spacers are needed or not in the final assembly. A spacer...transcriptional machinery at the promoter of the next module in the assembly...the transcription of the previous module is taking place. However there is no... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K801072","videoId":"BBa_K801072","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18K - [ Coding,cds, cds, biosynthesis, chassis, eukaryote, yeast ] ['This part encodes for 3 7 dimethylxanthine N methyltransferase CaDXMT1...This part is based upon the mRNA sequences having been isolated out of coffea...This part is characterized in Saccharomyces cerevisiae by cloning it into a...Caffeine is a purine alkaloid and its biosynthesis occurs in coffee plants and...tea plants. Its chemical structure is similar to that of the ribonucleoside...activity it is used as a means to stay awake. On average one cup 150 ml of...coffee or tea leading to physiological effects is usually a little bit... according to N end rule and the yeast consensus sequence for improved ribosome binding the first triplet after ATG GAG was exchanged with TCT serine to optimize both protein stability and mRNA translation. This decision was made after proofing the 3D structure of the enzyme CaDXMT1. Due to the fact that the first two residues of the amino acid sequence are not shown in the crystalized structure probably because of high flexibility we chose to exchange this amino acid because it is probably not necessary for the uptake of the ligands uniprot http www.uniprot.org uniprot Q8H0D2 entry further shows that it is not immediately involved in ligand binding . Because of the high similarity of the enzyme sequences we also exchanged this amino acid....']"},{"machine":"BBa_I13001","videoId":"BBa_I13001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18L - [ Reporter,classic, reporter, ret ] ['This part was found to express well when excited with fluorescence in the...We expressed this part in E.coli using pbad promoter and J23116 promoter.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K801092","videoId":"BBa_K801092","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18M - [ Coding,cds, cds, biosynthesis, chassis, eukaryote, yeast ] ['carried out by the enzyme chalcone synthase CHS E . Chalcone is isomerised...']"},{"machine":"BBa_J61001","videoId":"BBa_J61001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18N - [ DNA,plasmid, component, origin ] ['the absence of a second origin. In most E. coli strains this is a silent... This part belongs to a family useful for the construction of transposons and... FRT The FRT sequence is the recombination substrate for Flp... Transposition mutagenesis is usually carried out by mating a donor strain... transposon is excised from the plasmid and inserts randomly into the...resulting picture of an 1 2 agaraose gel of the PCR product is shown in...resulting table is shown below ...low compared to ori pMB1 but expected as the copy number of ori R6K is 15 20...and the copy number of ori pMB1 is 500 700 Morgan K. 2014 February 14 ....']"},{"machine":"BBa_K801093","videoId":"BBa_K801093","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18O - [ Coding,cds, cds, biosynthesis, chassis, eukaryote, yeast ] ['carried out by the enzyme chalcone synthase CHS E . Chalcone is isomerised...']"},{"machine":"BBa_J23119","videoId":"BBa_J23119","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 18P - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...BerkiGEM2006 Promoters.jpg File BerkiGEM2006 Promoters.jpg ... Constitutive promoter family ...Parts J23100 through J23119 are a family of constitutive promoter parts...isolated from a small combinatorial library. J23119 is the consensus ...promoter sequence and the strongest member of the family. All parts except...J23119 are present in plasmid J61002. Part J23119 is present in pSB1A2. This...places the RFP downstream of the promoter. Reported activities of the...promoters are given as the relative fluorescence of these plasmids in strain...These promoter parts can be used to tune the expression level of...within these promoter parts make them a scaffold for further modification. ...JCAraw Berk2006iGEM JCATCPromoterRaw Berk2006iGEM JCATCPromoterRaw ... Amsterdam 2020 Relative promoter strength in Synechocystis PCC6803 and...strength of promoters in Synechocystis PCC6803 Synechocystis and UTEX...2973 . 20 previously defined consecutive promoters including the promoters...promoter originating from Escherichia Coli PBAD Abe et al. 2014 were...compared. Besides they constructed 8 mutant promoters from the...The promoters were assembled in a pPMQAK1 T to drive eYFP expression. To the...promoter sequences a lac operon lacO and ribosomal binding site was...over 10 000 cells was used to compare the strength of the individual promoters...of the expression of the synthetic promoters in both strains was studied see...for Synechosystis the strength of the promoters has similar patterns in... Figure 1. Expression levels of heterologous and synthetic promoters in...Ptrc10 promoter design Huang et al. 2010 . B . Expression levels of eYFP...driven by promoters in Synechocystis and UTEX 2973 calculated from...of expression levels of synthetic promoters tested in Synechocystis and... UTEX 2973 . The coefficient of determination R2 is shown for the J23119...library red new synthetic promoters pink and trc variants dark red ....cultures were 3.5 6 0.2 and 3.6 6 0.2 respectively . Caption is cited from...Cytometry as a reference for the TALE stabilized promoter library. ... UP119 is modified by addition of an up element.... TALE2 sp6 is a TALE stabilized variant of J23119....the regulation of the constituve Anderson Family promoters ... lactamase is an enzyme that hydrolyses lactams e.g. ampicillin and is...To achieve that the coding sequence was assembled with each promoter a...the different promoters of the Anderson family. We tested different annealing...temperatures 45 47 53 aiming for clear results. The expected band is at... lactamase gene under the control of different promoters J23100 J23105 ... 490nm is divided by cell growth 600nm in order to normalize all values.... brown line which is the wild type promoter of the Anderson family. The...expression is reduced with the J23100 and J23106 yellow and purple line...J23105 promoter blue line . These results are in accordance with those from...previous teams that measured fluorescence and the same pattern is observed....Our team tested several constitutive promoters and rbs combinations for the...promoter did not work under our experimental conditions. So we found another...promoter and J23119 was one of the constitutive promoter candidates. We...combined three strong RBSs with this promoter and measured the expression of...the pDawn vector is important for the expression of mScarlet....After an attempt to clone this promoter upstream of the Citrine reporter gene...used with the promoters and realized that it would need to be improved. We...appropriately compatible with the Anderson Promoter Kit plate....We hope that when we use an unrepresentated promoter we can easily and...accurately get its relative strength in the already characterized promoter...Therefore we constructed the promoter strength measurement vector...Figure 1. The fluorescence of each promoter changes with time fluorescence ...calculated the relative fluorescence intensity of each promoter for it based...promoters. The reason of which might be the fusion genes influenced the...relatve expression level of the promoter....Anderson promoter was not consistent with reported relative expression.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter anderson ...']"},{"machine":"BBa_K741020","videoId":"BBa_K741020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19A - [ Composite ] ['We make this part in the middle of the progress of making the part plac RBS ...']"},{"machine":"BBa_I13528","videoId":"BBa_I13528","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19B - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K822002","videoId":"BBa_K822002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19C - [ Coding ] ['disease. This part is derived from...The part was placed under a constitutive promoter and cell growth experiments...Colicin E1 is considered safe for use as a food preservative and humans are...']"},{"machine":"BBa_M30011","videoId":"BBa_M30011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19D - [ Measurement,classic, measurement, uncategorized ] ['Positively regulated OmpR controlled promoter from OmpC gene R0082 ...alternative clone is M30012. Cells bearing this construct are pale pink.... Leaky Expression by the OmpR Regulated Promoter on Different Vectors... Leaky expression by the OmpR regulated promoter is reduced when cloned into...The expression properties of the OmpR regulated promoter were investigated...background generated by stimulation of the intrinsic OmpR system is removed ...that the OmpR regulated promoter mediated gene expression even in the absence...promoter on a high copy vector in E. coli strain S 928 OmpR....promoter required a low copy plasmid or insertion into the chromosome. Protein...promoters the experiment was carried out in both LB medium and M9 minimal...of RFP expressed by the the OmpR regulated promoter on the high copy vector ...coli MG1655 and the weak and strong constitutive promoters are included as...references. Standard error of mean is shown but are in several cases...that mediated by the strong constitutive promoter. On the low copy vector the...expression mediated by the weak constitutive promoter. On the other hand ...All things considered the OmpR regulated promoter was found to exhibit leaky...promoters. When cloned into a low copy vector the leaky expression was...the OmpR dependent promoter a low copy vector is required....']"},{"machine":"BBa_K863204","videoId":"BBa_K863204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19E - [ Device,chassis, eukaryote, pichia, chassis, eukaryote, yeast ] ['like laccase which needed glycolisation is the basic concept. The shuttle...gene aox1 containing the aox1 promoter region Kozak sequence mating...MFalpha1 taged POI is able via the 5 UTR and 3 UTR of the aox1 gene. This...instead of a zeocine resistance. This selection strategy is chosen because we...']"},{"machine":"BBa_J01060","videoId":"BBa_J01060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19F - [ Intermediate,classic, intermediate, uncategorized ] ['control of the pTET promoter. A quantifiable demonstration of the function of...']"},{"machine":"BBa_K929003","videoId":"BBa_K929003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19G - [ Composite ] ['The BioBrick modified AID with CMV hGH polyA and eGFP is an extended...of 3 parts CMV promoter...For using different promoters or terminators see...AID is known to be responsible for somatic hypermutation and the class switch...The AID motif is naturally terminated with the Nuclear Export Sequence NES ...stranded DNA it is supposed that the direction of the enzyme to the inside of...This part of the BioBrick directs the expressed protein into the nucleus ...Kozak consensus sequence is added upstream of the AID mutant to express the... CMV promoter ...CMV is an immediate early Cytomegalovirus promoter for high level expression....The CMV promoter is commonly used due to its very strong activity and...effectivity in a broad range of cell types. The BioBrick is therefore improved...via addition of the strong promoter....Polyadenylation is a significant part for the translation and stability of...mRNA. In eukaryotes it is part of the process that produces mature messenger...In order to test where and if the AID modified sequence is functional we added...to it a eGFP protein. It is used as a marker gene for detection of transfected... Aditional AgeI restriciton site This part has an aditional AgeI...25 tools.ietf.org html rfc25 is displayed. Actually fusion with RFC...25 tools.ietf.org html rfc25 parts is possible C terminal of CMV modified...AID eGFP but hGH polyadenylatiosequence must be added again. CMV promoter and...with CMV promoter and hGHpolyA . Therefor we cotransfected CHO cells with a...There is a significant higher mutation rate when wildtype AID modified AID or...modified AID eGFP is added compared to the same experiment without AID....Surprisingly the mutation rate of wt AID is two times higher than the...observation is contrary to our expectation. The modified AID eGFP is located...higher mutation rate. One possible explanation is that the modified AID has a...reflect this. It is also shown that transfected cells green nucleus Fig. 3...']"},{"machine":"BBa_J01141","videoId":"BBa_J01141","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19H - [ RNA ] []"},{"machine":"BBa_K778001","videoId":"BBa_K778001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19I - [ Coding ] ['produce H2 since hycAp is the promoter of FHL formate hydrogen lyase ....Tokyo Project H2 E.coli but the results in this wiki is older than this...']"},{"machine":"BBa_J01142","videoId":"BBa_J01142","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19J - [ RNA ] []"},{"machine":"BBa_K778002","videoId":"BBa_K778002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19K - [ Coding ] ['produce H2 since hycAp is the promoter of FHL formate hydrogen lyase ....Tokyo Project H2 E.coli but the results in this wiki is older than this...']"},{"machine":"BBa_I732095","videoId":"BBa_I732095","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19L - [ Reporter ] ['Promoter Activity Reporter LacZ alpha and RFP ...Promoter can be inserted into the adapter containing BglII and BamHI sites....inserted promoter can be qualitatively observed on a X gal plate or be...']"},{"machine":"BBa_K895005","videoId":"BBa_K895005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19M - [ Coding ] ['This is a coding part comprising the full open reading frame of Salmonella...CD27 bacteriophage. The CD27 endolysin is believed to have high specificity...A fundamental crux of the ProQuorum system is the expression of the endolysin...which is responsible for the actual lysis and consequent killing of the...pathogenic C. difficile . Thus there is a clear need for an endolysin that...Upon analysis there is evident expression of the truncated endolysin as seen...there is a substantial decrease in OD600 over time relative to the negative...']"},{"machine":"BBa_I732902","videoId":"BBa_I732902","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19N - [ Measurement ] []"},{"machine":"BBa_K775009","videoId":"BBa_K775009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19O - [ Composite ] []"},{"machine":"BBa_I732805","videoId":"BBa_I732805","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 19P - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K784047","videoId":"BBa_K784047","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20A - [ Composite ] []"},{"machine":"BBa_I13002","videoId":"BBa_I13002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20B - [ Reporter,classic, reporter, ret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K902059","videoId":"BBa_K902059","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20C - [ Translational_Unit ] []"},{"machine":"BBa_I13600","videoId":"BBa_I13600","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20D - [ Reporter,classic, reporter, pret ] ['absence of the tetR protein CFP expression is constitutive. tetR represses... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K876009","videoId":"BBa_K876009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20E - [ Composite ] ['Inducible promoter for TetR...']"},{"machine":"BBa_S03154","videoId":"BBa_S03154","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20F - [ Intermediate,classic, intermediate, uncategorized ] [' At Davidson College we sequenced this part from the 2007 registry and... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K876011","videoId":"BBa_K876011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20G - [ Composite ] ['2017 http 2017.igem.org Team UNIFI Contribution chose this part along...']"},{"machine":"BBa_I0466","videoId":"BBa_I0466","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20H - [ Signalling,function, cellsignalling ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K876013","videoId":"BBa_K876013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20I - [ Composite ] ['LacI and RFP attached to a constitutive promoter for LuxI...']"},{"machine":"BBa_P0151","videoId":"BBa_P0151","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20J - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K876038","videoId":"BBa_K876038","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20K - [ Composite ] []"},{"machine":"BBa_E0430","videoId":"BBa_E0430","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20L - [ Reporter,classic, reporter, ret ] ['Team USP Brazil in 2018 has improved this part...Another good point for using this is that dividing fluorescence measurements...responsive promoters activity we compared the variance of our controls which...constitutive. When plateauing it is clear that the normalization by CFP gives...it to the combined promoters J23110 and J23115 assembling and testing their...constituent promoters... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K876052","videoId":"BBa_K876052","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20M - [ Reporter ] ['pLasR is off by default and can be actated by LasR. LuxI converts SAM to AHL....']"},{"machine":"BBa_R1051","videoId":"BBa_R1051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20N - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter Standard lambda cI regulated ... Note This is the same part as R0051 except that the 10 and 35 sites and...The cI regulated promoter is based on the pR promtoer from bacteriohage...lambda. The promoter has two two DNA binding sites for lambda cI repressor...here is based on the cI repressible promoter used in the Elowitz repressilator...Strong promoter. May not be well matched with other 10 series promoters. jb... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K876060","videoId":"BBa_K876060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20O - [ Composite ] ['pLasR is off by default and can be activated by LasR....']"},{"machine":"BBa_I13453","videoId":"BBa_I13453","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 20P - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized ] ['Pbad promoter...PBad promoter from I0500 without AraC....Has been used as a second promoter in a system containing...promoters http openwetware.org wiki Titratable control of pBAD and lac promoters in individual E. coli cells pBAD promotersOpenWetWare ...context of a pBAD promoter...family http parts.igem.org PBAD Promoter Family . For the results of this...using a construct of GFP reporter after the pBad promoter. The transfer...represent individual measurements. The line is of a Hill equation fitted to... MetA Knockout Complementation by inducing arabinose promoter by British...This part consists of an arabinose promoter a strong RBS and the MetA coding...gene. It is able to complement a metA knockout and the growth rate appears to...be proportional to the amount of arabinose that is added....this part in M9 minimal media with the indicated concentrations of arabinose ... TrpA Knockout Complementation by inducing arabinose promoter by British...This part consists of an arabinose promoter a strong RBS and the TrpA coding...gene. It is able to complement a metA knockout and the growth rate appears to...be proportional to the amount of arabinose that is added....this part in M9 minimal media with the indicated concentrations of arabinose ...for this part as well as linked fluorescent data. Not understood... promoter ...']"},{"machine":"BBa_K775010","videoId":"BBa_K775010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21A - [ Composite ] []"},{"machine":"BBa_I732903","videoId":"BBa_I732903","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21B - [ Measurement ] []"},{"machine":"BBa_K849000","videoId":"BBa_K849000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21C - [ Coding,function, biosynthesis, isoprenoid ] ['This is a truncated version of the 3 Hydroxy 3 Methyl Glutaryl Coenzyme A ...in the Mevalonate Pathway to Isopentylpyrophosphate which is the Precurser of...all Isoprenoides. The enzyme is naturally a membrane bound enzyme. The...membrane anchor is situated N terminal. This region is also essential for the...Aminoacid inclusive the enzyme is expected to be water soluble and...BTS1 which is able to convert FPP into GGPP. HMG1 encodes HMG CoA reductase ...which is the main regulatory point in the ergosterol biosynthetic pathway in...mevalonate which is a rate limiting step in sterol biosynthesis. Because...mevalonate is synthesized it is easy to flow to subsequent pathways....of S. cerevisiae and carotene were compared. It is considered that the...']"},{"machine":"BBa_I732018","videoId":"BBa_I732018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21D - [ Translational_Unit ] []"},{"machine":"BBa_K849003","videoId":"BBa_K849003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21E - [ Coding,cds, enzyme, function, biosynthesis, isoprenoid ] ['This is the bifuntional Diterpene Cyclase from Gibberella fujikuroi . It...']"},{"machine":"BBa_I732810","videoId":"BBa_I732810","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21F - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K849004","videoId":"BBa_K849004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21G - [ Coding,function, biosynthesis, isoprenoid ] ['This part contains the sequence of an enzyme converting ent Kauren to ent ...']"},{"machine":"BBa_I6106","videoId":"BBa_I6106","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21H - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0078.E0430...']"},{"machine":"BBa_K929000","videoId":"BBa_K929000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21I - [ Composite ] ['AID with CMV promoter and hGH polyadenylation signal sequence...Fig. 1 AID with CMV promoter and hGH polyadenylation signal sequence in...The BioBrick AID with CMV promoter and hGH polyadenylation signal sequence ...AID is known to be responsible for somatic hypermutation and the class switch... CMV promoter ...CMV is an immediate early Cytomegalovirus promoter for high level expression....The CMV promoter is commonly used due to its very strong activity and...effectivity in a broad range of cell types. The BioBrick is therefore improved...via addition of the strong promoter. ...Polyadenylation is a significant part for the translation and stability of...mRNA. In eukaryotes it is part of the process that produces mature messenger...with CMV promoter and hGHpolyA . Therefor we cotransfected CHO cells with a...There is a significant higher mutation rate when wildtype AID modified AID or...modified AID eGFP is added compared to the same experiment without AID....Surprisingly the mutation rate of wt AID is two times higher than the...observation is contrary to our expectation. The modified AID eGFP is located...higher mutation rate. One possible explanation is that the modified AID has a...']"},{"machine":"BBa_I6107","videoId":"BBa_I6107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21J - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0079.E0430...']"},{"machine":"BBa_K929002","videoId":"BBa_K929002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21K - [ Composite ] ['AID is known to be responsible for somatic hypermutation and the class switch...The AID motif is naturally terminated with the Nuclear Export Sequence NES ...stranded DNA it is supposed that the direction of the enzyme to the inside of...This part of the BioBrick directs the expressed protein into the nucleus ...Kozak consensus sequence is added upstream of the AID mutant to express the...stop codon taa of the modified AID.You can fuse this part with RFC...generate fusions C terminal of the modified AID without CMV promoter use...available with CMV promoter and hGH polyadenlation... CMV promoter ...CMV is an immediate early Cytomegalovirus promoter for high level expression....The CMV promoter is commonly used due to its very strong activity and...effectivity in a broad range of cell types. The BioBrick is therefore improved...via addition of the strong promoter....Polyadenylation is a significant part for the translation and stability of...mRNA. In eukaryotes it is part of the process that produces mature messenger...with CMV promoter and hGHpolyA . Therefor we cotransfected CHO cells with a...There is a significant higher mutation rate when wildtype AID modified AID or...modified AID eGFP is added compared to the same experiment without AID....Surprisingly the mutation rate of wt AID is two times higher than the...observation is contrary to our expectation. The modified AID eGFP is located...higher mutation rate. One possible explanation is that the modified AID has a...']"},{"machine":"BBa_I6108","videoId":"BBa_I6108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21L - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0080.E0430...']"},{"machine":"BBa_K864680","videoId":"BBa_K864680","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21M - [ Coding ] ['TetM is a tetracycline resistance gene encoding a ribosomal protection...']"},{"machine":"BBa_I6207","videoId":"BBa_I6207","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21N - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0079.E0432...']"},{"machine":"BBa_K864444","videoId":"BBa_K864444","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21O - [ Composite,classic, composite, uncategorized, classic, reporter ] ['This part is a component of the Uppsala University iGEM 2012 modular small RNA...a BamHI site downstream and clone into any backbone carrying this part ...prevent folding errors in the SYFP2. Before the linker there is a BamHI...']"},{"machine":"BBa_I6211","videoId":"BBa_I6211","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 21P - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test R0083.E0432...']"},{"machine":"BBa_K876063","videoId":"BBa_K876063","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22A - [ Intermediate ] []"},{"machine":"BBa_B0030","videoId":"BBa_B0030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22B - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['Strong RBS based on Ron Weiss thesis. Strength is considered relative to...Global non modularity towards promoters protein coding parts and relative...Note not compatible with R0053 promoter due to likely transcript secondary...standardized into the Golden Braid assembly method. Thus it is both compatibe...Characterization of the this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter CDS and...coli . The original version is shown in Fig. 1. Pc is a constitutive...promoter Pcp6 promoter and it promotes the expression of HucR and YgfU. When...uric acid is absent HucR can bind to PhucR which suppresses dsRed...blue light. sfGFP is downstream of RBS0030... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K876067","videoId":"BBa_K876067","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22C - [ Composite ] []"},{"machine":"BBa_J44001","videoId":"BBa_J44001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22D - [ RBS,rbs, prokaryote, constitutive, miscellaneous, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, reverse, regulation, constitutive ] []"},{"machine":"BBa_K876068","videoId":"BBa_K876068","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22E - [ Intermediate ] []"},{"machine":"BBa_J63008","videoId":"BBa_J63008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22F - [ Tag,chassis, eukaryote, yeast, proteindomain, localization ] []"},{"machine":"BBa_K876073","videoId":"BBa_K876073","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22G - [ Composite ] []"},{"machine":"BBa_S03518","videoId":"BBa_S03518","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22H - [ Intermediate ] []"},{"machine":"BBa_K737005","videoId":"BBa_K737005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22I - [ Generator ] ['This part contains a constitutive promoter J23106 a coding region of TetR...protein a terminator B0015 a promoter repressed by TetR protein R0040 a...coding region of GvpC and GFP and a terminator B0015 behind it. This part...can be used to induce the strength of promoter R0040 by Tet and indicate the...strength of promoter R0040 ahead GvpC Protein and GFP. And We can know the...']"},{"machine":"BBa_J24679","videoId":"BBa_J24679","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22J - [ Translational_Unit ] []"},{"machine":"BBa_K737007","videoId":"BBa_K737007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22K - [ Generator ] [' It contains a constitutive promoter GvpC protein GFP protein and a...terminator. This part can be used as a control of...alongside GFP as a polycistron 1 . Using this part we can know the expression...Our devices are Constitutive GvpA and GFP generator Promoter J23106 RBS...Constitutive GvpC and GFP generator Promoter J23106 RBS B0034 gvpC ...Here is the result of SDS polyacrylamide gel electrophoresis. We can see GFP...and GvpC protein directly. Lane 4 is top10 control group lane 3 is...constitutive GvpA and GFP generator lane 5 is constitutive GvpC and GFP...protein 25.8KD . The lower white box in the position of about 20KD is GvpC 20... 20KD . Because the MW molecular weight of GvpA protein is too small it s...GFP suggests it may be expressed. Some papers say that GvpA is difficult to...see is that GvpA is too hydrophobic to run out of sample hole....Figure1.The result of SDS polyacrylamide gel electrophoresis. Lane 4 is top10...control group lane 3 is constitutive GvpA and GFP generator lane 5 is...about 20KD is GvpC 20 20KD . Because the GvpA protein can t be seen on the...RFU. We can see that the RFU of Gvp and GFP Generator is about 2000 and the...RFU of Gvp and GFP Generator is about 4000 while top 10 is about 0 as...Figure2.We can see that the RFU of Gvp and GFP Generator is about 2000 and...the RFU of Gvp and GFP Generator is about 4000 while top 10 is about 0 as...']"},{"machine":"BBa_J09855","videoId":"BBa_J09855","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22L - [ Composite ] []"},{"machine":"BBa_K952003","videoId":"BBa_K952003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22M - [ Intermediate ] ['In the modified bacterial cells the expression of amilgfp gene is controlled...a test tube containing 5ml of LB which is called 0h. All the tubes were...microplate reader. Total fluorescence is divided by OD600 to obtain...conditions is higher than the OD600 under light conditions....']"},{"machine":"BBa_I13458","videoId":"BBa_I13458","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22N - [ Generator,classic, generator, uncategorized ] ['promoter C and arabinose C operon...Promoter C PC and arabinose C AraC from the AraBAD operator. PC and AraC...']"},{"machine":"BBa_K737051","videoId":"BBa_K737051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22O - [ Composite ] ['observed with induced by IPTG. The RBS of E0240 is B0030 a weak GFP...']"},{"machine":"BBa_J01003","videoId":"BBa_J01003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 22P - [ Conjugation,dna, conjugation, function, conjugation ] ['OriTR the R plasmid nic region is where the relaxosome nicks the plasmid and...the transfer of the plasmid containing the oriT R is dependent on the presence...plasmid pSB1K3 is dependent on the coexistence of either of the conjugative...estimated. The slope for TN is 0.003639 0.000454 for TC the slope is...0.0.003487 0.000594 and the slope for TCN is 0.003049 0.000357 . ...']"},{"machine":"BBa_K917014","videoId":"BBa_K917014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23A - [ Generator ] ['pLac promoter plus S. oneidensis tetraheme cytochrome c cymA...']"},{"machine":"BBa_E0240","videoId":"BBa_E0240","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23B - [ Reporter,classic, reporter, ret, plasmid, measurement ] []"},{"machine":"BBa_K953002","videoId":"BBa_K953002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23C - [ Translational_Unit ] ['for expression in E. coli . This part differs from Part...that it does not includes a T7 promoter Part...time. As E. coli does not produce biliverdin heme oxygenase with T7 promoter...be coupled with this part to activate the oxidation of heme to produce...']"},{"machine":"BBa_E0840","videoId":"BBa_E0840","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23D - [ Reporter,classic, reporter, ret, s ] ['contain any promoter thus it can only be used if cloned downstream of one. It...is also for this reason that this part...fluorescence with promoters of different strengths which can be used by...added either of the constitutive promoters...five different constitutive promoters at the excitation wavelength of 488 nm....The emission peak is found at 511 nm which is in accordance with what was...related to the promoters strengths....all GFP biobricks function properly and that the emission peak is consistent...under control of promoters with different strengths normalized by 1 at...fluorescence intensity. The final OD600 is approximately equal for all...the exponential growth phase suggesting that GFP is being broken down by...successfully improved this part by constructing and characterizing five new...BioBricks based on this part. They provide ready to go expression devices for...green fluorescence including promoter RBS coding sequence and terminators....']"},{"machine":"BBa_K838001","videoId":"BBa_K838001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23E - [ Reporter ] ['Any promoters already present must be removed since we want only want... 4 Test the expression Since this readout system is built to express...']"},{"machine":"BBa_S01003","videoId":"BBa_S01003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23F - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K805011","videoId":"BBa_K805011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23G - [ Coding,function, degradation, cellulose ] ['The endoglucanase genes cel5A is cloned from Penicillium decumbens 114 2. The...expression levels of cel5A is repressed by glucose and induced by cellulose.It...main product is oligomeric glucose. It can digest glucosan to produce glucose...The expression levels of cel5A is repressed by glucose and induced by...chains. The main product is oligomeric glucose. It can digest glucosan to...Polyclonal antibody. Result of flow cytometry analysis is as follows ...vector is 1.14 with cel5A pPIC9k is 5.55....']"},{"machine":"BBa_S01002","videoId":"BBa_S01002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23H - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K737004","videoId":"BBa_K737004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23I - [ Generator ] ['This part contains a constitutive promoter J23106 a coding region of LacI...protein with an LVA degradation tail a terminator B0015 a promoter...terminator B0015 behind it. This part can be used to induce the strength of...promoter R0011 by IPTG and indicate the content of GvpA by fluorescence of...concentration of IPTG to regulate the strength of promoter R0011 ahead GvpA...']"},{"machine":"BBa_C0261","videoId":"BBa_C0261","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23J - [ Translational_Unit,function, biosynthesis, ahl, function, cellsignalling ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K909008","videoId":"BBa_K909008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23K - [ Coding,cds, membrane, receptor ] ['transcription from TetR responsive promoter Ptet due to the lacking...UVR8 is a plant UV B photoreceptor which switches from dimeric to monomeric...']"},{"machine":"BBa_I9026","videoId":"BBa_I9026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 23L - [ Translational_Unit,function, biosynthesis, ahl, function, cellsignalling ] []"},{"machine":"BBa_J04450","videoId":"BBa_J04450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24P - [ Reporter,cds, reporter, chromoprotein, classic, reporter, pret, function, reporter, color, function, reporter, pigment ] ['contain a degradation tag and the RBS is strong....LacI and induced by IPGT. Plac is one of the most common promoter in life...science research field. It is mainly composed of Lac operon containing LacO...the binding of RNA polymerase to the promoter. So the expression of downstream...genes is blocked. Serving as inducer IPTG can bind with LacI repressor ...making the latter s conformation changes so LacI is detached from LacO site ...generator driven by Plac promoter however there is no LacI gene in it....Although the E. coli could express some LacI it is not enough for inhibition...promoter. It contains LacI gene which can lower significantly the RFP leakage...expression so that no excessive LacI expression which is considered as waste...identification result is showed in Fig.1. ...fluorescent intensity is fluorescence per OD600 standardized with fluorescence...leakage expression is very low and it is sensitive to the IPTG induction. ...induction. Relative fluorescent intensity is fluorescence per OD600...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...very sensitive to the IPTG induction and the RFP leakage expression is very... 4. Add 100 l bacteria culture medium into a sterile 96 well plate. IPTG is added to final concentrations of 1 2 5 10mM. M9 medium is the blank control. The colony without RFP expression is the negative control....This part is commonly used but can fail if the system contains LacI or CAP... Team TU Munich 2012 http 2012.igem.org Team TU Munich improved this part... Team Warwick 2015 http 2015.igem.org Team Warwick improved this part by...characterisation of this part by showing equal functionality in simulated...contributed to the characterisation of this part by testing the time of...apparition of fluorescence in presence of IPTG or not because the promoter...leaks as well as they contributed to the improvement of this part by using...contributed to the characterization of this part by showing decreased...contributed to the characterization of this part by analyzing the rate of...contributed to the characterisation of this part by testing the delay before...contributed to the characterisation of this part by testing the fluorescence...part by replacing the induced promoter lacI with the strong constitutive pf 5...promoter PampC. see ...Alpes Contribution contributed to the characterisation of this part by...testing the effect of cAMP on the promoter s leakages and protein expression...charazterization of this part by testing the effect of different media...the characterization of this part by introducing it in Trans10 to observe its...contributed to the charazterization of this part by testing the effects of...characterization of this part by testing the effect of glucose on the protein...contributed to characterization of this part by testing radiation tolerance of...replication that could explain this effect. This part is a reversion of this...successfully produce colonies. In these results is the negative control...plate streaked with pSB1C3 containing J04450 RFP . This is the most...origin which has expression in vibrio. However pGGA is not compatible with...plasmid per genome. These values indicate that K3445002 is effective in both...in a plasmid that is still capable of replication in E. coli but now also...Escherichia coli Nissle 1917 EcN is widely used as a probiotic since it s...contains a CAP sensitive promoter and glucose can inhibit its expression. ...We then investigate whether this phenomenon is influenced by the strain and...amount of IPTG added for respective treatment is 500 M. ... The red color absorbance under 588 nm wavelength is recorded around 2.5 3 OD units....the role of RBS and Promoter parts in giving rise to intrinsic noise in E....of this part as a cloning tool. When ligating any part or part assembly into...any standard backbone that contains this part the non restricted and single ...insert the size of the BioBrick insert and whether the insert is an assembly...we characterized its expression under lac promoter. We did the transformation...Violaceum competent cells with the protocol that is in our wiki we concluded...that the best O.D. for the heat shock transformation is 0.5 since it showed...expression. This part is useful for characterizing the expression of different...proteins using the lacI sensitive promoter. For better application of this...promoter in controlling protein expression the effects of different hosts...fluorescence intensity at different temperature is much higher than those of...leak appeared in 34 oC. This finding is different from our expectation where...medium containing flask is significantly higher than others indicating that...oxygen is an important factor which will affect the protein expressin and cell...by using different IPTG induction Fig 3 . However it is interesting that the...driven by PrplJ promoter and expressed in DH10B. In addition we also applied...weaker E.coli endogenous promoters PdapA and PcaiF Figure 1 ....PcaiF promoter....However it is difficult for us to perform additional experiments with... The goal was to characterize the effect of cAMP on the promoter s leakages...without production of cAMP. BTH101 strain is streptomycin resistant. ...inducible promoter lactose promoter to create an auto amplifier system. ...It is apparent that without IPTG there is a visible difference between strains...the leakage of the promoter. ...data suggest that the promoter does not leak in that condition. ...lactose promoter has almost no leakage suggesting that the leakage of the...lactose promoter is due to cAMP in absence of IPTG. When the cAMP production...is restored the promoter is activated and the protein is expressed. It is also...expression if no IPTG is added. ...SHuffle strains. In order to test this lacI regulated promoter in our chassis ...functionality of the promoter. Protein expression was analysed through an SDS ...leakiness in the promoter. IPTG concentrations were chosen based on conditions...worked previously when using a T7 promoter 0.2 mM and recommendations of the...show bands if the promoter lacked leakiness nevertheless a faint band can be...stronger bands compared to the uninduced control. Thus the promoter is...promoter....and have been excluded. In case of 532 605 the noise is disturbing the...EcN. The lag phase is shorter compared to the other two media while the...logarithmic phase is longer. In TB Media the lag phase is extended and the...growth is not as high as before but still exhibits a clear logarithmic phase....In sharp contrast to that the lag phase in LB Media is almost double and the...exponential phase is quite brief. These results are expected since the media...the RFP production in LB is significantly lower. For E. coli BL21 DE3 Figure...lowest RFP levels. The expression in LB media is only slightly higher than in...Enriched media. The protein expression in TB Media however is notably higher...the control of a lactose promoter is a good alternative to produce inducible...could divide 24h into three different growth phases 0 2h is lag phase 2 15h...is an exponential phase 15 24 is a stationary phase. ...spectra for mCherry ranges from 551 nm to 800 nm. There is an overlap of 77 nm...each fluorescent protein is accurate....showed the highest fluorescence readings. This is probably because cell...concentration of 87 5 which is 3 5 times higher than the recommended...We transformed the plasmid which RFP is inserted in psB1C3 into DH5 and...We transformed DH5 with the plasmid which RFP is inserted in psB1C3 and... At first the cells are cultured in liquid medium and the medium is replaced...with Butterfield s Phosphate Buffer BPB . This is because when the gamma ray...versus 10 Gy. From this result we concluded that E. coli is highly...sensitive to gamma irradiation when it is irradiated with 50 and more doses of...This graph shows that the number of cells is significantly reduced with...']"},{"machine":"BBa_I732007","videoId":"BBa_I732007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24B - [ DNA,DNA, cloningsite ] []"},{"machine":"BBa_I732101","videoId":"BBa_I732101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24D - [ Coding,cds, transcriptionalregulator, repressor ] ['affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....The sequence produce LRLa repressor protein which is based on natural lacR...added to both ends of this part for standard assembly....']"},{"machine":"BBa_I715022","videoId":"BBa_I715022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24F - [ Coding,cds, reporter, rfp, function, reporter, fluorescence ] ['This is the first portion of the RFP gene before the insertion point of the...']"},{"machine":"BBa_I746104","videoId":"BBa_I746104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24H - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, function, cellsignalling, AgrA ] ['P2 promoter in agr operon from S. aureus...The agr P2 operon is an autocatalytic sensory transduction system in...Staphylococcus aureus. P2 promoter regulates the synthesis of AgrB a...phosphorylated AgrA increases the activity of agr P2 promoter about 50 fold....The cell density at which the agr system is activated is determined by the...AgrA independent activity of P2 promoter...The basal agr P2 promoter activity is high enough to make stochastic effects... promoter ...']"},{"machine":"BBa_I714033","videoId":"BBa_I714033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24J - [ RNA ] []"},{"machine":"BBa_I763007","videoId":"BBa_I763007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 2, 24L - [ Reporter,classic, reporter, pret ] ['promoter lambda cI regulated with RFP reporter...Promoter lambda cI regulated R0051 with RFP E1010 as a reporter....']"},{"machine":"BBa_I716155","videoId":"BBa_I716155","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1A - [ Coding,function, biosynthesis, heme ] ['This is an enzyme involved in the heme biosynthetic pathway. Also called...']"},{"machine":"BBa_S0105","videoId":"BBa_S0105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1B - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_I718017","videoId":"BBa_I718017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1C - [ DNA,function, recombination, cre ] ['Lox71 is a site specific recombination cassette. It belongs to the loxP family...lox site recombination is catalysed by a Site specific recombinase Cre....The particularity of lox66 is that it has an altered sequence at the end of...inherited both mutated arms. Use of lox71 lox66 sites is potentially...']"},{"machine":"BBa_I13401","videoId":"BBa_I13401","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1D - [ Reporter,function, reporter ] ['This part will be suffixed to a promoter.RBS library. The purpose of the...experiment is to make a first pass at a library based construction step to...']"},{"machine":"BBa_I742101","videoId":"BBa_I742101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1E - [ DNA,function, recombination, xer ] [' dif division induced filamentation is the recombination site for XerC and...']"},{"machine":"BBa_I732020","videoId":"BBa_I732020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1F - [ Generator ] []"},{"machine":"BBa_I742102","videoId":"BBa_I742102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1G - [ DNA,function, recombination, xer ] [' dif division induced filamentation is the recombination site for XerC and...enable recombination that is temporally isolated to division....']"},{"machine":"BBa_C2001","videoId":"BBa_C2001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1H - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_I742158","videoId":"BBa_I742158","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1I - [ Translational_Unit,classic, generator, RC, function, biosynthesis, isoprenoid ] []"},{"machine":"BBa_Q04530","videoId":"BBa_Q04530","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1J - [ Inverter,classic, inverter, uncategorized ] []"},{"machine":"BBa_I741018","videoId":"BBa_I741018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1K - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, multiple ] ['Right facing promoter for xylF controlled by xylR and CRP cAMP... promoter ...']"},{"machine":"BBa_I14018","videoId":"BBa_I14018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1L - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, constitutive, classic, regulatory, uncategorized ] ['promoter for ampicilin resistance... promoter ...']"},{"machine":"BBa_I741005","videoId":"BBa_I741005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1M - [ Coding,cds, transcriptionalregulator ] []"},{"machine":"BBa_I6116","videoId":"BBa_I6116","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1N - [ Measurement,classic, measurement, uncategorized ] []"},{"machine":"BBa_C2006","videoId":"BBa_C2006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1O - [ Coding,cds, transcriptionalregulator, repressor ] []"},{"machine":"BBa_S03724","videoId":"BBa_S03724","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 1P - [ Intermediate ] ['A weak as compared to J23100 constitutive promoter J23116 produces a steady...']"},{"machine":"BBa_K118003","videoId":"BBa_K118003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2A - [ Coding,function, biosynthesis, isoprenoid, function, odor ] ['This is the coding sequence of crtI from Pantoea ananatis formerly... Erwinia uredovora . CrtI is an enzyme catalyzes the conversion of phytoene to...lycopene in a one step reaction. In iGEM16 SCAU China project CrtI is used...higher plant rice Oryza sativa . The original CrtI is not suitable to...rice. In addition a Pea transit peptide of Rubisco small subunit is fused...']"},{"machine":"BBa_K525305","videoId":"BBa_K525305","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2B - [ Composite,chassis, prokaryote, ecoli, function, reporter, fluorescence, proteindomain, internal ] ['Especially their ability for self assembly into distinct geometries is of...is determined by the C terminal self assembly domain which is specific for...geometry it is possible to realize various practical applications Sleytr...functional protein domains. It is possible to coat surfaces and liposomes with...purification the nanobiotechnological system is cell free. This enhances the...This fluorescent S layer fusion protein is used to characterize purification...methods and the S layer s ability to self assemble on surfaces. It is also...The SgsE gene under the control of a T7 lac promoter...depicting KRX wildtype is shown for comparison. After induction at...significantly slower than KRX wildtype probably due to a leaky promoter and...wildtype is shown for comparison. After induction at approximately 4 h the RFU...uninduced culture the ratio is roughly four times higher. The KRX wildtype...and are resistant to proteases. The first purification step is to isolate and...solubilize the inclusion bodies. This step is followed by two filtrations 300...proteins. After the filtrations the remaining protein solution is dialyzed...A huge amount of protein is lost during the purification especially after the...strategy is very simple and can be carried out by nearly everyone in any lab ...complex inclusion body purification and filtration is necessary to decrease...that not all of the protein is immobilized on the beads supernatant fraction ...but the immobilization is quite stable very low fluorescence in the wash ....the degree of clearance C in the supernatant is calculated and plotted...protein. So a good protein bead ratio to work with is 5 7 10 4.... n 3 . Data is fitted with dose reponse function R 0.874 . ... Collect the eluate fractions the purified protein is most likely in the fractions containing 50 75 mM imidazole... This step is for removing cell debris... Take at least 500 L sample for each measurement 200 L is needed for one measurement so you can perform a repeat determination...']"},{"machine":"BBa_K118017","videoId":"BBa_K118017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2C - [ Translational_Unit,classic, generator, rc, function, biosynthesis ] ['This is the coding sequence of glgC from Escherichia coli JM109 with added...']"},{"machine":"BBa_K525306","videoId":"BBa_K525306","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2D - [ Coding,cds, reporter, chassis, prokaryote, ecoli, function, reporter, fluorescence, proteindomain, internal ] ['Especially their ability for self assembly into distinct geometries is of...is determined by the C terminal self assembly domain which is specific for...geometry it is possible to realize various practical applications Sleytr...functional protein domains. It is possible to coat surfaces and liposomes with...purification the nanobiotechnological system is cell free. This enhances the...This fluorescent S layer fusion protein is used to characterize purification...methods and the S layer s ability to self assemble on surfaces. It is also...The SgsE gene under the control of a T7 lac promoter...depicting KRX wildtype is shown for comparsion. After induction at...wildtype is shown for comparsion. After induction at approximately 4 h the RFU...uninduced culture the ratio is roughly 34 times higher at its highest point... Take at least 500 L sample for each measurement 200 L is needed for one measurement so you can perform a repeat determination... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K118018","videoId":"BBa_K118018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2E - [ Translational_Unit,classic, generator, rc, function, biosynthesis ] ['This is the coding sequence of glgC ADP glucose pyrophosphorylase from...binding site rbs . This mutation is known to cause increased activity of ADP ...']"},{"machine":"BBa_K525404","videoId":"BBa_K525404","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2F - [ Composite,chassis, prokaryote, ecoli, function, reporter, fluorescence, proteindomain, internal ] ['Especially their ability for self assembly into distinct geometries is of...is determined by the C terminal self assembly domain which is specific for...geometry it is possible to realize various practical applications Sleytr...functional protein domains. It is possible to coat surfaces and liposomes with...purification the nanobiotechnological system is cell free. This enhances the...This fluorescent S layer fusion protein is used to characterize purification...methods and the S layer s ability to self assemble on surfaces. It is also... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_P0412","videoId":"BBa_P0412","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2G - [ Generator,classic, generator, rct, function, regulation, transcriptional ] ['NOT logic gate is a common and useful part in logic gene circuit. This year ...strength constitutive promoters and used GFP to report the inductive effect... fig1 . The induced degree is up to the response effect in a steady state and...The response condition is similar to what we test in TetR Ptet...condition became very fast as we used a weak promoter. This issue occurs...because of the choosing of promoters and the concentration level of the...inducer. It is uncertain for every single element. Therefore how to maintain...is on the top of our agenda. Nevertheless does our promoters as stable as we...While quantitative biology is developing step by step some special model can...']"},{"machine":"BBa_K525406","videoId":"BBa_K525406","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2H - [ Composite,chassis, prokaryote, ecoli, function, reporter, fluorescence, proteindomain, internal ] ['Especially their ability for self assembly into distinct geometries is of...is determined by the C terminal self assembly domain which is specific for...geometry it is possible to realize various practical applications Sleytr...functional protein domains. It is possible to coat surfaces and liposomes with...purification the nanobiotechnological system is cell free. This enhances the...This fluorescent S layer fusion protein is used to characterize purification...methods and the S layer s ability to self assemble on surfaces. It is also...The SbpA gene under the control of a T7 lac promoter...depicting KRX wildtype is shown for comparsion. After induction at...wildtype is shown for comparsion. After induction at approximately 6 h the RFU...uninduced culture the ratio is roughly three times higher. The KRX wildtype... Take at least 500 L sample for each measurement 200 L is needed for one measurement so you can perform a repeat determination... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_C0056","videoId":"BBa_C0056","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2I - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['which use temperature as a screening condition. CI434ts is a heat inducible...ON transcription factor which is a thermo sensitive mutation type of CI434...temperatures. As shown in Figure 3 when the temperature is high CI434ts will...function and repress its promoter to inhibit the process of under stream genes... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K592011","videoId":"BBa_K592011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2L - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['the color development is slower. The color is readily observed in both LB or...on agar plates after 24 48 hours of incubation. The sequence is codon...This part is useful as a reporter....An improved part has been constructed. Since this part is a coding sequence ...we added a RBS which is on the upstream of sfGFP...following the constitutive promoter J23119 to achieve further control of...from the PDB. The model s QMEAN score is compared to the scores obtain for...calculated. A Z score or standard score is a score which is normalised to...query model with respect to the background distribution is marked in red. This...plot basically is a projection of the first plot for the given protein size....The number of reference models used in the calculation is shown at the bottom...The QMEAN6 score is a composite score consisting of a linear combination of 6...shows that the above predicted model of cjBlue green chromoprotein is a very...The N terminal of the sequence considered is M Met ....The instability index II is computed to be 29.86. ...The absorption wavelength maximum of cjBlue is approximately 610 nm 1 . The...maximum absorption wavelength of fwYellow is 523 nm 2 . Given that the...each fluorescent protein is accurate....The predicted molecular mass of this protein is about 27500Da and the exact...size is 28610.8Da.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I1466","videoId":"BBa_I1466","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2K - [ Signalling,function, cellsignalling ] []"},{"machine":"BBa_I732820","videoId":"BBa_I732820","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2M - [ Intermediate ] []"},{"machine":"BBa_K592101","videoId":"BBa_K592101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2N - [ Coding,cds, reporter, yfp, Kit plates, chromoprotein, uppsala, function, reporter, fluorescence ] ['better choice than this part....This part is useful as a reporter....this experiment we assembled two composite parts with the same promoter RBS...parameters from Table 2 were obtained. With these parameters it is possible to...obtain that the degradation of the protein with the tag is around twice as...measured at NaCl concentrations of 0 2.5 5 7.5 and 10 as 3 is the...']"},{"machine":"BBa_I732094","videoId":"BBa_I732094","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2O - [ Reporter ] ['Promoter Activity Reporter LacZ alpha and GFP AAV ...Promoter can be inserted into the adapter containing BglII and BamHI sites....inserted promoter can be qualitatively observed on a X gal plate or be...']"},{"machine":"BBa_K648013","videoId":"BBa_K648013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 2P - [ Coding,cds, reporter, gfp, function, reporter, fluorescence ] ['This is the standard GFP protein reporter E0040 cloned with the...epitope tag followed by an enterokinase cleavage site. This is important if...cell surface expression of this BioBrick is wished. Addition of... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I742107","videoId":"BBa_I742107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3A - [ Coding,function, biosynthesis, odorant, function, odor ] []"},{"machine":"BBa_S03881","videoId":"BBa_S03881","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3B - [ Intermediate ] []"},{"machine":"BBa_J22101","videoId":"BBa_J22101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3C - [ Coding,cds, membrane, pump ] []"},{"machine":"BBa_S03889","videoId":"BBa_S03889","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3D - [ Intermediate ] []"},{"machine":"BBa_J33204","videoId":"BBa_J33204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3E - [ Reporter ] ['This part includes the xylE gene from the Pseudomonas putida TOL naphthalene...bright yellow product 2 hydroxy cis cis muconic semialdehyde. This is a useful...suitable promoter to act as a reporter. I have previously used this gene to...Xgal etc. catechol in solution is prone to spontaneous oxidation resulting in...brown melanin like polymeric products so is not stable enough to incorporate...concentration of about 0.5 mM prior to assay. Note also that there is a SacI...site at the very start of the part when the prefix is included so this can...']"},{"machine":"BBa_S03184","videoId":"BBa_S03184","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3F - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_R0010","videoId":"BBa_R0010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3G - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['promoter lacI regulated ...This part is an inverting regulator sensitive to LacI and CAP....is generally present in E.coli and is asocciated with cell health and... In the absence of LacI protein and CAP protein this part promotes transcription.... In the presence of LacI protein and CAP protein this part inhibits transcription....site is on the 121 113 base number of the BioBrick and on the 12 20 base...primer. The third location of the internal priming site is on the 84 90 base...This is a direct copy of bases 0365739 through 0365540 of the E. coli K 12...MG1655 genome Genbank NC 000913 in reverse complement form. It is the natural...promoter for the LacZYA operon. It includes the tail end of the LacI gene...coding region but no promoter region for that partial gene....the lac promoter can be used as a constitutive promoter in this chassis. There...induction. Therefore we can confirm that this promoter is constitutive in C....in expression for modified proteins. This biobrick is completely functional...bandwith using GFP and mCherry programs. Relative fluorescence is calculated...IPTG and arabinose. Relative change of fluorescence is used to normalize...promoter is leaky and the arabinose and pAzF are much more critical for...expression when little or no pAzF or arabinose is present is most likely a... Usage of the lac promoter to express fluorescent markers in two different... Hong Kong HKU https 2019.igem.org Team Hong Kong HKU tested this promoter...Typhimurium to test whether this is a constitutive promoter in S. Typhi....Lactose fermentation ability is used to differentiate them. S. Typhimurium...characterisation experiment this lac promoter is transformed to S....As the data suggests this promoter is a constitutive promoter in S....Typhimurium as there is no difference in signals with or without IPTG. As...expected under IPTG induction there is a 3 fold increase in RFP signals... Tec Chihuahua 2019 Usage of lacI promoter to express RFP into E.coli ...functionality of this promoter by testing it in E. coli expression strain...regulated promoter inducible by IPTG. However characterization of promoters in...the iGEM Parts Registry for their use in SHuffle strains is nonexistent. ...transformed an RFP coding device under the regulation of this promoter into...of the promoter. Protein expression was analysed through an SDS PAGE. ...regulated promoter....were expected not to show bands if the promoter lacked leakiness ...control. Thus the promoter is slightly leaky but the addition of proper... Characterising lac promoter repression by glucose in different pH...the activity of promoter using a GFP reporter in pH 5 9 when repressed by 0.1M...glucose. This is done to assess the degree of control over activity that...the experiment. Cells transformed with this part are mixed into LB of pH range...5 9. 0.1M Glucose is then added to them. A control without the addition of...glucose is also included in this experiment. There is a leaked expression of...The activity of pLAC is relative to the expression of GFP fluorescence. In the...therefore little activity of the pLAC promoter. This control shows that there...is very little promoter activity in the absence of sugar. This validates our...level of GFP increases linearly over time. The reporter gene is expressed...following the activation of the pLAC promoter in the presence of lactose. We...functioning of our designed pLAC promoter....pLAC is significantly activated in the presence of lactose compared to...conditions without sugar verifying the proper functioning of this part.... II The link between sugar concentration and promoter activity...The activity of pLAC is relative to the expression of GFP fluorescence. We...the fluorescence in conditions where lactose is present. However we do not... III The specificity of each promoter to their associated sugar...To complete our experiments we tested the promoter activity of the simple...The activity of pLAC is relative to the expression of GFP fluorescence. ...fluorescence hence activate the pLAC promoter. This corroborates already...experiment is to analyse the activity of pLAC promoter in the presence of 2...sugar hierarchy is still present in our construction in this condition and...promoter....Our results show that pLAC promoter is activated by all tested binary...activity over time is mainly imputable to lactose. Addition of other sugars...additional effect on pLAC activity. This confirms that pLAC is on the top of...hierarchy will inhibit promoters associated to sugars lower in the hierarchy.... V Duration of the promoter expression...As our tool is mainly based on controlling gene expression in time it is...important for us to study the activity of this promoter pLACs in time. This...will allow us to better understand the behavior of our promoter enabling us...The activity of pLAC is relative to the expression of GFP fluorescence. ...We can conclude that the activity of the promoter pLAC observed here as the...from one to the other. In saturated sugar conditions pLAC is activated around... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_I1468","videoId":"BBa_I1468","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3H - [ Generator,classic, generator, rct, function, cellsignalling, function, regulation, transcriptional ] []"},{"machine":"BBa_I715019","videoId":"BBa_I715019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3I - [ Reporter,function, reporter, fluorescence ] ['control of a lac operon controlled T7 promoter. The complete zinc finger...the usage of this part and tested its function.... A pair of primers that can extent the usage of this part... the C terminal of GFP that part is also improved and tested the their...']"},{"machine":"BBa_J52019","videoId":"BBa_J52019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3J - [ Coding,function, immunology, chassis, eukaryote, human ] ['It is an imortant protein in signaling cascade through TLR receptors MyD88...']"},{"machine":"BBa_J61046","videoId":"BBa_J61046","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3K - [ DNA,function, recombination, cre ] []"},{"machine":"BBa_J45397","videoId":"BBa_J45397","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3L - [ Composite ] []"},{"machine":"BBa_J33203","videoId":"BBa_J33203","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3M - [ Reporter ] ['E. coli ars promoter arsR gene and lacZ...This biobrick contains the promoter region of the Escherichia coli chromosomal...repressor protein required for inducibility of this promoter. This is fused to...function of this promoter....']"},{"machine":"BBa_S03591","videoId":"BBa_S03591","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3N - [ Intermediate ] []"},{"machine":"BBa_F2620","videoId":"BBa_F2620","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3O - [ Signalling,classic, signalling, receiver, function, cellsignalling ] [' 3OC6HSL is controlled by a TetR ... . Device input is 3OC6HSL 3OC6HSL 3OC6HSL . Device output is...aims to expand the characterization of this part by identifying crosstalk...can be found under the Experience tab of this part....']"},{"machine":"BBa_S03650","videoId":"BBa_S03650","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 3P - [ Intermediate,chassis, bacteriophage, T7 ] []"},{"machine":"BBa_I732006","videoId":"BBa_I732006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4A - [ Coding,cds, enzyme, function, reporter, color ] ['11 41. Beta galactosidase produced without those residues is missing a small...part and is thus not functional....But if this mutated form of beta galactosidase is brought together with the...galactosidase is a tetramer it needs for units of LacZalpha and the rest to...part is also used as a reporter in the following composite parts which are... Galactosidase is an enzyme that is commonly used as a reporter marker to...monitor gene expression. It is encoded by the LacZ gene and its function in...the cell is to cleave lactose to glucose and galactose. Galactosidase assay...splits into two peptides LacZ and LacZ neither of which is active by...DH5 and XL1 Blue the mutated LacZ fragment is naturally found in the...bacterial genome so when a vector containing the LacZ fragment is inserted...o nitrophenyl beta d galactopyranoside ONPG . This synthetic compound is also...ONPG is in excess over the enzyme in a reaction the production of...o nitrophenol per unit time is proportional to the concentration of beta ...function is immediately related to gene expression....']"},{"machine":"BBa_J23111","videoId":"BBa_J23111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4B - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, Anderson, regulation, constitutive ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...BerkiGEM2006 Promoters.jpg File BerkiGEM2006 Promoters.jpg ... Constitutive promoter family ...Parts J23100 through J23119 are a family of constitutive promoter parts...isolated from a small combinatorial library. J23119 is the consensus ...promoter sequence and the strongest member of the family. All parts except...J23119 are present in plasmid J61002. Part J23119 is present in pSB1A2. This...places the RFP downstream of the promoter. Reported activities of the...promoters are given as the relative fluorescence of these plasmids in strain...These promoter parts can be used to tune the expression level of...within these promoter parts make them a scaffold for further modification. ...JCAraw Berk2006iGEM JCATCPromoterRaw Berk2006iGEM JCATCPromoterRaw ... promoter Anderson ...']"},{"machine":"BBa_I732085","videoId":"BBa_I732085","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4C - [ Generator ] ['There is a mutation induced by PCR in...']"},{"machine":"BBa_J23108","videoId":"BBa_J23108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4D - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member For video explanation on this promoter... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...BerkiGEM2006 Promoters.jpg File BerkiGEM2006 Promoters.jpg ... Constitutive promoter family ...Parts J23100 through J23119 are a family of constitutive promoter parts...isolated from a small combinatorial library. J23119 is the consensus ...promoter sequence and the strongest member of the family. All parts except...J23119 are present in plasmid J61002. Part J23119 is present in pSB1A2. This...places the RFP downstream of the promoter. Reported activities of the...promoters are given as the relative fluorescence of these plasmids in strain...These promoter parts can be used to tune the expression level of...within these promoter parts make them a scaffold for further modification. ...JCAraw Berk2006iGEM JCATCPromoterRaw Berk2006iGEM JCATCPromoterRaw ... Manchester 2017 used this part to create part...choosing promoters. ...We hope that when we use an unrepresentated promoter we can easily and...accurately get its relative strength in the already characterized promoter...Therefore we constructed the promoter strength measurement vector...Figure 1. The fluorescence of each promoter changes with time fluorescence ...calculated the relative fluorescence intensity of each promoter for it based...promoters. The reason of which might be the fusion genes influenced the...relatve expression level of the promoter....Anderson promoter was not consistent with reported relative expression.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter anderson ...']"},{"machine":"BBa_B0015","videoId":"BBa_B0015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4E - [ Terminator,direction, forward, terminator, double ] [' This is the most commonly used terminator. It seems to be reliable. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...of the T7 DNA ligase gene which is in the early region of bacteriophage T7...genome 4 . This terminator is an efficient one for the E. coli RNA...']"},{"machine":"BBa_J23109","videoId":"BBa_J23109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4F - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...BerkiGEM2006 Promoters.jpg File BerkiGEM2006 Promoters.jpg ... Constitutive promoter family ...Parts J23100 through J23119 are a family of constitutive promoter parts...isolated from a small combinatorial library. J23119 is the consensus ...promoter sequence and the strongest member of the family. All parts except...J23119 are present in plasmid J61002. Part J23119 is present in pSB1A2. This...places the RFP downstream of the promoter. Reported activities of the...promoters are given as the relative fluorescence of these plasmids in strain...These promoter parts can be used to tune the expression level of...within these promoter parts make them a scaffold for further modification. ...JCAraw Berk2006iGEM JCATCPromoterRaw Berk2006iGEM JCATCPromoterRaw ...Relative promoter strength estimates see this...page http 2009.igem.org Team Groningen Promoters from Groningen 2009 ...weak promoter respectively in 2020. For all the experiments below we use E....First we measured the strength of the promoter by sfGFP...The gene circuit we used is as below ...The protocol is as below ...of this page they worked well anb the strength order of the three promoters...Second we measured the strength of the promoter by CAHS 106094...different promoters to adjust the expression level of CAHS 106094 to study...The gene circuit we used is as below ...The protocol is as below ... 1 If fluorescence induced by the iPTG is detectable in the control group... 1 equals to 109 cells. If the OD600 value is between 0.1 and 1 There is a... 3 If the density above is not suitable take 100 L of the solution and...As expected J23100 is the strongest promoter and it gave the best survival...rate. J23107 is the second and J23109 seemed too weak to express enough CAHS...106094. In conclusion J23100 and J23107 is effective in this situation but...J23109 is not.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...strength of 3 constitutive promoters when used in a cell free expression...transcription factor. Three closely related promoters of well documented...The measured fluorescence is presented in fluorescence units FU . ...the difference between 101 compared to 105 and 109 is far more pronounced than...system higher the difference between 105 and 109 is hardly visible. In fact ...To produce a notable amount of a protein of interest the promoter 101 seems... promoter anderson ...']"},{"machine":"BBa_J52028","videoId":"BBa_J52028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4G - [ Reporter,function, reporter, fluorescence ] ['GFP linker PEST191 is a part composed of GFP as a reporter linked with...PEST191 through six aminoacid long protein linker. PEST191 is a sequence that...half life is 2h....']"},{"machine":"BBa_B0030","videoId":"BBa_B0030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4H - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['Strong RBS based on Ron Weiss thesis. Strength is considered relative to...Global non modularity towards promoters protein coding parts and relative...Note not compatible with R0053 promoter due to likely transcript secondary...standardized into the Golden Braid assembly method. Thus it is both compatibe...Characterization of the this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter CDS and...coli . The original version is shown in Fig. 1. Pc is a constitutive...promoter Pcp6 promoter and it promotes the expression of HucR and YgfU. When...uric acid is absent HucR can bind to PhucR which suppresses dsRed...blue light. sfGFP is downstream of RBS0030... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_J52008","videoId":"BBa_J52008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4I - [ Reporter,cds, enzyme, function, reporter, light ] ['Rluc is a protein called Renilla luciferase and it emits light when the...right substrate is added. That is why it can be used as a reporter to track...other proteins or to monitor the activity of a promoter....This part contains a Eukaryotic ribosome binding site and non standard prefix... This part was characterized by the iGEM team DUT China B in 2019....In the process coelenterazine is oxidized with a concurrent loss of CO2 and...a photon of blue light is emitted 2 . ...After the 3 mL system is configured 2900 uL crude enzyme solution and 100 uL...']"},{"machine":"BBa_K1188002","videoId":"BBa_K1188002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4J - [ Tag ] ['RTX repeats in toxin is a polypeptide motif consisting of a repeating...calcium which causes it to precipitate from solution. This is the shorter... 8 mer version of this part and is in Freiburg format. This allows RTX to be...then be precipitated from a solution. This is useful for the purpose of...in effective precipitation and is capable of a high level of purification of a...fluorescence is present . Additionally calcium concentrations below 1 mM do... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_J32015","videoId":"BBa_J32015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4K - [ Tag,proteindomain, localization ] ['The pelB leader sequence is a sequence of amino acids which when attached to a...sequence is removed by pelB peptidase. It is used to direct coat protein ...When the 5 aspartate repeated sequence 5D is added to the back of the...containing pelB 5D and PETase the only difference between them is the...removed.piGEM2016 module01 and piGEM2016 module01 is a vector containing...PETase and MHETase the difference between them is that pelB 5D is added in...and piGEM2016 002 show that the pelB 5D is working.Further more SDS PAGE...result of piGEM2016 module01 is obviously better than that of...To improve the function of this part we made the codon optimization for its...use of the Pelb signal sequence for secretory expression is one major...']"},{"machine":"BBa_K1218003","videoId":"BBa_K1218003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4L - [ Coding,function, crispr ] ['CasA is the first subunit of the CASCADE complex and is responsible for the...initial identification of invasive DNA. This part can be used with casBCDE to... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S03506","videoId":"BBa_S03506","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4M - [ Intermediate ] []"},{"machine":"BBa_K1218011","videoId":"BBa_K1218011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4N - [ Coding,function, crispr, function, crispr, cas9 ] ['CRISPR Cas is a bacterial immune system that remembers and targets foreign...spacers are then used to sense homologous DNA which is cleaved by CRISPR ...This part codes for the tracrRNA Cas9 protein and minimal CRISPR array of a...easily switch the promoter and RBS from Cas9 coding sequence through 3A...BioBrick. It was necessary as the Cas9 is located in an operon complex in...For more information on the contruction of this part please refer to the...The aim behind this part improvement is to use CRISPR CAS9 technology to...in to improve characterization CMV enhancer CMV promoter and T7 promoter at...']"},{"machine":"BBa_B1003","videoId":"BBa_B1003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4O - [ Terminator,terminator, single, direction, forward ] []"},{"machine":"BBa_K1184000","videoId":"BBa_K1184000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 4P - [ Coding,biosafety, biosafety, kill_switch, cds, reporter, rfp, chassis, prokaryote, ecoli, function, celldeath, function, reporter, fluorescence ] ['KillerRed is a red fluorescent protein that produces reactive oxygen species...gives rise to a bleaching effect. KillerRed is spectrally similar to mRFP1...with a similar brightness. KillerRed is oligomeric and may form large...Superoxide O2 is the radical anion of molecular oxygen which can react...This sequence is codon optimized for mammalian cells and has 13 rare proline... 2016 NYMU Taipei team characterized this part with thermal stability... It is obvious that KR contribute to most of the fluorescence. ... A sigmoidal curve was fitted to find the particular temperature K at which half of the KR protein is denatured studied by measuring the fluorescence. ... NYMU 2016 also developed this part to construct a fungal expression... 2019 KOREA team characterized this part with phtotoxicity ...KillerRed is the light induced killswitch producing rhe reactive oxygen...spieces. When cells transfected with killswitch gene is exposed to the green... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I13973","videoId":"BBa_I13973","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5A - [ Composite,classic, composite, uncategorized ] ['c1 promoter YFP aav reporter device...This is meant to serve as a reporter device for the synchronized oscillator....']"},{"machine":"BBa_S03653","videoId":"BBa_S03653","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5B - [ Intermediate,chassis, bacteriophage, T7 ] []"},{"machine":"BBa_B0017","videoId":"BBa_B0017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5C - [ Terminator,direction, forward, terminator, double ] []"},{"machine":"BBa_J04771","videoId":"BBa_J04771","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5D - [ Device,classic, device, uncategorized ] ['This is a ForAptRibo Riboswitch device that contains a EYFP reporter region...']"},{"machine":"BBa_B0021","videoId":"BBa_B0021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5E - [ Terminator,direction, bidirectional, terminator, single ] []"},{"machine":"BBa_J04871","videoId":"BBa_J04871","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5F - [ Device,classic, device, uncategorized ] ['This is a RevAptRibo Riboswitch device that contains a EYFP reporter region...']"},{"machine":"BBa_I13521","videoId":"BBa_I13521","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5G - [ Reporter,classic, reporter, pret ] ['The DNA corresponding to this part is amplified and extracted from liquid...A clone resulting from each transformation is subcultured in liquid culture of...OD600 of 0.4 is reached. ...Each of the 8 liquid cultures is divided into 3 corresponding to 3 different...A time course experiments is realized measuring the OD600 and mRFP...meaning that even at this low concentration the tetracycline is toxic for...but the subpart description is not coherent with this description as it is...stated that this reporter construct has a ptetR promoter regulated by...R represent the strain that only has tetR repressible promoter without RBS and...represent the strain that only has tetR repressible promoter without RBS and...As I13521 is under the control of a TeT repressible promoter we elected to...further investigate the control this promoter displays on the output of RFP....BioBrick under the control of the LacI promoter to act as a positive control....output through the TeT repressible promoter....promoter. As J04450 is under the control of the LacI promoter it would be...cells containing only LB which is what is seen above. Additionally aTc acts...culture. This result is also seen in the chart below....']"},{"machine":"BBa_J04971","videoId":"BBa_J04971","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5H - [ Device,classic, device, uncategorized ] ['This is a 3AptRibo Riboswitch device that contains a EYFP reporter region...']"},{"machine":"BBa_I13522","videoId":"BBa_I13522","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5I - [ Reporter,classic, reporter, pret ] ['Untagged GFP behind a constitutive promoter....This part was used to characterize the cell free chassis. Details of...we planned to use bacterial promoter pTET as a upstream of our coding region...but for it to act effectively we need to quantify that its promoter activity...bacterial promoter in bacterial medium Luria Broth and mammalian cell culture...The bacterial promoter pTET constitutively expresses comparable amount the...We characterized this part using fluorescence at different concentrations of...']"},{"machine":"BBa_I13535","videoId":"BBa_I13535","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5J - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_C0171","videoId":"BBa_C0171","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5K - [ Coding,cds, cds, transcriptionalregulator, activator, cds, transcriptionalregulator, repressor, function, cellsignalling, function, regulation, transcriptional ] ['Promoter and obtain our original improved Prhl included in...Our purpose is to create strong Prhl for our final genetic circuits. This...for this result is unclear....obtained 198 Prhl mutants and chose the two Prhl mutants of which promoter...characters indicate the scar sequence and a single point mutation is colored...']"},{"machine":"BBa_I732821","videoId":"BBa_I732821","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5L - [ Intermediate ] []"},{"machine":"BBa_C0179","videoId":"BBa_C0179","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5M - [ Coding,cds, cds, transcriptionalregulator, activator, function, cellsignalling, function, regulation, transcriptional ] ['In our project this year LasR is not only a component in the quorum sensing...and LasR inhibitors which is shown in the references 2 3 . Also the...We improved this part by characterising the crosstalk between LasR and non ...year we have done two more experiments for improving this part ... 2 Our fluorescence measurement is real time process rather than a time point. ...downstream from the pLas promoter and recorded the fluorescence for different...We improved this part by characterising the crosstalk between LasR and non ...placed the coding sequence downstream from the pLas promoter and recorded the...']"},{"machine":"BBa_I732830","videoId":"BBa_I732830","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5N - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_C0161","videoId":"BBa_C0161","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5O - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] [' Note In the Spring 2009 Distribution Plate the insert size for this part...Add more about the biology of this part here...which is the Acyl homoserine lactone synthase LuxI coding sequence...It is part of our our Valencia UPV IGEM 2018 Printeria...']"},{"machine":"BBa_I732835","videoId":"BBa_I732835","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 5P - [ Intermediate ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_B1005","videoId":"BBa_B1005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6A - [ Terminator,terminator, single, direction, forward ] []"},{"machine":"BBa_K1031410","videoId":"BBa_K1031410","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6B - [ Coding,cds, transcriptionalregulator, activator, chassis, prokaryote, ecoli, function, regulation, transcriptional, terminator, double ] ['HcaR is a 32 kDa 296 amino acids protein which belongs to LysR family.... Figure.1 The ph promoter and the degradation pathway carried out by the...hca gene cluster. a The ph is a 70 dependent promoter. The HcaR protein...The cognate promoter of HcaR ph is quite regular it is 70 dependent and...operator in the ph promoter Fig. 1a ....derivatives. It aromatics sensing profile is quite narrow supposed to be... Ph HcaR biosensor circuit is constructed. The coding sequence of HcaR was...constitutive promoters at different intensities are constructed to fine tune...represent promoters. RBSs are shown as green ovals. Squares in dark red refers...section. The constitutive promoter Pc to control the expression of HcaR...used a library of combinations of Pc promoters and RBS sequences to tune the...specific sensor for PPA CnA is not an aromatic compound thus not taken into... Figure.3 RBS and Pc constitutive promoter library for HcaR biosensor. X...']"},{"machine":"BBa_B1006","videoId":"BBa_B1006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6C - [ Terminator,terminator, single, direction, forward ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1033000","videoId":"BBa_K1033000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6D - [ Coding,chassis, prokaryote, ecoli, chassis, prokaryote, ecoli, nissle, chassis, prokaryote, lactobacillus, Kit plates, probiotics, Kit plates, probiotics, production ] ['Tyrosine ammonia lyase TAL is an enzyme which catalyzes the formation of... 1 . P coumaric acid is an important precursor in many metabolic pathways. TAL...P coumaric acid is also needed as a precursor for many metabolites in the...We expressed our protein with a promoter working in both lactobacillus and E....with constitutive promoters in E. coli. The negative control has no bands ...showing that there is no natural protein in wildtype E. coli with the same...experiments show that there is a somewhat lower concentration in the sample...incubation. The negative control is an extract from a strain with no TAL gene...on the transformed plasmid. The positive control is an extract of a culture of...has two peaks. The one around 305 nm is preferable to detect because of...promoter J23110. b Spectra from the strain with TAL CDS with promoter CP8.... c Spectra from the strain with TAL CDS with promoter J23101. d Standards of...']"},{"machine":"BBa_B1007","videoId":"BBa_B1007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6E - [ Terminator,terminator, single, direction, bidirectional ] []"},{"machine":"BBa_K1092001","videoId":"BBa_K1092001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6F - [ Device ] []"},{"machine":"BBa_B1008","videoId":"BBa_B1008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6G - [ Terminator,terminator, single, direction, bidirectional ] []"},{"machine":"BBa_K1104204","videoId":"BBa_K1104204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6H - [ Regulatory ] ['AhpCp2D1 is a ROS induced promoter controlled by OxyR transcription factor ...which is activated by ROS Reactive Oxygen Species ....AhpCp2D1 is composed of AhpCp2...promoter DsbGp...We improved a BioBrick Part ahpC promoter...image object EG11384 composition contains hybrid promoters shared TFBS... Transcription Factor Binding Site and reverse promoter DsbG. In this part...ahpC promoter as well as its improvement can be activated by OxyR...promoter DsbGp...cutting site. Thus we improved the promoter by first mutating the PstI cutting...point and the Dsbg coding sequence is removed. ...Here is the overview about the other ahpC promoter...The PstI cutting site is mutated. ...DsbG promoter sequence is removed. ...one promoter AhpCp2 and its TFBS. ...Bidirectional promoter AhpCp1 and DsbGp reverse promoter and their shared...one promoter AhpCp1 and its TFBS. ...project there are some previous iGEM team who used OxyR induced promoter ...it for the ink of E.coli Pen colorful. And those OxyR induced promoters...Since ROS is a natural byproduct of the metabolism and have important roles in...cell signaling and homeostasis the improvement of ROS induced promoter is...useful for sensing some specific conditions. ROS is found to involve in...cancer aging and apoptosis. Thus ROS induced promoter in the future...']"},{"machine":"BBa_B1009","videoId":"BBa_B1009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6I - [ Terminator,terminator, single, direction, bidirectional ] []"},{"machine":"BBa_K1166002","videoId":"BBa_K1166002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6J - [ Composite ] ['The alpha hemolysin system is one of the best studied type 1 secretion systems...This is a device that allows a protein to be secreted by means of the alpha ...that you have to do is to assemble your protein part in the device via the...Although the signal is weak for some lanes all therapeutic proteins with the...This finding reveals that the HlyA peptide is not enough for the secretion of...TAT APOPTIN HlyA but on the other hand APOPTIN is being secreted to the...the growth medium fraction may suggest three things a TAT APOPTIN is being...medium fraction is recovered....implies that the secretion complex is efectively required for the active...media is unlikely to be attributed to premature cell lysis....2 . the hemolysin secretion system is sufficient only to small range of...free functional domains in vivo. OmpT is a protease localized to the outer...test OmpT cleavage activity. And the ARRA site is flanked with GS in order to...mRFP is apparently more suitable for the fusion of hlyA to testify the...In order to further investigate whether the OmpT cleavable is functional and...promoter and the double terminator in the HlyA secretion system to construct...arabinose promoter is 0.2 in the unsimplified HlyA system....system also has a TolC protein but its coding gene is not presented in the...part. So the function of the transmembrane complex that is encoded by the...Since the number of bacteria is kept at the same level we can roughly rule...transmembrane complex is not available. So the resources that should be given...4.How to explain the phenomenon described in 2 is more obvious after inserting...promote the combination of ribosomes and mRNA. So there is more rfp... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_B1010","videoId":"BBa_B1010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6K - [ Terminator,terminator, single, direction, forward ] []"},{"machine":"BBa_K1033910","videoId":"BBa_K1033910","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6L - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, color, function, reporter, pigment ] ['the color development is slower. The color is readily observed in both LB or...This part is useful as a reporter....Figure 1. under blue light excitation The left one is fwYellow...absorbed light we found that the spectrum of fwYellow is too narrow. Due to...the low precision of the instrument it is impossible to accurately measure...its excitation light and emission light. The excitation light is around 522 nm...and the emission is about 536 nm....Figure.1 under UV excitation The right one is fwYellow...scanning range of emission spectrum is 420 530nm and the scanning range of...emission spectrum is 490 600nm. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I732105","videoId":"BBa_I732105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6M - [ Coding,cds, transcriptionalregulator, repressor ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K1033916","videoId":"BBa_K1033916","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6N - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, fluorescence, function, reporter, pigment ] ['the color development is slower. The color is readily observed in both LB or...This part is useful as a reporter....This version is codon optimized for E coli by Genscript....standard quantum yield of 0.5 is also consistent with the previously published...Summary Although amajLime is described as chromoprotein in the main page we...fluoresece ex em of purified amajLime which is diluted to 10 g 100 l...the amajLime protein was correct which is consistent with the expected...more amajLime protein can be obtained with IPTG induction. As is shown in lane...expression and purification strategy is effective....The concentration of amajLime is 0.6608 mg ml....molecular mass of amajLime protein is 26.898kDa the value of the sharpest...peak is shown as the molecular mass of amajLime protein . Moreover the...intensity of 26.898kDa is up to 4x105 which indicates the high concentration... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I732106","videoId":"BBa_I732106","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6O - [ Coding,cds, transcriptionalregulator, repressor ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K1150001","videoId":"BBa_K1150001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 6P - [ Coding ] ['Virus Protein 16 VP16 is a transcription factor encoded by the UL48 gene of...regulatory element in the upstream promoter region of immediate early genes...core domain in its central region which is necessary for the indirect DNA...The TAD of VP16 is one of the most efficient TADs. It is widely fused to host...VP16 is originally a part of the virus particle from HSV and is released into...DNA sequence in the promoter region of immediate early genes where VP16...VP16 is one of the most effective once 1 .... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I732100","videoId":"BBa_I732100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7A - [ Coding,cds, transcriptionalregulator, repressor ] ['Suffix are added to both ends of this part for standard assembly....The lac repressor is a DNA binding protein which inhibits the expression of...helix turn helix motif is the only region that serves to bind DNA. Figure I...']"},{"machine":"BBa_I746001","videoId":"BBa_I746001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7B - [ Signalling ] ['This part is simply the AIP generator...In the natural system the signalling oligopeptide termed AIP is made from...AgrD by the membrane located enzyme AgrB. It is then detected by the membrane ...and upregulates transcription of the promoters termed P2 and P3 in the agr...This part contains the coding regions for group I agrB and agrD in that...']"},{"machine":"BBa_I715020","videoId":"BBa_I715020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7C - [ Reporter,function, reporter, fluorescence ] ['the usage of this part and tested its function.... A pair of primers that can extent the usage of this part... the C terminal of GFP that part is also improved and tested the their...']"},{"machine":"BBa_I763005","videoId":"BBa_I763005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7D - [ Generator ] ['cI repressor LVA regulated by pLac Promoter...the protein is regulated by pLac Promoter R0010 ....']"},{"machine":"BBa_I746360","videoId":"BBa_I746360","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive ] ['PF promoter from P2 phage...This is the PF promoter taken from the P2 phage genome. It is an inducible...promoter that is activated by a class of activators including P2 ogr...activators should cause different levels of activity of the PF promoter.... promoter ...']"},{"machine":"BBa_I732107","videoId":"BBa_I732107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7F - [ Coding,cds, transcriptionalregulator, repressor ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_I746361","videoId":"BBa_I746361","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7G - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive ] ['PO promoter from P2 phage...This is the PO promoter taken from the P2 phage genome. It is an inducible...promoter that is activated by a class of activators including P2 ogr...activators should cause different levels of activity of the PO promoter.... promoter ...']"},{"machine":"BBa_I732110","videoId":"BBa_I732110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7H - [ Coding,cds, transcriptionalregulator, repressor ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_I746364","videoId":"BBa_I746364","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7I - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive ] ['Psid promoter from P4 phage...This is the Psid promoter taken from the P4 phage genome. It is an inducible...promoter that is activated by a class of activators including P2 ogr...activators should cause different levels of activity of the Psid promoter.... promoter ...']"},{"machine":"BBa_I732115","videoId":"BBa_I732115","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7J - [ Coding,cds, transcriptionalregulator, repressor ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_I750013","videoId":"BBa_I750013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7K - [ Coding,cds, transcriptionalregulator ] ['This protein is part of a two part signaling system. Phosphorylation of ComA...transcription from a specific response promoter. This protein is not...']"},{"machine":"BBa_R0052","videoId":"BBa_R0052","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7L - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter 434 cI regulated ...The 434 cI regulatory region sequence is a 89 base pair sequence with the...434 cI is a member of the lamboid cI protein family. Very strong promoter. It...is not well matched with the other available promoters and may be unstable at... promoter ...']"},{"machine":"BBa_I746909","videoId":"BBa_I746909","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7M - [ Generator ] ['superfolder GFP driven by T7 promoter...This is one of the constructs used to characterise superfolder GFP see...Japan a validated this part in BL21 DE3 . ...Fig.1 This is our Abs600 Standard Curve measured by PerkinElmer Multipmode...Fig.2 This is our Fluorescein Standard Curve measured by...Fig.3 This figure shows the fluorescence is highly proportional to Abs600 the...concentration of microorganisms. This means the GFP fluorescence is to be...This part was improved by Team Manchester 2019...adding sfGFP to a pTet promoter. Fluorescence intensity is higher especially...during the first few hours and gene expression is more tightly controlled....Superfolder GFP also known as sfGFP is a GFP derived green fluorescent...protein. P delacq et al. 2006 . GFP is a protein isolated from the jellyfish...intensity Frenzel et al. 2018 . This composite part is made of sfGFP...expressed by a Tet promoter...protein is able to express colour and auto secrets to the media....To show whether this part worked we decided to measure fluorescence ... Colour Alone represents this part pTet sfGFP. The values suggest that...sfGFP is expressed at very high levels in both DH5a and BL21 DE3 ....and functionality of sfGFP with Tet promoter....after induction with 100 nM of anhydrotetracycline. sfGFP with Tet is labelled...This is an essential new part as sfGFP is a very common reporter gene....Manchester https 2019.igem.org Team Manchester Improve how this is an...improved part over the sfGFP provided by iGEM with a T7 promoter. We hope that...GFP driven by T7 promoter As we wanted to produce a signal only in case of...has an integrated T7 promoter and a Ribosome Binding Site before the encoded...removed the promoter and RBS sequence. Then we run PCR with primers that had...sample where the triggering DNA is included to be expressed normally....As expected there is some leakage present in the final results but given that...the output of the reading while the wanted sequence is present is more than... 2019 iGEM TUDelft https 2019.igem.org Team TUDelft characterized this part...expression system is a valid contribution to the development of the iGEM cell ...over in vivo protein production methods and is gaining more and more attention...choice for a system that rely on purified protein is based on the fact that...The PUREfrex system GeneFrontier Corporation Japan is used for cell free...signal. GFP is the translated protein of interest of this construct. To follow...of GFP is plotted over time a classical sigmoidal expression curve could be...time course reaction of SYBRsafe measurement is shown in Figure 2....promoter medium promoter strong RBS to T7 expression. Some proteins fold...better under constitutive promoters however nobody had yet directly compared...We found that the T7 promoter produced about 2.6 times as much fluorescent...signal as the constitutive PR4 promoter indicating that T7 is much more...however after the initial expression the promoter seems to be shut off. ...and PR4 Green . The T7 promoter lead to about 2.6 as much protein being... Promoter and RBS ...PR4 medium Promoter J23110 strong RBS B0034 ...The T7 promoter comes from the T7 bacteriophage and is a lac promoter ... Studier et al 1990 Meth. Enzymol. 10 605 . Lac promoters can be...leaky meaning that there is incomplete repression of gene expression. As we...wanted to use the T7 promoter in our project the main aim of these...experiments was to determine how leaky the T7 promoter actually is by using... leakiness of sGFP expression under control of the T7 promoter in three E....coli expression strains. E. coli BL21 is the most widely used strain of E....coli used for protein expression however expression from a T7 promoter...from the T7 promoter Studier et al 1986 J. Mol. Biol. 189 113 . As...stated above the T7 promoter is known to be leaky therefore E. coli ... Studier 1987 Cell. 49 221 . This is a natural inhibitor of T7 RNA...control of the T7 promoter. In these cultures we expect to see no sGFP...into E. coli BL21 DE3 pLysS which is resistant to chloramphenicol ...promoter. Less sGFP expression was seen in cultures of E. coli ...strains would have sufficient control over expression from the T7 promoter and...Expression of sGFP measured by fluorescence is only seen in IPTG induced...The images taken on Ch02 demonstrate that sGFP fluorescence is only detected...T7 promoter show that in our lab expression from the T7 promoter is...cell growth until expression of the enzymes is induced. In addition strains...']"},{"machine":"BBa_R1050","videoId":"BBa_R1050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7N - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter Standard HK022 cI regulated ... Note This is the same part as R0050 except that the 10 and 35 sites and...The pR regulatory region is a 98 base pair sequence with standard BioBrick...transcription of a gene upstream thus the pM 10 region is not included . The... promoter ...']"},{"machine":"BBa_J37032","videoId":"BBa_J37032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7O - [ Project ] ['GFP expression controlled by LuxR promoter...This forms a GFP coding region which is controlled by the pLuxR promoter. This...Compared to the previous part the expression of the new part is particularly...']"},{"machine":"BBa_I20270","videoId":"BBa_I20270","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 7P - [ Measurement ] ['Promoter MeasKit J23151 ...J23151 inserted in the Promoter MeasKit...I20270 serves as the positive control for the iGEM InterLab study. It is in...']"},{"machine":"BBa_I732112","videoId":"BBa_I732112","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8A - [ Coding,cds, transcriptionalregulator, repressor ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K1150002","videoId":"BBa_K1150002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8B - [ Coding ] ['promoters. ...']"},{"machine":"BBa_J52012","videoId":"BBa_J52012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8C - [ Reporter,cds, enzyme, function, reporter, light ] ['Rluc linker PEST191 is a part composed of Rluc which acts as a reporter ...linked with PEST191 through six aminoacid long protein linker. PEST191 is a...']"},{"machine":"BBa_K1150003","videoId":"BBa_K1150003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8D - [ Coding ] ['This BioBrick is part of the Freiburg 2013 uniCAS toolkit for gene...methyltransferase HMTase G9a encoded by the murine EHMT2 gene. G9a is able...histone 3 H3K9 1 . This part only contains the catalytically active SET...domain of G9a that is responsible for histone modification. By fusing an...targeting is possible. In regions of open chromatin structures H3K9...RFC25 pSB1C3 backbone. dCas9 G9a under a CMV promoter is expressed at the...this the endogenous VEGF A locus was chosen as it is well characterized...In summary the CMV dCas9 G9a is an effective repressor of endogenous gene...']"},{"machine":"BBa_J52021","videoId":"BBa_J52021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8E - [ Coding,cds, reporter, gfp, chassis, eukaryote, human, function, immunology, function, reporter, fluorescence ] ['Part is composed of TIR domain of Traf6 and GFP linked with 6 aminoacids long...']"},{"machine":"BBa_K1150004","videoId":"BBa_K1150004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8F - [ Coding ] ['Phytochrome B is a photoreceptor which detects red and far red light. In...establishment. It is a protein with a molecular mass of 125 kDa that is...C terminal regulatory part. The N terminal part is covalently bound to...phytochromibilin. Phytochromibilin is a linear tetrapyrol that undergoes...bound to the phytochrome moiety. This conformational change is responsible for...']"},{"machine":"BBa_E2020","videoId":"BBa_E2020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8G - [ Reporter,chassis, eukaryote, yeast, function, reporter, fluorescence ] ['Derived from ECFP. Has single exponential decay kinetics is at least 2X...brighter than ECFP and is more resistant to photobleaching....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150005","videoId":"BBa_K1150005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8H - [ Coding ] ['The Phytochrome Interaction Factor 6 PIF6 is derived from Arabidopsis...']"},{"machine":"BBa_E2030","videoId":"BBa_E2030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8I - [ Reporter,chassis, eukaryote, yeast, function, reporter, fluorescence ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150006","videoId":"BBa_K1150006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8J - [ Coding ] ['Sunlight is essential for plants Not only as an energy source but also as...In the absence of UVB light UVR8 forms homodimers. This is its closed...configuration. When UVB light is perceived UVR8 monomerizes and changes into...its open configuration. UVR8 is then able to recruit...Freiburg 2013 used this part to engineer a UVB light induced mechanism to...']"},{"machine":"BBa_E2060","videoId":"BBa_E2060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8K - [ Reporter,chassis, eukaryote, yeast, function, reporter, fluorescence ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150007","videoId":"BBa_K1150007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8L - [ Coding ] ['Sunlight is essential for plants Not only as an energy source but also as...PHOTOMORPHOGENIC 1 COP1 is the interaction partner of ultraviolet B UVB ...ubiqutin ligase activity of this COP1 is eliminated only the WD40 domain...When UVB light is perceived by the UVR8 photoreceptor it monomerizes and...therefore changes in its open confuguration. Then it recruits COP1. This is a...photomorphogenesis 3 . Freiburg 2013 used this part to engineer a UVB light...']"},{"machine":"BBa_C0070","videoId":"BBa_C0070","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8M - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150010","videoId":"BBa_K1150010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8N - [ Signalling ] ['The nuclear localization signal or nuclear localization sequence NLS is a...The NLS is recognized by importins which enable the nuclear proteins the...']"},{"machine":"BBa_C0071","videoId":"BBa_C0071","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8O - [ Coding,cds, cds, transcriptionalregulator, activator, cds, transcriptionalregulator, repressor, function, cellsignalling, function, regulation, transcriptional ] ['Rhl promoter...Promoter and obtain our original improved Prhl included in...Our purpose is to create strong Prhl for our final genetic circuits. This...for this result is unclear....obtained 198 Prhl mutants and chose the two Prhl mutants of which promoter...characters indicate the scar sequence and a single point mutation is colored...We improved this part by characterising the activation range of RhlR and the...downstream from the pRhl promoter and recorded the fluorescence for different...orthogonal with Cin. It is also seen that RhlR only exhibits slight activity...at high concentrations at 3O C12 AHL. RhlR is seen to be significantly...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150011","videoId":"BBa_K1150011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 8P - [ Regulatory ] ['SV40 promoter... Function Promoter ...SV40 promoter is a viral promoter derived from Simian Virus 40....enables the teams to choose from differently strong mammalian promoters ...In an earlier study CMV and SV40 promoter were tested in different B and T...cells as well as in two non lymphoid cells. In all cell lines the CMV promoter...In comparison to the cellular promoter VV1 SV40 showed similar activities....Hence with an SV40 promoter one can gain a more physiologic control for...Comparison of CMV RSV SV40 viral and VV1 cellular promoters in B and T...']"},{"machine":"BBa_K203109","videoId":"BBa_K203109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9A - [ Regulatory ] ['Constitutive promoter 2.5 REU...A constitutive promoter from the Heidelberg 2009 library of promoters for use...We generated a library of constitutive promoters by RA ...PCR http 2009.igem.org Team Heidelberg Project Synthetic promoters . We...characterized those promoters by Flow cytometry....This promoter corresponds to clone S4. We confirmed the initial measurement by...an independet technique image analysis . Its expression strength is approx...']"},{"machine":"BBa_K079015","videoId":"BBa_K079015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9B - [ Coding,cds, membrane, pump ] []"},{"machine":"BBa_K203110","videoId":"BBa_K203110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9C - [ Regulatory ] ['Constitutive promoter 0.4 REU...A constitutive promoter from the Heidelberg 2009 library of promoters for use...We generated a library of constitutive promoters by RA ...PCR http 2009.igem.org Team Heidelberg Project Synthetic promoters . We...characterized those promoters by Flow cytometry....This promoter corresponds to clone S5. We confirmed the initial measurement by...an independet technique image analysis . Its expression strength is approx...']"},{"machine":"BBa_K200008","videoId":"BBa_K200008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9D - [ Coding ] [' PAH http en.wikipedia.org wiki Phenylalanine hydroxylase is the enzyme...additional cofactor TPNH is required for the hydrolysis to take place PAH4....The enzyme is stable between 7 and 40 degrees celsius PAH2 and in this range...Phenylketonuria is a condition whose prevalence varies considerably with...populations. In Northern Europe for example the incidence is estimated to 1 in...10000 PAH6. At the other end of the spectrum Turkey is estimated to have an...incidence of 1 in 2600 births PAH6. This condition is due to the inability of...former form of the disease is linked to a deficient PAH enzyme sequence that...renders the resulting protein non functional. The latter is due to a deficient...']"},{"machine":"BBa_K203111","videoId":"BBa_K203111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9E - [ Regulatory,Kit plates, immune_regulation, sense-control ] ['Constitutive promoter 2 REU...A constitutive promoter from the Heidelberg 2009 library of promoters for use...We generated a library of constitutive promoters by RA ...PCR http 2009.igem.org Team Heidelberg Project Synthetic promoters . We...characterized those promoters by Flow cytometry....This promoter corresponds to clone S10. We confirmed the initial measurement...This is based on the activation of NF B by proinflammatory cytokines such as...and adhesion molecules. This part contains a synthetic promoter upregulated by...']"},{"machine":"BBa_K200028","videoId":"BBa_K200028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9F - [ Coding ] ['The Homo sapiens endogenous enzyme is synthesised by the liver. However as...proteases PRPAH1. In fact it is thought that phosphorylation of the serine 16...state is mimicked by replacing the serine with a glutamine residue....']"},{"machine":"BBa_K203118","videoId":"BBa_K203118","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9G - [ Regulatory ] ['Constitutive promoter 1 REU...A constitutive promoter from the Heidelberg 2009 library of promoters for use...We generated a library of constitutive promoters by RA ...PCR http 2009.igem.org Team Heidelberg Project Synthetic promoters . We...characterized those promoters by Flow cytometry in...This promoter corresponds to clone L1. We confirmed the initial measurement by...an independet technique image analysis . Its expression strength is approx 1...']"},{"machine":"BBa_I6058","videoId":"BBa_I6058","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9H - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test I0500.E0430... Induction and Subsequent Inhibition of the pBAD Promoter... Expression by the pBAD promoter can be regulated tightly by induction and...The pBAD promoter holds great potential to control the expression of genes...that require tight regulation as it is capable of both an induction and...from 2015 found that the pBAD promoter exhibits an almost all or none...was evident that this promoter on a high copy vector would be inappropriate...promoter.png http 2017.igem.org wiki images archive f f5 20171102025131 21T... SDU Denmark pBAD promoter.png ...promoter is both inducible and repressible as required when cloned into the...']"},{"machine":"BBa_K203125","videoId":"BBa_K203125","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9I - [ Regulatory ] ['SREBP regulated promoter predicted tested HB8...SREBP upregulated promoter predicted by...in the ER membrane is inhibited resulting in cleavage of SREBP and migration...to the nucleus. Image is public...Sterol regulatory element binding protein SREBP is a transcription factor...concentration of cholestrol SREBP is present in an inactive form anchored to...concentration decreases SREBP is cleaved by the proteases site 1 protease and...aminoterminal domain of SREBP is translocated into the nucleus and binds to... HB8 this part is upregulated by sterol depletion active condition ...']"},{"machine":"BBa_I6088","videoId":"BBa_I6088","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9J - [ Measurement,classic, measurement, o_h ] ['Promoter O H Test I0500.E0432...']"},{"machine":"BBa_S03335","videoId":"BBa_S03335","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9K - [ Reporter,classic, reporter, pret ] ['Pr promoter of the lambda system combined with GFP as a quantification and...']"},{"machine":"BBa_I13512","videoId":"BBa_I13512","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9L - [ Measurement,classic, measurement, uncategorized ] [' Note This is NOT the most current version of the measurement device of...']"},{"machine":"BBa_J33202","videoId":"BBa_J33202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9M - [ Reporter ] []"},{"machine":"BBa_I13514","videoId":"BBa_I13514","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9N - [ Measurement,classic, measurement, uncategorized ] []"},{"machine":"BBa_J33201","videoId":"BBa_J33201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9O - [ Generator ] ['E. coli chromosomal ars promoter with arsR repressor gene...This part consists of the promoter of the E. coli JM109 chromosomal arsenic...ribosome binding site. Addition of any other genes to the 3 end of this part...protein ArsR resulting in inability to repress the promoter. Based on our...The following is from TJU China 2018. We used the part Bba J33201 saved in...Then we performed PCR on the promoter fragment and ArsR fragment in this...Figure2. The result of nucleic acid gel electrophoresis of Ars Promoter after...PCR. lane M Marker. Lane 1 4 Ars Promoter. ...As shown in Fig.2 our biosensor based on J33201 part is very sensitive to...The threshold of this biosensor is 10 ppm. As the arsenite concentration...our biosensor constructed on the basis of J33201 is sensitive and fast. The...biobrick includes the ArsR repressor binding site the arsR promoter a...inhibiting its own promoter Diorio et al. 1995 . When an arsenic ion is...present it will bind to ArsR. This complex is not able to inhibit the...promoter making expression of upstream reporter genes possible....expression of mCherry is As V dose dependent Figure 2 and 3 . We recommend a...']"},{"machine":"BBa_S01004","videoId":"BBa_S01004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 9P - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_C0072","videoId":"BBa_C0072","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10A - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150012","videoId":"BBa_K1150012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10D - [ Terminator ] []"},{"machine":"BBa_C0073","videoId":"BBa_C0073","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10C - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_C0074","videoId":"BBa_C0074","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10E - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150013","videoId":"BBa_K1150013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10F - [ Coding ] ['This is a short linker of the three amino acids AGS. Using this part you can...connect fusion proteins. The DNA Sequence is GCAGGCTCC. For a more flexible...']"},{"machine":"BBa_C0075","videoId":"BBa_C0075","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10G - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150016","videoId":"BBa_K1150016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10H - [ Tag ] ['It is derived from a surface glycoprotein of the human virus. The tag consists...sequence. In contrast the RFC25 biobrick which is also suitable for...']"},{"machine":"BBa_C0076","videoId":"BBa_C0076","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10I - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] ['autoinducer synthetase This part codes for an autoinducer synthetase which...C0077 to make a complex which can activate the Cin promoter...and separate transcriptional elements. There is a short 200bp intergenic...region between cinR and cinI. The cinR intergenic cinI structure is conserved... Rhodobacter sphaeroides. The intergenic region is thought to contain a...terminator for cinR a promoter and RBS for cinI and a dna binding domain for...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150034","videoId":"BBa_K1150034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10J - [ Device ] ['promoter driving the expression of the tracrRNA which is mediating the...crRNA gives rise to the specific binding of dCas9 to DNA and is under control...of the human U6 promoter. The 30 bp target site can be inserted by simply...On this plasmid two RNAs are encoded. The tracrRNA is mediating the...dummy DNA is inserted which has two BbsI cleavage sites. After digesting with...BbsI the locus is opened and the DRs end with sticky ends so new targets can...Once single loci are inserted it is easy to combine several loci on one...with various targets. We tested if it is possible to activate transcription of...plasmid. Experiment has been conducted as decribed above. It is clearly...visible that activation depends on which target site is ligated into the...A main feature of the CRISPR Cas9 system is the ability to target multiple...loci at once. To test whether this is possible putting more than one target...promoter using two single loci plasmids and an engineered RNAimer plasmid...As we see in figure 3 there is no difference in activation of a SEAP reporter...']"},{"machine":"BBa_C0077","videoId":"BBa_C0077","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10K - [ Coding,cds, cds, transcriptionalregulator, activator, function, cellsignalling, function, regulation, transcriptional ] ['and separate transcriptional elements. There is a short 200bp intergenic...region between cinR and cinI. The cinR intergenic cinI structure is conserved... Rhodobacter sphaeroides . The intergenic region is thought to contain a...terminator for cinR a promoter and RBS for cinI and a dna binding domain for...We created a new version of this part without the LVA degradation tag...orthogonal with Rhl and Lux. However it is seen that CinR is activated by...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150035","videoId":"BBa_K1150035","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10L - [ Device ] []"},{"machine":"BBa_C0078","videoId":"BBa_C0078","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10M - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150036","videoId":"BBa_K1150036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10N - [ Device ] []"},{"machine":"BBa_C0079","videoId":"BBa_C0079","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10O - [ Coding,cds, cds, transcriptionalregulator, activator, function, cellsignalling, function, regulation, transcriptional ] ['We improved this part by characterising the activation range of LasR and the...downstream from the pLas promoter and recorded the fluorescence for different...system is orthogonal with Rhl and Lux. However it is seen that LasR is...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...']"},{"machine":"BBa_K1150037","videoId":"BBa_K1150037","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 10P - [ Device ] []"},{"machine":"BBa_I714075","videoId":"BBa_I714075","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11A - [ Composite ] ['This is J01008 key 1 with B0015 double terminator in the end....']"},{"machine":"BBa_S01009","videoId":"BBa_S01009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11B - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_E0432","videoId":"BBa_E0432","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11C - [ Reporter,classic, reporter, ret ] ['This part does not work presumably because of the LVA tag strength. When...hooked up with 2 fine constitutive promoters no glowing was observed....']"},{"machine":"BBa_S01008","videoId":"BBa_S01008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11D - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_J06505","videoId":"BBa_J06505","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11E - [ Reporter,function, reporter, function, reporter, fluorescence ] []"},{"machine":"BBa_S01013","videoId":"BBa_S01013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11F - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_I763020","videoId":"BBa_I763020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11G - [ Intermediate ] []"},{"machine":"BBa_S01012","videoId":"BBa_S01012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11H - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_I746907","videoId":"BBa_I746907","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11I - [ Generator ] ['T7 promoter driving 6 his tagged P7 GFP...This part is used for purification of P7 GFP for source and other information...tag. It is driven by a T7 promoter. We used E.coli BL21 DE3 for expression...of this part addition of 1mM IPTG leads to expression of the T7 DNA...']"},{"machine":"BBa_I0406","videoId":"BBa_I0406","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11J - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_K112806","videoId":"BBa_K112806","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11K - [ Coding,cds, enzyme, lysis, function, celldeath ] ['Additionally we constructed three different versions of varying promoter...We successfully combine T4 endolysin with a constitutive promoter...Figure 1 is the gene map of T4 endolysin construct pSB1C3 K737007 K112806. ...product. The marker is 100bp. The length is 514bp as expected. ...PCR product. The marker is 100bp. The length is 2268bp as expected. ...Figure 4 is the bacterium with holin endolysin construct. As figure 3 shows ...the suicide mechanism is induced immediately when lactose is added into the...Figure 5 is the bacterium with holin endolysin NrtA construct. As figure 4...shows the trend of the relative absorbance is downward as the lactose is...added to induce the suicide mechanism. The concentration of lactose is also...']"},{"machine":"BBa_I0407","videoId":"BBa_I0407","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11L - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_K165002","videoId":"BBa_K165002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11M - [ RBS,ribosome, eukaryote, yeast, chassis, eukaryote, yeast, direction, forward, regulation, constitutive ] ['The kozak sequence initiates translation from eukaryotic mRNA. It is cloned...directly between a promoter and coding region to facilitate translation. The...start codon is included....']"},{"machine":"BBa_E0615","videoId":"BBa_E0615","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11N - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_K165009","videoId":"BBa_K165009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11O - [ Protein_Domain,proteindomain, dnabinding ] []"},{"machine":"BBa_I13023","videoId":"BBa_I13023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 11P - [ Project,classic, project, uncategorized ] []"},{"machine":"BBa_C0080","videoId":"BBa_C0080","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12A - [ Coding,cds, cds, transcriptionalregulator, activator, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K1150038","videoId":"BBa_K1150038","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12B - [ Device ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R0061","videoId":"BBa_R0061","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12C - [ Regulatory,awards, basic_part, chassis, prokaryote, ecoli, classic, regulatory, uncategorized, direction, forward, promoter, regulation, negative, rnap, prokaryote, ecoli, sigma70 ] ['Promoter HSL mediated luxR repressor ...This part involves the 10 binding site the 35 binding site and the twenty...nucleotides between that constitute the lux box. With this part LuxR...The Lux box is positioned such that it partially overlaps the consensus 35... lux Lux Lux box which is a 20 base inverted repeat unit is positioned...artificial lacZ promoter with the lux box positioned between and overlapping...promoter. It was found that full length...In order characterize this promoter we constructed the composite part... promoter ...']"},{"machine":"BBa_K1150039","videoId":"BBa_K1150039","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12D - [ Device ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R0073","videoId":"BBa_R0073","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter Mnt regulated ... Expression Level of the Mnt and PenI Regulated Promoters... The PenI regulated promoter exhibits a stronger expression than the Mnt ...regulated promoter. ...Applicability of two different promoters was studied for the expression of...and Mnt regulated promoters on pSB1C3 in E. coli MG1655 at OD600 0.3 0.5....From the data obtained it was evident that the PenI regulated promoter...promoter as seen in Figure 1. Furthermore the PenI regulated promoter... promoter ...']"},{"machine":"BBa_K1150040","videoId":"BBa_K1150040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12F - [ Device ] ['target 2 . This RNaimer is bulid of the uniCAS... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R0081","videoId":"BBa_R0081","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12G - [ Regulatory,classic, regulatory, uncategorized ] ['functional Operator2 site. when attached to the rest of the promoter region ...this part allows for the binding and loop formation that would result in...repression of the araC promoter...']"},{"machine":"BBa_K1150041","videoId":"BBa_K1150041","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12H - [ Device ] ['target 3 . This RNaimer is bulid of the uniCAS... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_R2000","videoId":"BBa_R2000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12I - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter Zif23 regulated test between...Promoter with standard 10 and 35 sites. A symmetric Zif23 dimer target site...This part successfully promotes transcription of GFP when placed upstream of... promoter ...']"},{"machine":"BBa_K1150042","videoId":"BBa_K1150042","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12J - [ Device ] ['target 4 . This RNaimer is bulid of the uniCAS... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_R2002","videoId":"BBa_R2002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12K - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter Zif23 regulated test between and after...Promoter with standard 10 and 35 sites. A symmetric Zif23 dimer target site...This promoter successfully drives transcription of GFP when placed upstream of... promoter ...']"},{"machine":"BBa_K1150043","videoId":"BBa_K1150043","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12L - [ Device ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E1010","videoId":"BBa_E1010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12M - [ Coding,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence, test ] ['Peking iGEM 2016 has fused this part with triple spytag. The fused protein is...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...the biobrick part is not of potential allergen status. In the 80 amino acid...other teams to better understand the nature and characteristics of this part...resulting model is regularized by using a force field. In case loop modelling...with ProMod3 fails an alternative model is built with PROMOD II Guex et...biologically relevant in the template library b the ligand is in contact...with the model c the ligand is not clashing with the protein d the...template. If any of these four criteria is not satisfied a certain ligand...The quaternary structure annotation of the template is used to model the...target sequence in its oligomeric form. The method Bertoni et al. is based...The QSQE score is a number between 0 and 1 reflecting the expected accuracy...Summary We have characterized the fluoresence of this part over time and at...Summary We have characterized the fluoresence of this part over time and at...believe that every team has a J04450 complex. After all it is our favorite...product is completely denatured shown in our characterization map with a...small amount of protein precipitation and the color is pale yellow . ...our system is possible to track the gene expression. ...this sequence is both compatible with the BioBrick and GoldenBraid 3.0....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...proteins at the beginning one of them is mRFP. To develop an oral cancer...candidate reporter genes. This part is composed of T7 promoter RBS mRFP ...fluorescent intensity is similar to the excitation graph. To the peak...is quite weak there is little difference between each pH value only the...absorbance wavelength of pH12 is lower than other pH values in both graph That...2 . T7 promoter RBS mRFP...']"},{"machine":"BBa_K1149051","videoId":"BBa_K1149051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12N - [ Composite ] ['Hybrid promoter phaCAB...In R. eutropha cells P 3HB is made through 3 steps. Two acetyl CoA molecules...We cloned the constitutive promoter J23104 RBS B0034 upstream of the native...phaCAB promoter and the phaCAB operon . Thus this part consists of a hybrid...promoter system which functions as an optimised bioplastic producing...and methods of changing the promoter on Imperial iGEM wiki PHB... A summary of the improved production of P3HB by our hybrid promoter phaCAB...synthesised P 3HB using our improved Biobrick part hybrid promoter phaCAB ...produced per cell. As indicated by other authors we saw that P3HB is found in...little fluorescence. In those that do the staining is qualitatively different...than in the phaCAB containing strains. Nile Red is also used as a lipid stain...and this is indicated by its staining of the membranes of EV cells. In...contrast in phaCAB containing cells staining is restricted to points within...produced by the cells containing the hybrid promoter is greater than from the...promoters which lead to phaCAB expression and therefore the amount of P3HB...produced. The images also suggest that not every single E.coli is stained....vector 2 constitutive promoter phaCAB 3 hybrid promoter phaCAB. Images...fluorescence no plastic at the bottom is the native promoter i.e. low...hybrid promoter respectively which both show high expression and thus...importantly our new Biobricks hybrid promoter phaCAB...promoter on Imperial iGEM wiki Module 1 Waste to...promoters for phaCAB. The plasmids all show similar growth curves in LB for...all 3 promoters. Indeed this is confirmed by an ANOVA test which shows no...The 3 phaCAB promoter constructs are represented with native phaCAB ...phaCAB promoter constructs in M9S with acetoacetate as sole carbon source....performing construct is hybrid phaCAB. According to ANOVA analysis there is...no statistical significance between the different phaCAB promoter constructs...Hybrid promoter in phaCAB growth in sole carbon sources under M9S. MG1655 E....0.0001 . This shows that there is a difference between individual carbon... Conclusions For native promoter and empty vector there is no significant...difference in growth for the same sole carbon source. There is a significant...picture is observed with the constitutive promoter for phaCAB. By far the...most interesting result is seen with the hybrid phaCAB promoter. There is a...J23104 B0034 NATIVE promoter pwt RBS phaCAB... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_C0024","videoId":"BBa_C0024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12O - [ Coding,cds, cds, enzyme, cds, enzyme, methylation, function, motility ] ['CheB is part of the chemotaxis pathway in E. coli....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...simulations. A short animation of the protein run for 1 ns is attached. RMSD...that the structure at 1 ns is slightly different from the initial structure ...the protein is stably folded over the 1 ns production run. The plot shows...']"},{"machine":"BBa_K1061001","videoId":"BBa_K1061001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 12P - [ Coding ] ['Apoptin is a protein that is originally isolated from the chicken anemia...in a broad spectrum of cancer cells but not in normal cells. Hence it is a...For each suicide gene it is important to know which cancer cells and normal... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K206000","videoId":"BBa_K206000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13A - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['pBAD is an E.coli promoter that is induced by L arabinose. In the absence of...K206000 is a variant pBAD promoter with a modified AraI1 site that has been...members PBAD Promoter Family PBAD Promoter Family allowing analog device...modified to permit homogeneous pBAD promoter expression by substituting the...chromosomal arabinose dependent promoter of AraE arabinose transporter...PBAD promoter in Escherichia coli by constitutive expression of the low ...As is shown in Fig.1 the cell number of experimental groups show a...pBAD is induced by L arabinose....Beyond our project pBAD is applied for heterologous gene expression due to...transcription which is particularly significant to expressing toxins. 2 ...tubes which is 1mL respectively. Centrifuge them at 4000rpm for 5 minutes....et al. Modulation of heterologous expression from PBAD promoter in Escherichia... promoter ...family pBAD promoter positive regulators 1...']"},{"machine":"BBa_I13261","videoId":"BBa_I13261","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13B - [ Signalling,function, cellsignalling ] []"},{"machine":"BBa_K206001","videoId":"BBa_K206001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13C - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['pBAD is an E.coli promoter that is induced by L arabinose. In the absence of...K206001 is a variant pBAD promoter with a modified AraI1 site that has been...members PBAD Promoter Family PBAD Promoter Family allowing analog device...modified to permit homogeneous pBAD promoter expression by substituting the...chromosomal arabinose dependent promoter of AraE arabinose transporter...PBAD promoter in Escherichia coli by constitutive expression of the low ... promoter ...family pBAD promoter positive regulators 1...']"},{"machine":"BBa_I13263","videoId":"BBa_I13263","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13D - [ Signalling,function, cellsignalling ] ['This part is supposed to serve as a potential detection and quantification...constitutively expressed. In the presence of AHL a LuxR AHL complex is formed...experiments the amount of AHL required for induction was analyzed. This part...Figure 1 The fluorescence of YFP is shown over time...that the amount of YFP produced is the same for all concentrations above...hours of incubation is visualized. It can be seen that the YFP signal after 2...Figure 2 The fluorescence of YFP is shown...outside of the bacteria is required for the induction of the LuxpR and in turn...induction of the LuxpR promoter by AHL which reaches its maximum induction at...']"},{"machine":"BBa_K228001","videoId":"BBa_K228001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13E - [ RNA ] ['and translate it into a Ser. There is no need to assembly SupD tRNA with a...rbs since it is not translated....The complementary information and the structure of the tRNA is predicted by...This part together with the T7ptag part make an AND Gate that is in the...presence of both the 2 parts T7 polymerase is tranlated into a functional...promoter. Which is the output of the AND Gate....']"},{"machine":"BBa_I13606","videoId":"BBa_I13606","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13F - [ Measurement,function, reporter ] []"},{"machine":"BBa_K145151","videoId":"BBa_K145151","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13G - [ Coding,cds, selectionmarker ] ['Coding region for the ccdB control of cell death gene. This part will cause...']"},{"machine":"BBa_I13604","videoId":"BBa_I13604","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13H - [ Reporter,classic, reporter, multiple ] []"},{"machine":"BBa_K145215","videoId":"BBa_K145215","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13I - [ Generator ] ['FILTER Key TetR promoter key ...case p TetR PoPs. If there is a short increase in transcription from this...promoter a small amount of J23066 RiboKey is produced. This is then used to...The final part of this filter is an AND gate which is used in the components...promoter with another RiboLock J23078 again . The AND gate will only function...if the duration of the noise is sufficiently long and intense a signal in...To construct this part we added a TetR responsive promoter to J23066....Sequence analysis shows that the sequence read does not match this part. This...']"},{"machine":"BBa_I13605","videoId":"BBa_I13605","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13J - [ Reporter,classic, reporter, multiple ] []"},{"machine":"BBa_K145201","videoId":"BBa_K145201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13K - [ Generator ] ['repressible promoter such as...']"},{"machine":"BBa_I13404","videoId":"BBa_I13404","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13L - [ Project,classic, project, uncategorized ] ['Has a deletion at the end of the pBAD promoter. Between transcription and...']"},{"machine":"BBa_K145300","videoId":"BBa_K145300","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13M - [ Composite ] ['lactonase is inhibited by the lock. When key is added or produced the...']"},{"machine":"BBa_I13405","videoId":"BBa_I13405","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13N - [ Project,classic, project, uncategorized ] ['Has a deletion at the end of the pBAD promoter. Between transcription and...']"},{"machine":"BBa_K145303","videoId":"BBa_K145303","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13O - [ Generator ] ['This device can generate GFP but the production of GFP is normally switched...off. Only when key is present GFP will be produced. In that case fluorescence...']"},{"machine":"BBa_I13516","videoId":"BBa_I13516","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 13P - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_I14017","videoId":"BBa_I14017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14A - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, RhlR ] ['RhlR and C4HSL regulated promoter.... promoter ...']"},{"machine":"BBa_K1061003","videoId":"BBa_K1061003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14B - [ Coding ] ['For each suicide gene it is important to know which cancer cells and normal... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I14033","videoId":"BBa_I14033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14C - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['Constitutive Promoter Medium Transcription...promoter for chloramphenicol resistance... promoter ...']"},{"machine":"BBa_I12036","videoId":"BBa_I12036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, negative, regulation, multiple, classic, regulatory, uncategorized ] ['Modified lamdba Prm promoter cooperative repression by 434 cI ...Lamdba Prm promoter modified to be activated by lamda repressor cI and... promoter ...']"},{"machine":"BBa_I15009","videoId":"BBa_I15009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14G - [ Coding,cds, enzyme, function, biosynthesis, phycocyanobilin, function, coliroid, function, sensor, light ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_I759001","videoId":"BBa_I759001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14I - [ Intermediate ] ['A pTet promoter can be repressed by tet Repressor and transcriptional...transcripts of a spacer including the RBS N complex. The spacer is a...be cloned in. This construct is an intermediate as the terminator sequence...']"},{"machine":"BBa_I759002","videoId":"BBa_I759002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14K - [ Intermediate ] ['A pTet promoter can be repressed by tet Repressor and transcriptional...transcripts of a spacer including the RBS cro complex. The spacer is a...be cloned in. This construct is an intermediate as the terminator sequence...']"},{"machine":"BBa_J06800","videoId":"BBa_J06800","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14M - [ Inverter,classic, inverter, uncategorized ] ['Jason has info about this part http kdjlsdjfaklfgj lkbjf ...']"},{"machine":"BBa_J06801","videoId":"BBa_J06801","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 14O - [ Inverter,classic, inverter, uncategorized ] []"},{"machine":"BBa_J04450","videoId":"BBa_J04450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24O - [ Reporter,cds, reporter, chromoprotein, classic, reporter, pret, function, reporter, color, function, reporter, pigment ] ['contain a degradation tag and the RBS is strong....LacI and induced by IPGT. Plac is one of the most common promoter in life...science research field. It is mainly composed of Lac operon containing LacO...the binding of RNA polymerase to the promoter. So the expression of downstream...genes is blocked. Serving as inducer IPTG can bind with LacI repressor ...making the latter s conformation changes so LacI is detached from LacO site ...generator driven by Plac promoter however there is no LacI gene in it....Although the E. coli could express some LacI it is not enough for inhibition...promoter. It contains LacI gene which can lower significantly the RFP leakage...expression so that no excessive LacI expression which is considered as waste...identification result is showed in Fig.1. ...fluorescent intensity is fluorescence per OD600 standardized with fluorescence...leakage expression is very low and it is sensitive to the IPTG induction. ...induction. Relative fluorescent intensity is fluorescence per OD600...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...very sensitive to the IPTG induction and the RFP leakage expression is very... 4. Add 100 l bacteria culture medium into a sterile 96 well plate. IPTG is added to final concentrations of 1 2 5 10mM. M9 medium is the blank control. The colony without RFP expression is the negative control....This part is commonly used but can fail if the system contains LacI or CAP... Team TU Munich 2012 http 2012.igem.org Team TU Munich improved this part... Team Warwick 2015 http 2015.igem.org Team Warwick improved this part by...characterisation of this part by showing equal functionality in simulated...contributed to the characterisation of this part by testing the time of...apparition of fluorescence in presence of IPTG or not because the promoter...leaks as well as they contributed to the improvement of this part by using...contributed to the characterization of this part by showing decreased...contributed to the characterization of this part by analyzing the rate of...contributed to the characterisation of this part by testing the delay before...contributed to the characterisation of this part by testing the fluorescence...part by replacing the induced promoter lacI with the strong constitutive pf 5...promoter PampC. see ...Alpes Contribution contributed to the characterisation of this part by...testing the effect of cAMP on the promoter s leakages and protein expression...charazterization of this part by testing the effect of different media...the characterization of this part by introducing it in Trans10 to observe its...contributed to the charazterization of this part by testing the effects of...characterization of this part by testing the effect of glucose on the protein...contributed to characterization of this part by testing radiation tolerance of...replication that could explain this effect. This part is a reversion of this...successfully produce colonies. In these results is the negative control...plate streaked with pSB1C3 containing J04450 RFP . This is the most...origin which has expression in vibrio. However pGGA is not compatible with...plasmid per genome. These values indicate that K3445002 is effective in both...in a plasmid that is still capable of replication in E. coli but now also...Escherichia coli Nissle 1917 EcN is widely used as a probiotic since it s...contains a CAP sensitive promoter and glucose can inhibit its expression. ...We then investigate whether this phenomenon is influenced by the strain and...amount of IPTG added for respective treatment is 500 M. ... The red color absorbance under 588 nm wavelength is recorded around 2.5 3 OD units....the role of RBS and Promoter parts in giving rise to intrinsic noise in E....of this part as a cloning tool. When ligating any part or part assembly into...any standard backbone that contains this part the non restricted and single ...insert the size of the BioBrick insert and whether the insert is an assembly...we characterized its expression under lac promoter. We did the transformation...Violaceum competent cells with the protocol that is in our wiki we concluded...that the best O.D. for the heat shock transformation is 0.5 since it showed...expression. This part is useful for characterizing the expression of different...proteins using the lacI sensitive promoter. For better application of this...promoter in controlling protein expression the effects of different hosts...fluorescence intensity at different temperature is much higher than those of...leak appeared in 34 oC. This finding is different from our expectation where...medium containing flask is significantly higher than others indicating that...oxygen is an important factor which will affect the protein expressin and cell...by using different IPTG induction Fig 3 . However it is interesting that the...driven by PrplJ promoter and expressed in DH10B. In addition we also applied...weaker E.coli endogenous promoters PdapA and PcaiF Figure 1 ....PcaiF promoter....However it is difficult for us to perform additional experiments with... The goal was to characterize the effect of cAMP on the promoter s leakages...without production of cAMP. BTH101 strain is streptomycin resistant. ...inducible promoter lactose promoter to create an auto amplifier system. ...It is apparent that without IPTG there is a visible difference between strains...the leakage of the promoter. ...data suggest that the promoter does not leak in that condition. ...lactose promoter has almost no leakage suggesting that the leakage of the...lactose promoter is due to cAMP in absence of IPTG. When the cAMP production...is restored the promoter is activated and the protein is expressed. It is also...expression if no IPTG is added. ...SHuffle strains. In order to test this lacI regulated promoter in our chassis ...functionality of the promoter. Protein expression was analysed through an SDS ...leakiness in the promoter. IPTG concentrations were chosen based on conditions...worked previously when using a T7 promoter 0.2 mM and recommendations of the...show bands if the promoter lacked leakiness nevertheless a faint band can be...stronger bands compared to the uninduced control. Thus the promoter is...promoter....and have been excluded. In case of 532 605 the noise is disturbing the...EcN. The lag phase is shorter compared to the other two media while the...logarithmic phase is longer. In TB Media the lag phase is extended and the...growth is not as high as before but still exhibits a clear logarithmic phase....In sharp contrast to that the lag phase in LB Media is almost double and the...exponential phase is quite brief. These results are expected since the media...the RFP production in LB is significantly lower. For E. coli BL21 DE3 Figure...lowest RFP levels. The expression in LB media is only slightly higher than in...Enriched media. The protein expression in TB Media however is notably higher...the control of a lactose promoter is a good alternative to produce inducible...could divide 24h into three different growth phases 0 2h is lag phase 2 15h...is an exponential phase 15 24 is a stationary phase. ...spectra for mCherry ranges from 551 nm to 800 nm. There is an overlap of 77 nm...each fluorescent protein is accurate....showed the highest fluorescence readings. This is probably because cell...concentration of 87 5 which is 3 5 times higher than the recommended...We transformed the plasmid which RFP is inserted in psB1C3 into DH5 and...We transformed DH5 with the plasmid which RFP is inserted in psB1C3 and... At first the cells are cultured in liquid medium and the medium is replaced...with Butterfield s Phosphate Buffer BPB . This is because when the gamma ray...versus 10 Gy. From this result we concluded that E. coli is highly...sensitive to gamma irradiation when it is irradiated with 50 and more doses of...This graph shows that the number of cells is significantly reduced with...']"},{"machine":"BBa_K091100","videoId":"BBa_K091100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15A - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, regulation, multiple ] ['pLac lux hybrid promoter...This promoter is repressed by the lacI repressor and induced by IPTG. It is... promoter ...']"},{"machine":"BBa_I13515","videoId":"BBa_I13515","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15B - [ Measurement,classic, measurement, uncategorized ] ['site. Sole purpose is to check whether the insertion site alone affects the...']"},{"machine":"BBa_K091146","videoId":"BBa_K091146","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15C - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, negative, regulation, multiple, function, cellsignalling, LasR, function, cellsignalling, LuxR ] ['pLas Lux Hybrid Promoter...promoter is expected to be activated in the presence of PAI 1 and LasR and... promoter ...']"},{"machine":"BBa_I13517","videoId":"BBa_I13517","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15D - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_K081005","videoId":"BBa_K081005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15E - [ Composite,plasmidbackbone, expression, constitutive ] ['constitutive promoter family member and RBS...Constitutive promoter strong with RBS strong efficiency 0.6 ...']"},{"machine":"BBa_I13907","videoId":"BBa_I13907","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15F - [ Device,classic, device, uncategorized ] ['This device is meant to be coupled to the elowitz repressilator device to...']"},{"machine":"BBa_K081007","videoId":"BBa_K081007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15G - [ Translational_Unit,function, regulation, transcriptional ] []"},{"machine":"BBa_I13974","videoId":"BBa_I13974","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15H - [ Project,classic, project, uncategorized ] []"},{"machine":"BBa_K081008","videoId":"BBa_K081008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15I - [ Translational_Unit,function, biosynthesis, function, cellsignalling ] []"},{"machine":"BBa_I13977","videoId":"BBa_I13977","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15J - [ Project,classic, project, uncategorized ] []"},{"machine":"BBa_K081009","videoId":"BBa_K081009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15K - [ Translational_Unit,function, biosynthesis, function, cellsignalling ] []"},{"machine":"BBa_I15015","videoId":"BBa_I15015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15L - [ Reporter,function, reporter ] ['This part accepts POPS to produce a single mRNA encoding ECFP and EYFP under...']"},{"machine":"BBa_K081013","videoId":"BBa_K081013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15M - [ Composite ] []"},{"machine":"BBa_I13513","videoId":"BBa_I13513","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15N - [ Measurement,classic, measurement, uncategorized ] []"},{"machine":"BBa_K081017","videoId":"BBa_K081017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15O - [ Translational_Unit,function, biosynthesis, function, sensor, light ] []"},{"machine":"BBa_I715040","videoId":"BBa_I715040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 15P - [ Reporter ] ['This part is designed to ensure that we can detect both RFP and GFP in the...']"},{"machine":"BBa_J06702","videoId":"BBa_J06702","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16A - [ Reporter,classic, reporter, ret ] []"},{"machine":"BBa_B0025","videoId":"BBa_B0025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16B - [ Terminator,direction, reverse, terminator, double ] ['This structure is from... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_E0030","videoId":"BBa_E0030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16C - [ Coding,function, reporter, function, reporter, fluorescence ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...means that the biobrick part is NOT of potential allergen status. In 80 amino...for this biobrick. This also means that there is NOT of potential allergen...site is on the 111 118 base number of the BioBrick and on the 1 8 base number...of the VF2 primer. The second location of the internal priming site is on the... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_J61100","videoId":"BBa_J61100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16D - [ RBS,rbs, prokaryote, constitutive, anderson, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['These parts are present in plasmid pSB1A2 but there is also a constitutive...promoter J23100 derived inserted into the XbaI site. So for example the...assembly. Normal prefix insertion into EcoRI XbaI will delete this promoter...element. Suffix insertion into SpeI PstI will retain this promoter but it can...Note also that the base 5 to the SpeI site is allowed to float in these parts...and is therefore rarely T . The G downstream of the XbaI site obeys the...More on this family of parts and their quantitative behavior is described ...Characterization of the this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter CDS and...attached this promoter RBS construct to...efficiency because the ribosome binding sites connect the promoter with an...iGEM gfp. Since there is gfp present this means that our characterization was...control is successful because there are no gfp present. This serves as a good...reference for our sample comparison. The finding that there is no significant... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S03575","videoId":"BBa_S03575","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16E - [ Intermediate ] []"},{"machine":"BBa_J61101","videoId":"BBa_J61101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16F - [ RBS,rbs, prokaryote, constitutive, anderson, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['These parts are present in plasmid pSB1A2 but there is also a constitutive...promoter J23100 derived inserted into the XbaI site. So for example the...assembly. Normal prefix insertion into EcoRI XbaI will delete this promoter...element. Suffix insertion into SpeI PstI will retain this promoter but it can...Note also that the base 5 to the SpeI site is allowed to float in these parts...and is therefore rarely T . The G downstream of the XbaI site obeys the...More on this family of parts and their quantitative behavior is described ...Add more about the biology of this part here...Characterization of the this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter CDS and... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_P0140","videoId":"BBa_P0140","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16G - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_B0010","videoId":"BBa_B0010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16H - [ Terminator,direction, forward, terminator, single ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...Figure The intrinsic terminator is composed of the NusA protein which...Transcription of DNA is made up of the following steps RNA polymerase binding...to promoter and activation initiation of RNA transcript elongation of RNA...transcript and termination of transcription. Termination is the last step of...the RNA transcript is not reversible and further transcription requires...reinitiation at a promoter region to form a new RNA transcript Uptain et. al ...also near promoter regions or between genes in the operon Nojima et. al. ...2005 . The T1 terminator region on the rrnB gene of E. coli is one of two...Efficiency is enhanced by the E. coli nusA protein which gives effectiveness...terminated when nusA protein is present are released from the RNA polymerase...complex suggesting that there is a complete termination reaction. The...protein s termination factor activity is not dependent on the presence ofthe...general termination at T1 in vitro is quiteefficient with an 80 ...this high level of efficiency is also achieved suggesting that in vivo the...entity responsible for the highly efficient termination is dueto the nusA... Schmidt M. C. and M. J. Chamberlin 1987 . nusA Protein of Escherichia coli is an efficient transcription termination factor for certain terminator sites. Journal of Molecular Biology 195 4 809 818....']"},{"machine":"BBa_P0340","videoId":"BBa_P0340","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16I - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_I715023","videoId":"BBa_I715023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16J - [ Coding,cds, reporter, rfp, function, reporter, fluorescence ] []"},{"machine":"BBa_P0353","videoId":"BBa_P0353","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16K - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K125500","videoId":"BBa_K125500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16L - [ Coding,cds, reporter, gfp, function, reporter, fluorescence ] ['This BioBrick is a GFP fusion brick meaning that it can be ligated in frame...']"},{"machine":"BBa_P0451","videoId":"BBa_P0451","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16M - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K165005","videoId":"BBa_K165005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16N - [ Coding,chassis, eukaryote, yeast, function, reporter, fluorescence ] ['This is the venus YFP yeast optimized in the Silver Lab BioFusion standard...']"},{"machine":"BBa_P0453","videoId":"BBa_P0453","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 16O - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K081000","videoId":"BBa_K081000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17A - [ Composite ] ['This device is a PoPS in luxI out protein generator with Plux promoter...It is a module of the following genetic multiplexer mux click... here http en.wikipedia.org wiki Multiplexer to see what is a... PA PS and PB are three promoters that can be ACTIVATED by the three generic elements A S and B respectively ... GOI is the gene of interest that is the output of the system....In particular K081000 is Channel 0 .... K081000 under the desired regulation for Channel 0 for example the generic promoter PA ... K081001 under the desired regulation for Channel 1 for example the generic promoter PB ... K081002 under the desired regulation for Selector for example the generic promoter PS ...']"},{"machine":"BBa_I746370","videoId":"BBa_I746370","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17B - [ Composite ] ['P2 ogr inducing PF promoter...This construct is used to screen the level of induction of the P2 ogr...activator on the PF promoter....']"},{"machine":"BBa_K081001","videoId":"BBa_K081001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17C - [ Composite ] ['This device is a PoPS in lasI out protein generator with Plas promoter...It is a module of the following genetic multiplexer mux click... here http en.wikipedia.org wiki Multiplexer to see what is a... PA PS and PB are three promoters that can be ACTIVATED by the three generic elements A S and B respectively ... GOI is the gene of interest that is the output of the system....In particular K081001 is Channel 1 .... K081000 under the desired regulation for Channel 0 for example the generic promoter PA ... K081001 under the desired regulation for Channel 1 for example the generic promoter PB ... K081002 under the desired regulation for Selector for example the generic promoter PS ...']"},{"machine":"BBa_I746371","videoId":"BBa_I746371","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17D - [ Composite ] ['P2 ogr inducing PO promoter...This construct is used to screen the level of induction of the P2 ogr...activator on the PO promoter....']"},{"machine":"BBa_K081024","videoId":"BBa_K081024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17E - [ Composite ] ['This device is a PoPS in pcyA out with Pomp promoter downstream....660 nm radiation is an indirect repressor of Pomp....']"},{"machine":"BBa_I746372","videoId":"BBa_I746372","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17F - [ Composite ] ['P2 ogr inducing PP promoter...This construct is used to screen the level of induction of the P2 ogr...activator on the PP promoter....']"},{"machine":"BBa_K117000","videoId":"BBa_K117000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17G - [ Coding,biosafety, kill_switch, cds, lysis, chassis, prokaryote, lactobacillus, Kit plates, probiotics, Kit plates, probiotics, biocontainment, function, celldeath ] ['Colicin E7 with Immunity construct is 144 base pairs in length and formally... For more information on how this part operates in our Detection system ...protein which is only 4872Da in molecular weight and performs two functions...function is to Release of ColE7 from ColE7 Immunity complex and the other is...conclusion that once the lysis protein is produced with IPTG inducing by HT115... However T7 promoter was too strong to be controlled so Trp attenuator...promoter. ...Fig.5 . The Trp Lysis metabolism obviously has the advantage which is able to...the concentration critical valve of tryptophan is around 0.3 which means that...if the concentration is more than 0.3 the killing metabolism will be closed...']"},{"machine":"BBa_I746382","videoId":"BBa_I746382","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17H - [ Composite ] ['PSP3 pag inducing PP promoter...This construct is used to screen the level of induction of the PSP3 pag...activator on the PP promoter....standard promoter device J69591....']"},{"machine":"BBa_K117002","videoId":"BBa_K117002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17I - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive ] ['LsrA promoter indirectly activated by AI 2 ...the effect of LsrK. Without the presence of AI 2 LsrA promoter is inhibited...this promoter hence activating it so that the downstream sequence can be...expressed. To prevent the cell from self inducing this promoter we must...promoter can only be activated under the presence of AI 2 from other sources...than the host cell which is LuxS mutant say by contact with normal cells .... Effects of AI 2 on LsrA promoter... This part is only the promoter region of LsrA gene which is normally inhibited by LsrR. It is NOT the entire LsrA gene.... It is INDIRECTLY induced by AI 2 through a complex network involving LsrK LsrR.... How this promoter works ...By ligating LsrA promoter with a protein coding sequence downstream we can... promoter ...']"},{"machine":"BBa_I746385","videoId":"BBa_I746385","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17J - [ Composite ] ['PSP3 pag inducing PLL promoter...This construct is used to screen the level of induction of the PSP3 pag...activator on the PLL promoter....']"},{"machine":"BBa_K117008","videoId":"BBa_K117008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17K - [ Reporter ] ['This part is induced by AI 2 to produce YFP....']"},{"machine":"BBa_I746392","videoId":"BBa_I746392","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17L - [ Composite ] ['phiR73 delta inducing PP promoter...This construct is used to screen the level of induction of the phiR73 delta...activator on the PP promoter....']"},{"machine":"BBa_K118002","videoId":"BBa_K118002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17M - [ Coding,function, biosynthesis, isoprenoid ] ['This is the coding sequence of crtB from Pantoea ananatis formerly...']"},{"machine":"BBa_I746394","videoId":"BBa_I746394","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17N - [ Composite ] ['phiR73 delta inducing Psid promoter...This construct is used to screen the level of induction of the phiR73 delta...activator on the Psid promoter....']"},{"machine":"BBa_K118006","videoId":"BBa_K118006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17O - [ Translational_Unit,classic, generator, rc, function, biosynthesis, isoprenoid ] ['This is the coding sequence of crtB from Pantoea ananatis formerly...']"},{"machine":"BBa_I746395","videoId":"BBa_I746395","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 17P - [ Composite ] ['phiR73 delta inducing PLL promoter...This construct is used to screen the level of induction of the phiR73 delta...activator on the PLL promoter....']"},{"machine":"BBa_I12006","videoId":"BBa_I12006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18A - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, negative, regulation, multiple, classic, regulatory, uncategorized ] ['Modified lamdba Prm promoter repressed by 434 cI ...Lamdba Prm promoter modified to be activated by lamda repressor cI and... promoter ...']"},{"machine":"BBa_I20260","videoId":"BBa_I20260","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18B - [ Measurement ] ['available in the registry. This part was very useful as a control for us to...']"},{"machine":"BBa_I12007","videoId":"BBa_I12007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18C - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Modified lambda Prm promoter OR 3 obliterated ...Lambda Prm promoter modified to be activated but not repressed by the lambda...Relative fluorescence is calculated by the formula below LB medium as blank....Relative fluorescence is shown in logarithmic axis 2 to the power of n. As...shown in the figure the expression strength of I12007 is about 8 of HrtO ...under the activation of cI promoter HrtO showing 92 of loss during signal... promoter ...']"},{"machine":"BBa_E0240","videoId":"BBa_E0240","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18H - [ Reporter,classic, reporter, ret, plasmid, measurement ] []"},{"machine":"BBa_I14015","videoId":"BBa_I14015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, negative, regulation, multiple, classic, regulatory, uncategorized, function, cellsignalling, LasR ] ['LasR and 3OC12HSL regulated promoter with a single Tet Operator binding site... promoter ...']"},{"machine":"BBa_I14032","videoId":"BBa_I14032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18G - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, negative, rnap, prokaryote, ecoli, sigma70 ] ['promoter P Lac IQ...Constitutive Promoter High Transcription... promoter ...']"},{"machine":"BBa_I11033","videoId":"BBa_I11033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18I - [ DNA,classic, other, uncategorized, function, recombination, p22 ] []"},{"machine":"BBa_I11032","videoId":"BBa_I11032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18K - [ DNA,classic, other, uncategorized, function, recombination, p22 ] []"},{"machine":"BBa_I11021","videoId":"BBa_I11021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18M - [ Coding,function, recombination, function, recombination, lambda ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_I15008","videoId":"BBa_I15008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 18O - [ Coding,cds, enzyme, function, biosynthesis, phycocyanobilin, function, coliroid, function, sensor, light ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...The infomation below is updated by TJU China of iGEM 2017....In addition in order to make this part express better in hosts of our project...addition phycocyanobilin PCB is synthesized from BV and PCB do not exists...in mammals but BV does. So BV is better as a chromophore in some way along...In our projext we use HO 1 gene for two task one is to produce BV in E.coli...BL21 the other is to be a element in co expression system with fluorescent...We use this part to prduce Biliverdin BV in E.coli BL 21. As shown in the... Figure 1. The result after induction the upper one is the control group ...and the inferior one is the experimental group. ...and 2 are experimental group and tube 3 is the control group. ... Figure 2. The result after induction the upper one is the control group ...and the inferior one is the experimental group. ...for 5.5h.The left is the control one the right is the experimental one. ...']"},{"machine":"BBa_K118007","videoId":"BBa_K118007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19A - [ Translational_Unit,classic, generator, rc, function, regulation, transcriptional ] ['This is the coding sequence of appY from Escherichia coli JM109 preceded...']"},{"machine":"BBa_I746009","videoId":"BBa_I746009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19B - [ Intermediate ] []"},{"machine":"BBa_K118011","videoId":"BBa_K118011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19C - [ Regulatory,chassis, prokaryote, ecoli, Kit plates, probiotics, control, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['PcstA glucose repressible promoter ...This is the promoter for the Eschaerichia coli JM109 cstA gene. It...to the cAMP receptor protein which in its bound form is able to associate...with the promoter and promote transcription of the downstream gene. cstA ... promoter ...']"},{"machine":"BBa_S03827","videoId":"BBa_S03827","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19D - [ Intermediate ] []"},{"machine":"BBa_K118015","videoId":"BBa_K118015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19E - [ Coding,cds, enzyme, phosphorylation, function, biosynthesis ] ['This is the coding sequence of glgC from Escherichia coli JM109. It...']"},{"machine":"BBa_I744204","videoId":"BBa_I744204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19F - [ Composite ] ['Tc sensor and cl lambda generator Tet promoter ...This part serves as a sensor and reporter of intracellular tetracycline...Tc. It uses the tetR promoter to control tetR concentration through a negative...']"},{"machine":"BBa_K118016","videoId":"BBa_K118016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19G - [ Coding,cds, enzyme, phosphorylation, function, biosynthesis ] ['This is the coding sequence of glgC ADP glucose pyrophosphorylase from... Escherichia coli JM109 with the substitution G336D. This mutation is known...which is the glgC ADP glucose pyrophosphorylase from E. coli with mutation...simulations. A short animation of the protein run for 1 ns is attached. RMSD...indicating that the structure is stable. The backbone of the G336D is overall...']"},{"machine":"BBa_J23040","videoId":"BBa_J23040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19H - [ Signalling ] []"},{"machine":"BBa_K118021","videoId":"BBa_K118021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19I - [ Measurement ] [' xylE is from the Pseudomonas putida TOL naphthalene and xylene...bright yellow product 2 hydroxy cis cis muconic semialdehyde. This is a useful...glucose repressible promoter of cstA . This allows for characterisation of... project http 2010.igem.org Team Lethbridge Project is to decrease the...can be metabolized by the cell. This conversion is accomplished by a protein...hypothesis was that the iron molecule is oxidized after converting a single...amount of S30 extract is added to an excess catechol solution production of...2 HMS is increased approximately twofold. This suggests that the enzyme... rather than substrate is the limiting component in catechol degradation by...catechol 2 3 dioxygenase active site iron is reduced upon catalysis rendering...2 3 dioxygenase. The blue line is 4 g of control S30 cell extract. ...biobrick is capable of converting catechol into 2 HMS. Moreover the reduction...Figure 3 shows a reduction of 2 HMS concentration in the solution. It is more...soluble metabolic machinery of E. coli is metabolizing 2 HMS into its...breakdown products. This is a feature of the system that we intend to exploit...With this in mind it is inefficient to utilize a single turnover enzyme such...protein that will reduce the iron that is oxidized in the conversion of...ferredoxin protein and is located on the same operon as xylE in...Before using xylE in this part for our project we tested enzyme activity of...of each well. The protocol for the instrument is listed here. The result...']"},{"machine":"BBa_J24018","videoId":"BBa_J24018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19J - [ Signalling ] ['This part produces LuxR when no tetR is present which forms a complex with...']"},{"machine":"BBa_K118027","videoId":"BBa_K118027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19K - [ Composite ] ['This part consists of the cstA promoter which is repressed by high levels of...glucose coupled to the lacZ reporter gene for promoter activity assays....']"},{"machine":"BBa_J45014","videoId":"BBa_J45014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19L - [ Coding,function, biosynthesis, odorant, function, odor, s ] [' Note that this is not aspartate amino transferase also called AATase ... an entirely different protein that is homologous to Atf1 in mouse . ...has an oxidizing disulfide bond that is reduced when free thiols are present ...A SH CoA SH which is a co substrate in the enzymatic reactions of Alcohol...measured every 0.5 minutes. Included is the computer generated linear...measured every minute. Included is the computer generated linear trendline...the concentration change of TNB M A is the change in absorbance in 1... moles of enzyme as TNB is formed in a 1 1 molar ratio with CoA SH produced....']"},{"machine":"BBa_K103003","videoId":"BBa_K103003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19M - [ Protein_Domain,cds, receptor ] ['which specifically binds to the Fc portion of immunoglobulin G it is also... Protein A is the famous protein from Staphylococcus aureus which binds to constant fragments of IgG antibodies and has many uses in molecular biology TapTag for instance .... This part uses our BamHI SacI NdeI fusion cloning substandard...']"},{"machine":"BBa_I15018","videoId":"BBa_I15018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19N - [ Reporter,function, reporter ] ['This part accepts POPS to produce a single mRNA encoding ECFP and EYFP under...']"},{"machine":"BBa_K082034","videoId":"BBa_K082034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19O - [ Generator ] []"},{"machine":"BBa_I13537","videoId":"BBa_I13537","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 19P - [ Project,classic, project, uncategorized ] ['Two promoter screening plasmid v1.0...']"},{"machine":"BBa_I11031","videoId":"BBa_I11031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20A - [ Coding,function, recombination, function, recombination, p22 ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_J52026","videoId":"BBa_J52026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20B - [ Coding,cds, reporter, gfp, chassis, eukaryote, human, function, immunology, function, reporter, fluorescence ] ['dnMyD88 is a dominant negative form of protein MyD88 an important protein in...signaling cascade through TLR4 receptor . dnMyD88 is linked to GFP acts as a...']"},{"machine":"BBa_E2050","videoId":"BBa_E2050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20C - [ Coding,cds, reporter, rfp, chassis, eukaryote, yeast, function, reporter, fluorescence ] ['revealed this part is working....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...transformed plasmid containing this part into E. coli BL21 DE3 strain which...to a self made promoter which is characterized by a perfect consensus...transformation efficiency where plasmid insertion is enhanced due to...mutations in recA1 and endA1 . pAC7 is a vector for the construction of...The integration of the promoter reporter gene fusion results in the...activity of amylase the lack of this enzymatic activity is a good...indication for the correct integration of the promoter reporter gene fusion....The integration of the promoter reporter gene fusion results in the...activity of amylase the lack of this enzymatic activity is a good...indication for the correct integration of the promoter reporter gene fusion....iGEM28 and iGEM36. On the abscissa is the time in h depicted on the...fluorophores work perfectly in the presence of the self made promoter. The...']"},{"machine":"BBa_I712019","videoId":"BBa_I712019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20D - [ Coding,cds, enzyme, function, reporter, light ] ['Firefly Luciferase is luciferase from Photinus pyralis . By oxidation of...substrate luciferin light is produced. Luciferase thus acts as a reporter...protein when connected to other proteins or promoters....This part was improved by NUDT CHINA in iGEM 2017 to optimize its function in...This part contains a Eukaryotic ribosome binding site and non standard prefix...sequencing result suggested that this part is completely working....We are Team SDSZ China in iGEM2019 and we used this part to detect...reaches somewhat near 0.3 protein expression is tested to be at high level by...Note Since there is no proper device in our lab for observing...']"},{"machine":"BBa_M0100","videoId":"BBa_M0100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20E - [ RNA ] ['tRNA Arg5 to use as transcriptional reporter. Sequence is natural tRNA Arg5...K12 tRNA Arg5 sequence. Chris Hayes says that tRNA Arg5 is the lowest...coli tRNAs. It turns out that tRNA Arg5 encoded by argW is not the least...My confusion arose because tRNA Arg5 decodes AGG which is used less...frequently than any other codon except ACA. However ACA is decoded by tRNA ...Thr4 900 cell 1.42 of total and is not normally regarded as a rare...Hope all is well....']"},{"machine":"BBa_K200000","videoId":"BBa_K200000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20G - [ Coding,cds, biosynthesis, chassis, prokaryote, ecoli ] ['RcsB is a transcription factor that forms part of a phosphorelay system. As...which a phosphate group is passed. The transfer of this phosphate group down...along the Rcs relay system is initiated by membrane stress. Once the phosphate...The Rcs phosphorelay is composed of two membrane anchored proteins RcsC and...kinase RcsC autophosphorylates and the phosphoryl group is transferred to...regulate 5 of the E.coli genome 4. It is important to note that RcsB is a...for colanic acid production. 2 This is via the activation of the ugd cps...operon which is required for capsule synthesis. ...Colanic acid is a heteropolymer containing glucose galactose fucose and...glucuronic acid. The overexpression of RcsB is akin to fitting a stethoscope...increase further as an even more complete protective capsule is being...']"},{"machine":"BBa_J04500","videoId":"BBa_J04500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20I - [ Intermediate,classic, intermediate, uncategorized, plasmidbackbone, expression, inducible ] ['IPTG inducible promoter with RBS...After induction a specific protein band that is consistent with the...']"},{"machine":"BBa_J04650","videoId":"BBa_J04650","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20K - [ Reporter,classic, temporary, uncategorized ] ['This part results from ligating E1010 with B0015 in the manner described on...We ligated J04500 to this part and transformed the resulting plasmid into...this part works....']"},{"machine":"BBa_K082003","videoId":"BBa_K082003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20M - [ Coding,cds, reporter, gfp, function, reporter, fluorescence ] []"},{"machine":"BBa_K082006","videoId":"BBa_K082006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 20O - [ Coding,cds, transcriptionalregulator, activator, function, cellsignalling ] []"},{"machine":"BBa_K098991","videoId":"BBa_K098991","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21A - [ Composite ] ['cI promoter with GFP reporter...This is the a constitutive GFP reporter driven by the cI promoter....']"},{"machine":"BBa_I13538","videoId":"BBa_I13538","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21B - [ Composite,classic, composite, uncategorized ] ['Two promoter screening plasmid v1.1...']"},{"machine":"BBa_K137040","videoId":"BBa_K137040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21C - [ Device ] ['Strong promoter strong RBS GFP with AGTC 10 repeat after start codon ... out coding SSM constructs. Spectrum of positive control is in green ...negative control is in blue AGTC in construct is in brown and AGTC out ...regulatory SSM constructs. Spectrum of negative control is in red TA on is...in blue and TA off is in green. The TA on distribution lies to the right...of the TA off distribution indicating that the TA on construct is a...better promoter than its counterpart. These distributions were taken at a...Our flow cytometer is commonly used with eukaryotic cells and has not yet been...']"},{"machine":"BBa_I13533","videoId":"BBa_I13533","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21D - [ Measurement,classic, measurement, uncategorized ] []"},{"machine":"BBa_K137042","videoId":"BBa_K137042","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21E - [ Device ] ['Regulatory SSM device Promoter with TA 10 repeat expressing GFP...Promoter with TA 10 repeat upstream of RBS GFP TT... out coding SSM constructs. Spectrum of positive control is in green ...negative control is in blue AGTC in construct is in brown and AGTC out ...regulatory SSM constructs. Spectrum of negative control is in red TA on is...in blue and TA off is in green. The TA on distribution lies to the right...of the TA off distribution indicating that the TA on construct is a...better promoter than its counterpart. These distributions were taken at a...Our flow cytometer is commonly used with eukaryotic cells and has not yet been...']"},{"machine":"BBa_I13539","videoId":"BBa_I13539","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21F - [ Composite,classic, composite, uncategorized ] ['Two promoter screening plasmid v1.2...']"},{"machine":"BBa_K137043","videoId":"BBa_K137043","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21G - [ Device ] ['Regulatory SSM device Promoter with TA 9 repeat expressing GFP...Promoter with TA 9 repeat upstream of RBS GFP TT... out coding SSM constructs. Spectrum of positive control is in green ...negative control is in blue AGTC in construct is in brown and AGTC out ...regulatory SSM constructs. Spectrum of negative control is in red TA on is...in blue and TA off is in green. The TA on distribution lies to the right...of the TA off distribution indicating that the TA on construct is a...better promoter than its counterpart. These distributions were taken at a...Our flow cytometer is commonly used with eukaryotic cells and has not yet been...']"},{"machine":"BBa_I13544","videoId":"BBa_I13544","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21H - [ Composite,classic, composite, uncategorized ] ['Intermediate in two promoter screening plasmid...']"},{"machine":"BBa_K105004","videoId":"BBa_K105004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21I - [ Protein_Domain,proteindomain, dnabinding ] ['cI is a repressor of the phage lamda. It binds specificly to a operator site...']"},{"machine":"BBa_T9002","videoId":"BBa_T9002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21J - [ Signalling,function, cellsignalling ] ['GFP. The GFP protein generator is the same as that found in I7101....We used this part to characterize the quorum sensing system. Induced by...characterize quorum sensing system. But we found that this part has an obvious...diffusion. This is validated on the agar plate by dropping the donor cells in...']"},{"machine":"BBa_K105022","videoId":"BBa_K105022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21K - [ Regulatory ] ['This BioBrick is the lex A recognition site. It can be used for the...construction of promoters which should be regulated by activators or...']"},{"machine":"BBa_I13543","videoId":"BBa_I13543","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21L - [ Composite,classic, composite, uncategorized ] ['Intermediate in two promoter screening plasmid...pSB1A10. Transcription must be induced off of Pbad so this part should be...']"},{"machine":"BBa_K105024","videoId":"BBa_K105024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21M - [ Regulatory ] ['This BioBrick is the Gal4 recognition site. It can be used for the...construction of promoters which should be regulated by activators or...']"},{"machine":"BBa_I732906","videoId":"BBa_I732906","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21N - [ Device ] [' anhydrotetracycline http openwetware.org wiki ATc is present the...I732080 regulated by constitutive promoter...']"},{"machine":"BBa_K116638","videoId":"BBa_K116638","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21O - [ Generator ] ['LuxI regulated by the pLac promoter. Used for expressing an adjustable amount...']"},{"machine":"BBa_I732913","videoId":"BBa_I732913","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 21P - [ Measurement ] [' anhydrotetracycline http openwetware.org wiki ATc is present the...I732080 regulated by constitutive promoter...']"},{"machine":"BBa_K081015","videoId":"BBa_K081015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22A - [ Generator,function, cellsignalling ] []"},{"machine":"BBa_K081019","videoId":"BBa_K081019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22C - [ Generator,function, cellsignalling ] ['This device produces luxR constitutively under the strong promoter Plambda in...']"},{"machine":"BBa_K143001","videoId":"BBa_K143001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22E - [ DNA,chassis, prokaryote, bsubtilis, DNA, chromosomalintegration ] ['host cell at a specific locus. This is achieved by using leading 5 and...Shimotsu and Henner 1 and is still commonly used in vectors such as pDR111 2 ...']"},{"machine":"BBa_K165037","videoId":"BBa_K165037","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22G - [ Regulatory,rnap, eukaryote, yeast, direction, forward, chassis, eukaryote, yeast, promoter, regulation, unknown ] ['TEF2 yeast constitutive promoter...This is a high level constitutive promoter from the yeast gene TEF2. It has... promoter ...']"},{"machine":"BBa_K084007","videoId":"BBa_K084007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22I - [ Signalling ] []"},{"machine":"BBa_K081012","videoId":"BBa_K081012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22K - [ Generator ] []"},{"machine":"BBa_K081014","videoId":"BBa_K081014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22M - [ Generator ] []"},{"machine":"BBa_K081016","videoId":"BBa_K081016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 22O - [ Generator ] []"},{"machine":"BBa_K116640","videoId":"BBa_K116640","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23A - [ Generator ] ['LuxR regulated by the pTet promoter. Used to constitutively express LuxR....']"},{"machine":"BBa_I716103","videoId":"BBa_I716103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23B - [ T7 ] ['This is the T7 RNA Polymerase gene ATG Start and will transcribe any genes...with a T7 Promoter. It provides very good PoPS Polymerases Per Second ...output and it is highly orthogonal to E. Coli s natural transcription system....This variation has an ATG start and so is more active than the GTG start...variation but is also significantly toxic and potentially unstable in a 80...']"},{"machine":"BBa_K137058","videoId":"BBa_K137058","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23C - [ Device,function, recombination, fim ] ['GFP fimE switch with 250 bp tetR promoter...A promoter facing upstream is flanked by two FimE binding sites. GFP is...downstream to this fimE switch. Active FimE will flip the promoter such that...GFP is expresssed....as it is energetically unfavorable to bend DNA to such a great degree. These...']"},{"machine":"BBa_S03813","videoId":"BBa_S03813","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23D - [ Intermediate ] []"},{"machine":"BBa_C0050","videoId":"BBa_C0050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23E - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Here is an alignment of the HK022 cI repressor the lambda cI repressor the...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S03814","videoId":"BBa_S03814","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23F - [ Intermediate ] []"},{"machine":"BBa_K079050","videoId":"BBa_K079050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23G - [ Reporter ] ['GFP reporter protein under the control of the J23100 constitutive promoter and...This part is a DNA damage reporter. See experience part for more Experimental...decrease in Fluorescence OD is significantly different between each exposure...time providing evidence that this part may actually be able to differentiate...']"},{"machine":"BBa_J24676","videoId":"BBa_J24676","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23H - [ Device,function, regulation, transcriptional ] ['Links the pBAD promoter which is induced by arabinose and inhibited by araC ...']"},{"machine":"BBa_K145301","videoId":"BBa_K145301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23I - [ Composite ] ['This part can generate the lacI repressor. Normally however the production...of lacI is inhibited by the presence of the lock. But when key is added lacI...']"},{"machine":"BBa_J24675","videoId":"BBa_J24675","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23J - [ Composite ] []"},{"machine":"BBa_K081020","videoId":"BBa_K081020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23K - [ Translational_Unit,function, cellsignalling, function, regulation, transcriptional ] ['This is a two protein generator cI and lasR without transcriptional...']"},{"machine":"BBa_J06620","videoId":"BBa_J06620","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 23L - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K081021","videoId":"BBa_K081021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24A - [ Generator ] []"},{"machine":"BBa_K137055","videoId":"BBa_K137055","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24C - [ Composite ] [' pabA is one of three genes pabA pabB pabC involved in the...behind the strong promoter J23100 and the strong RBS B0034 and in front of...the terminator B0015. Currently it is in the high copy plasmid pSB1AK3....']"},{"machine":"BBa_E0420","videoId":"BBa_E0420","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24E - [ Reporter,classic, reporter, ret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_S0102","videoId":"BBa_S0102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24G - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_S0103","videoId":"BBa_S0103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24I - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_S0104","videoId":"BBa_S0104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 3, 24K - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K831009","videoId":"BBa_K831009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1A - [ Composite ] ['Inducible HipB antitoxin under the control of lac promoter...HipB is the antitoxin of the HipAB toxin antitoxin TA module. HipB... which is a high persistence mutant. We evaluated the persistence frequencies...promoter HipB antitoxin is exogenously expressed even without IPTG induction ...n a Inducible HipB antitoxin under the control of lac promoter...']"},{"machine":"BBa_K249003","videoId":"BBa_K249003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1B - [ Device ] ['This is the Composite Part which creates the enzyme Lumazine Synthase....']"},{"machine":"BBa_J176005","videoId":"BBa_J176005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1C - [ Protein_Domain,cds, classic, reporter, function, reporter, fluorescence ] ['The mushroom coral Discosoma sp. is the source of monomeric RFP....mCherry is a mutant derivative of mRFP. PDB 2H5Q is shown here. N amino... Monomeric cherry mCherry red fluorescent protein is a derivative of...expression in human mammalian cells. Only a single copy is needed for...with no promoter to be expressed in E. coli. ...']"},{"machine":"BBa_K257007","videoId":"BBa_K257007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1D - [ Coding ] ['ClyA or HlyE is an alpha PFT for Pore Forming Toxins.... ClyA is capable of co localizing a variety of structurally diverse fusion partners to the surface of E. coli and their released vesicles but only when the periplasmic disulfide bond forming machinery was present it s makes OMVs an ideal structure to transport hydrophobic compounds like membrane proteins into the host.... 3. F.J del Castillo F. Moreno. and I.del Castillo. Secretion of the Escherichia coli K 12 SheA hemolysin is independent of its cytolytic activity 2001 FEMS Microbiol.Lett. 204 281 285. 11731136 http www.ncbi.nlm.nih.gov pubmed 11731136 ...']"},{"machine":"BBa_K228009","videoId":"BBa_K228009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1E - [ Regulatory ] ['AraC protein reversed sequence and Pbad promoter...Pbad promoter and constitutively expressed AraC regulatory protein. When...arabinose is absent the AraC protein binds to and represses Pbad very...conformation of AraC protein successfully prevent it repressing Pbad promoter...This part is constructed for two purposes. First we coupled two parts an...AraC protein pand a Pbad promoter in order to characterize the latter one...obtain more information about this promoter. We place a GFP coding gene Part...of Pbad promoter to construct a report system. If arabinose is added to the...tested. We have tested the function of this promoter according to...concentration gradient and time scale as is shown below. Secondly we use...this part as a sensor in our AND gate system which works very efficiently....The direction of AraC coding sequence is opposite compared to the Part...Because this part is from commonly used elements in bacteria. No safety...problem can be arised by this part....n a AraC protein reversed sequence and Pbad promoter...']"},{"machine":"BBa_K676004","videoId":"BBa_K676004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1F - [ Device ] ['Transcription from certain promoter sequences have already been indicated to...the topological state of DNA molecules is one of the regulation mechanism for...This type of transcriptional regulation is referred to as the relaxation ...of the promoter for the gyrase enzyme the only topoisomerase which relaxes...So far several bacterial promoter sequences have been identified and their...unique sensory function. Sequence analysis of all of these promoter sequences...promoters. This discriminator region is the portion of the promoter sequence...GC base pairing involves 3 hydrogen bonds and therefore is much stronger and...initiation from these promoters....The first promoter to be studied in this area was tyrT tyrosine tRNA ...promoter from Escherichia coli. The initial studies using circular plasmid...indicated that this promoter only retained its supercoiling dependence in...region later restored the function in vivo. Other identified promoter...sequences include hisR promoter and leu 500 from Salmonella typhimurium 6 ....promoter on a circular plasmid will yield a sensory device for measuring the... Results from Dundee for chacraterisation of tyrT promoter.jpg wiki images e e4 Results from Dundee for chacraterisation of tyrT promoter.jpg File Results from Dundee for chacraterisation of tyrT promoter.jpg ...of the Gyra Promoter Affect Both Promoter Strength and Sensitivity to DNA...promoter antagonises the formation of stable preinitiation complexes. Journal...5 . Bowater R.P. D.R. Chen and D.M.J. Lilley Modulation of Tyrt Promoter...6 . El Hanafi D. and L. Bossi Activation and silencing of leu 500 promoter...promoter parallels its responsiveness to stringent control. Embo Journal ...']"},{"machine":"BBa_K243000","videoId":"BBa_K243000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1G - [ Protein_Domain,cds, enzyme, endonuclease, restriction ] ['This part is used as the active domain of our universal restriction...endonuclease. It cuts DNA when it is fused to the inactive protein domain of...heterodimers Miller Nature biotech 2007 and this part acts as the active...enzyme which is programmable to cut DNA at specific chosen sites. We chose...FokI because previous studies indicated that this endonuclease is modifiable...scientist who is working with DNA because the question where to cut with...which enzyme isn t needed anymore. He is free to choose the cutting sequence...and can receive the part that he wanted. The only thing is left to him is to...']"},{"machine":"BBa_I732111","videoId":"BBa_I732111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1H - [ Coding ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K1051002","videoId":"BBa_K1051002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1I - [ Reporter ] []"},{"machine":"BBa_K189000","videoId":"BBa_K189000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1J - [ Coding ] ['The Targeted Biobrick is a specially constructed for cell specific attachment...Targeted BioBrick is composed of three functional domains RGD domain fiber...display. Fiber protein is the L5 gene product of adenovirus while the...E2A. RGD domain is common in cell cell junctions and unlikely to be involved...for assistance in the design construction and characterization of this part....']"},{"machine":"BBa_K515107","videoId":"BBa_K515107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1K - [ Composite,classic, reporter, multiple ] ['its properties as a reporter. The tests describe this part in terms of...This test is to show the thermostability of Dendra2 by finding the...which half of the protein is denatured measured by looking at its fluorescence...This test is to show photostability of the Dendra2 protein for green...stimulation at 405 nm wavelength. Red flourescence is very low before...This part has been used as a reporter for observation of bacterial uptake into...used to see the outline of the roots recorded is therefore very high. The...photoconversion. Brightfield is present for visualisation of the root and...ROI 2 displays the fluorescence emitted by a single cell while it is being...spectra. The difference between red and green emission is greater in ROI 2...to be smaller than in ROI 2. Brightfield emmision is kept at just over 100...A single bacterium on the right visible in the video above is used as a...The main goal of this characterization is to find out which pH value is the...1.pH 4.5 is found to be the best pH that is suitable for the expression of...']"},{"machine":"BBa_K255000","videoId":"BBa_K255000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1L - [ Coding ] ['This part is laci cfp fusion . A linker was used to fuse these two genes....Because this part is from commonly used elements in bacteria. No safety...problem can be arised by this part....']"},{"machine":"BBa_K249001","videoId":"BBa_K249001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1M - [ Inverter ] ['Arabinose Promoter with Tetracycline Inverter...']"},{"machine":"BBa_K592015","videoId":"BBa_K592015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1N - [ Reporter ] ['This color expressing cassette is a potential alternative complementary to...construct useful. Due to the strong promoter over expressing amilCP will be...The promoter is constitutive the RBS is strong the double terminator is not...']"},{"machine":"BBa_J31006","videoId":"BBa_J31006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1O - [ Coding,cds, selectionmarker, antibioticresistance ] ['This is the coding region for tetracyline resistance TetA C inner membrane ...this part s BioBrick cloning sites on the part design page....If RBS reverse and a promoter reverse are placed to the right of this...']"},{"machine":"BBa_K360126","videoId":"BBa_K360126","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 1P - [ Device ] ['J23102 constitutive promoter LovTAP Photosensor...factor trp repressor. The resulting protein is called LovTAP LOV and...of the LOV domain is often flanked by amino or carboxy terminal helices ...DNA binding affinity decreases and LovTAP is in an inactive conformation....The reason of the conformational change is the following ...Cys450 side chain is involved in light state in bond formation with the...The isoleucine 427 is quite big. But not enough to push the cystein s side...by an PHE427 an amino acid which is much bigger and have more or less the...']"},{"machine":"BBa_J18931","videoId":"BBa_J18931","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2A - [ Protein_Domain,classic, reporter, proteindomain ] []"},{"machine":"BBa_K208001","videoId":"BBa_K208001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2B - [ Coding ] ['This is a Silver fusion compatible BioBrick part that codes for phasin. The...Silver fusion compatibility standard was used so that this part could be fused...cytoplasm. This part is functional both in fusion and non fusion applications....Phasin PhaP is a low molecular weight protein that plays a role in PHA...2001 . The specific purpose of phasin production is not completely understood...dependent on PHA accumulation. Specifically it is suggested that phasin...the size of PHA granules increases when phasin is either absent or regulated...']"},{"machine":"BBa_K1080004","videoId":"BBa_K1080004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2C - [ Coding ] ['ChlM is responsible for the methylation of magnesium protoporphyrin IX. It...catalyzed by ChlM is the transfer of the methyl group from... 2 http www.ncbi.nlm.nih.gov pubmed 25077963 . This reaction is one of...The N terminal of the sequence considered is M Met ....The instability index II is computed to be 34.88 This classifies the protein...']"},{"machine":"BBa_K249006","videoId":"BBa_K249006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2D - [ Reporter ] []"},{"machine":"BBa_K1088020","videoId":"BBa_K1088020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2E - [ Regulatory ] ['lacI LVA device constitutive promoter RBS and terminator ...transcription from high copy plasmids containting the lac promoter...transcription from the lac promoter. However we have build a similar device...protein fusion under the lactose promoter with and without this regulatory...IPTG are above the fluorescenct threshold. After 180 min there is a slightly...']"},{"machine":"BBa_K1129039","videoId":"BBa_K1129039","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2F - [ Coding ] ['promoter...ATCCR1 is a Cinnamoyl CoA reductase found in Artabidopsis thaliana it...enzyme belongs to the oxioreductase family and is involved in both the...were assembled into one PSB1C3 plasmid under constitutive promoters and...EncP 4CL and ATCCR1 gene construct under a constitutive promoter. The mass...']"},{"machine":"BBa_K592000","videoId":"BBa_K592000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2G - [ Coding,cds, membrane, receptor, function, coliroid, function, sensor, light ] ['response is located around the wavelength 650 nm....']"},{"machine":"BBa_I714894","videoId":"BBa_I714894","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2H - [ Generator ] []"},{"machine":"BBa_K1031510","videoId":"BBa_K1031510","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2I - [ Coding,cds, transcriptionalregulator, repressor, chassis, prokaryote, ecoli, function, regulation, transcriptional, terminator, double ] ['HpaR is of 17 235 Da 149 amino acids that belongs to MarR family 4 . It...promoter controlling cognate clusters. Addition of 3 hydroxyphenylacetic acid...can derepress the promoters inhibited by HpaR for Pr and Pg activation or...transcribed in the divert direction to other genes under Pr promoter. The...adjacent promoter Pg initiates the transcription of the functional hpaGEDFHI...names of genes in the clusters. eg. HpaB C means the step 1 is catalyzed by...Pg HpaR biosensor circuit is constructed. The coding sequence of HpaR was...represent promoters. RBS is shown as green oval and red square stands for...']"},{"machine":"BBa_K365004","videoId":"BBa_K365004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2J - [ Coding ] ['end of ClpX contains a domain which is responsible for interaction with its...domain is also partially responsible for ClpX subunits complexation into an...']"},{"machine":"BBa_K1175006","videoId":"BBa_K1175006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2K - [ Coding ] ['BglS This gene encodes an endo beta 1 3 1 4 glucanase bglS which is from...The endo 1 3 1 4 glucanase bglS is a globular protein that that has two...zones are visible around the colonies where bglS is breaking down the...']"},{"machine":"BBa_K608014","videoId":"BBa_K608014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2L - [ Measurement ] ['strong promoter and medium RBS with RFP...This part consists of a strong promoter with medium RBS PR2 and tagged with...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...With RFP Red Fluorescence Protein the activity of promoter and RBS can be...level. RFP is excited at a wavelength of 580nm. The more RFP in the solution...the more is the RFP fluorescence intensity.The plate reader illuminates the...create the exact wavelength. The more RFP in the sample the higher is the RFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....RFP fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ... PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ...PR4 medium Promoter J23110 strong RBS B0034 ...PR5 medium Promoter J23110 medium RBS B0032 ...PR6 medium Promoter J23110 weak RBS B0031 ...The results of this test show that PR2 is 39 9 times stronger than PR6....tested the promoter and RBS activity with GFP as a reporter and the results...fluorescence intensity and compared between this part and our improvement....']"},{"machine":"BBa_K608018","videoId":"BBa_K608018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2M - [ Measurement ] ['medium promoter and weak RBS with RFP...This part consists of a medium promoter with weak RBS PR6 and tagged with...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...With RFP Red Fluorescence Protein the activity of promoter and RBS can be...level. RFP is excited at a wavelength of 580nm. The more RFP in the solution...the more is the RFP fluorescence intensity.The plate reader illuminates the...create the exact wavelength. The more RFP in the sample the higher is the RFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....Red fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ...PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ...PR4 medium Promoter J23110 strong RBS B0034 ...PR5 medium Promoter J23110 medium RBS B0032 ... PR6 medium Promoter J23110 weak RBS B0031 ...repeat this experiment. We have also tested the promoter and RBS activity with...']"},{"machine":"BBa_K137112","videoId":"BBa_K137112","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2N - [ Coding,cds, membrane, receptor ] ['lamB is the a porin protein which is part of the maltose pathway. It is also...']"},{"machine":"BBa_K1189009","videoId":"BBa_K1189009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2O - [ Coding ] [' Beta lactamase His tag Beta lactamase BLA is an enzyme frequently...present in plasmids for selection. Beta lactamase is a 29 kDa monomeric...Kinetically beta lactamase is simple and shows high catalytic efficiency....that we are expressing and purifying functional protein which is degrading the...protein is functional....from red to yellow. This is because there is phenol red a pH indicator added...']"},{"machine":"BBa_K249007","videoId":"BBa_K249007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 2P - [ Reporter ] []"},{"machine":"BBa_J18930","videoId":"BBa_J18930","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3A - [ Protein_Domain,classic, reporter, proteindomain ] ['Cerulean GFP is an optimized FRET donor molecule that was rationally designed...In ECFP a single exponential fit to the fluorescence lifetime is not feasible...']"},{"machine":"BBa_K518007","videoId":"BBa_K518007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3B - [ Device,function, motility ] ['cheZ expression cassette no promoter ...CheZ is responsible for the dephosphorylation of flagellum regulating protein...direction change and thus a narrower range of mobility. With a promoter of...The CheZ intracellular signaling cascade is started by detection of a...Work done by Welch et al. 3 showed that CheY protein is active only when...phosphorylated. The dephosphorylation and inactivation of CheY is regulated by...plate containing 1 10 40 100 M IPTG respectively. The 1st picture is a...']"},{"machine":"BBa_K389004","videoId":"BBa_K389004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3C - [ Reporter,cds, enzyme, chassis, prokaryote, ecoli, classic, reporter, function, reporter, light ] ['vector. Luciferase is a sensitive reporter gene....The activity of a luciferase is measured in a luminometer so only use this... production is growth dependent...']"},{"machine":"BBa_K091171","videoId":"BBa_K091171","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3D - [ Composite ] []"},{"machine":"BBa_K133010","videoId":"BBa_K133010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3E - [ Coding,cds, function, immunology ] []"},{"machine":"BBa_I732114","videoId":"BBa_I732114","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3F - [ Coding ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K156010","videoId":"BBa_K156010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3G - [ Coding,cds, reporter, function, reporter, fluorescence ] ['This part codes for strongly enhanced blue fluorescent protein SBFP2 ....expression in cells. SBFP2 is yet another fluorescent protein like GFP that...']"},{"machine":"BBa_K398206","videoId":"BBa_K398206","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3H - [ Generator ] [' Figure 1 When IPTG binds to LacI the promoter is active and AlnA can be...AlnA is a protein with emulsification activity originated from the natural oil...AlnA is a protein with emulsification activity originated from the natural oil...this protein keeps its emulsifying capacities when it is produced by other...water and oil. This process is based upon the ability of biosurfactants to...The original sequence is available in GenBank...own emulsifier assay. The main difference to the existing assays is that... 1. Walzer G. Rosenberg E. and Ron E.Z. The Acinetobacter outer membrane protein A OmpA is a secreted emulsifier. Environmental Microbiology. 8 1026 1032. 2006 ... 4. Toren A. Orr E. Paitan Y. Ron E.Z. and Rosenberg E. The active component of the bioemulsifier alasan from Acinetobacter radioresistens KA53 is an OmpA like protein. The Journal of Bacteriology. 184 165 170. 2002 ...']"},{"machine":"BBa_K518005","videoId":"BBa_K518005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3I - [ Coding,function, motility ] ['CheZ is responsible for the dephosphorylation of flagellum regulating protein...Work done by Welch et al. 3 showed that CheY protein is active only when...phosphorylated. The dephosphorylation and inactivation of CheY is regulated by...plate containing 1 10 40 100 M IPTG respectively. The 1st picture is a...and segmentized. The relative colony size is determined as a pixel number of...the segmented region. A Graph plot. B Bar chart plot. Data is expressed as...']"},{"machine":"BBa_K358006","videoId":"BBa_K358006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3J - [ Generator ] []"},{"machine":"BBa_K925000","videoId":"BBa_K925000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3K - [ Coding ] ['This part encodes a 12 desaturase derived from Synechocystis sp PCC 6803. It...the bacterial membrane composition changes. Linoleic acid is observed....Our results indicate that C18 2 is present in both the lipid extracts and...the control meaning the 18 2 found in the transformed cells is the expected...desaturase is able to catalyze the desaturation of oleic acid to give linoleic...']"},{"machine":"BBa_K1051502","videoId":"BBa_K1051502","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3L - [ Coding ] [' Sic1 a protein is a stoichiometric inhibitor of Cdk1 Clb B type...prevents premature S phase entry.Multisite phosphorylation of Sic1 is thought...promoter the cells will stop at late G1 and the cell becomes larger than the...the degradation. This is the version without stop codon. ...']"},{"machine":"BBa_K607040","videoId":"BBa_K607040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3M - [ Regulatory ] ['reverse pBad araC promoter...']"},{"machine":"BBa_K098995","videoId":"BBa_K098995","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3N - [ Composite ] ['heat sensitive cI QPI with high promoter...This is a heat sensitive cI QPI with a high promoter preceding the repressor...reporter or indicator is adding to the right of this part....']"},{"machine":"BBa_K222000","videoId":"BBa_K222000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3O - [ Reporter,classic, reporter, function, reporter, light ] ['Aequorin is a photoprotein isolated from luminescent jellyfish like various...Cells containing this part are able to sintetize apoaequorin the apoprotein...ground state blue light wavelength 469 nm is emitted. ...the transmembrane potential that is why they are called voltage dependent...these channels is the following ...Where g is the conductance associated with the channel V is the...transmembrane potential and E Ca is the Nernst potential related to the...fraction of all channels that are open. This fraction is determined by...channels in its plasma membrane. However there is a lack of study of the...properties of these channels. That is why we have determined their conductance...cytoplasm where aequorin is located through voltage dependent calcium...1 5V this observation is not carried out by our yeasts. The reason must be...that the electrical input is too low so yeasts don t die so easily as with...more elevated voltage and a better response is produce with a more...has to be noted the sharp peak of light produced when stimulation is applied...Again light production is lower in mutant cells also in the first peak of...calcium ions enter through VDCCs. A sharp peak of light is produced when the...stimulus is applied but our controls discard the idea of an artifact. For...']"},{"machine":"BBa_K750104","videoId":"BBa_K750104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 3P - [ Signalling ] ['This part contains promoter pBAD RBS of 1.0 strength cI lva protein...and double terminator. When arabinose is added the promoter pBAD will be...promoter PcI and repress the production of reporter gene behind it. In our...repressed by cI protein. And this part can provide cI protein for PcIGLT ....arabinose which effect on promoter pBAD an E.coli promoter see more 4 ....In the absence of arabinose cI regulated promoter PcI expresses GFP with...repressor CI protein is translated and represses PcI ....called Dual input BCD Decoder. Once the construction is completed Engineered...gfp LVA tt failed to function which is supposed to express GFP without...But we got no result from the SDS PAGE it is possible to hypothesize that the...SDS PAGE is not so sensitive to detect the low concentration of cI protein ...aim of constructing this new part is to reduce the hypothetic leakage of cI...']"},{"machine":"BBa_K143062","videoId":"BBa_K143062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4A - [ Composite ] ['subtilis . LacI can be used in conjunction with the lac operon promoter...The double terminator is the most commonly used terminator and is a...Please note. This part has picked up a mutation which changes an amino acid...']"},{"machine":"BBa_K315015","videoId":"BBa_K315015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4B - [ Coding ] ['This sequence is the wild type TetA gene which has been deoptimized from base...pairs 1 to 141. This is a basic part that can be placed behind a promoter and...']"},{"machine":"BBa_K322124","videoId":"BBa_K322124","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4C - [ Translational_Unit ] ['This part is identical to I15010 but in pSB1C3. We were unable to revive...I15010 or the composite part M30109. It is clear from the registry sequencing...that the DNA for M30109 is not what it is supposed to be....This part was made by PCRing out the Cph8 region from M30109. A PstI site...WARNING Following sequencing of this part from the 2012 kit plate by Exeter...be taken when using this part from the plate....']"},{"machine":"BBa_K608017","videoId":"BBa_K608017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4D - [ Measurement ] ['medium promoter and medium RBS with RFP...This part consists of a medium promoter with medium RBS PR5 and tagged with...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...dye is 595nm. The absorbance is proportional with the amount of bound dye....because the concentration of BSA is known and with a linear calibration line...With RFP Red Fluorescence Protein the activity of promoter and RBS can be...level. RFP is excited at a wavelength of 580nm. The more RFP in the solution...the more is the RFP fluorescence intensity.The plate reader illuminates the...create the exact wavelength. The more RFP in the sample the higher is the RFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....Red fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ...PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ...PR4 medium Promoter J23110 strong RBS B0034 ... PR5 medium Promoter J23110 medium RBS B0032 ...PR6 medium Promoter J23110 weak RBS B0031 ...The results of this test show that PR5 is still 19.6 times stronger than PR6....not repeat this experiment. We have also tested the promoter and RBS activity...']"},{"machine":"BBa_J06503","videoId":"BBa_J06503","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4E - [ Coding,cds ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_I763026","videoId":"BBa_I763026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4F - [ Generator ] ['Note Sequencing by the 2008 Caltech iGEM team shows no promoter sequence...']"},{"machine":"BBa_K404314","videoId":"BBa_K404314","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4G - [ Project,proteindomain, binding, viral_vectors, aav, capsid_coding ] ['N terminus of VP2. It is expected that these peptides become located on the...Additionally it is required to knock down the natural tropism of the virus...promoter of the vector plasmid Table 1 ....controls. Transduction is rescued by integration of the DARPin into the virus...']"},{"machine":"BBa_K575004","videoId":"BBa_K575004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4H - [ Composite ] ['This part constitutively transcribes the LasR receptor protein that is part of...the Pseudomonas quorum sensing hierarchy. Its function is characterized as...']"},{"machine":"BBa_K874000","videoId":"BBa_K874000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4I - [ Coding ] ['This part codes for the M.ScaI http rebase.neb.com rebase enz M.ScaI.html ...methyltransferase protein. M.ScaI is a type II methyltransferase subtype...leaving an N4 methylcytosine m4 . This methylation type m4 is not found in...native E. coli nor is the recognition site methylated by any of E. coli s... Its prototype restriction enzyme is commercially available...It can be assumed that M.ScaI is expressed and folds properly in E. coli ...However it might be worth noting that the protein is natively found in...which is a bacteria that has an optimal growth temperature of 26C and thus...']"},{"machine":"BBa_K777000","videoId":"BBa_K777000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4J - [ Coding,chassis, prokaryote, ecoli, promoter, anderson, regulation, constitutive ] ['This part can be used for chemotaxis assays.... Here is the complete sequence of this part as an ApE file http 2012.igem.org wiki images f fc Tar receptor under the control of constitutive promoter.zip .... promoter anderson ...positive regulators J23100 constitutive promoter protein Tar...']"},{"machine":"BBa_K731400","videoId":"BBa_K731400","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4K - [ Composite ] ['This part encodes a cysteine desulfhydrase CysDes from Treponema denticola ...This part has been successfully operated and characterized both in pSB1C3 and...the low copy vector pSB4K5. A sfGFP tagged fusion of this part has also been...This part was cloned by the iGEM Trento 2012...This part is also available in the low copy vector pSB4K5 upon request.... SAFETY NOTES Please note that this part produces hydrogen sulfide which...bacteria is posted in the iGEM Trento 2012 wiki...CysDes is a unique 45 KDa hemolysin cysteine dependent that was shown to have...This part produces high levels of CysDes enzyme upon IPTG induction. Protein...produces 1 mM H2S when cysteine is provided at a concentration of 1mM thus...cells Panel B Induced cells. Absorbance at 483 nm is shown in blue optical...density is shown in red. ...The decrease of the free copper concentration in the medium fig. 5B is the...The new part we submitted is part...more details about this part iGEM17 USTC http 2017.igem.org Team USTC ....Cysteine Desulfhydrase is an aminotransferase that converts cysteine into...activity is not restricted to anaer obic conditions expression of cysteine...membrane of our engineered E.coli. The easiest way is to precipitate those...cadmium ions and solve the pollution of cadmium ions. With this part we can...The reason we chose this part for contribution is that we found out that many...of this part. For example although it can precipitate cadmium ions to...increase the resistance but what is the maximum concentration of cadmium ions...gene from IDT. We inserted this gene to plasmid pSB1C3 with promoter pLuxR on... one contains gene CysDes and promoter pLuxR into strain BL21. Then we picked...protein CysDes is about 46kDa we can find obvious bands at the about position...In our project we added Cd2 which is toxic to bacteria to our media to...strengthen the resistance to Cd2 . But the substrate of CysDes cysteine is a...concentration of S2 which is reduced from cysteine under the catalysis of...development for 20 min at 20 C. Sulfide concentration is determined from the...From figure 4 the concentration of S2 in the group of CysDes is higher than...light s wave length is 455 nm and the source is a LED light bought from an...This part was used together with part...']"},{"machine":"BBa_K914007","videoId":"BBa_K914007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4L - [ Generator ] ['I SceI homing endonuclease expression is controlled by pBad promoter....Expression is induced with IPTG if LacI is present in the cell. I SceI doesn t... 1. Those two plasmids are not compatible. Plasmids could have different origins of replication. That might be the reason why double transformation is unsuccessful. ... 2. Our system works. Our system perfectly works but there is some leakage in the promoter leading to the expression of I SceI meganuclease. In such case it very efficiently cuts I SceI restriction site digesting the second plasmid with ampicillin resistance.... E.Coli strain. The first plasmid in this experiment is analogous to the one...second plasmid is the same as in the previous experiment ...Only the version with pLac promoter was tested because they all have the same...that our circuits work but there is some leaky expression of I SceI...promoter. Results are presented on the next photos ...on the plates containing both Amp and Cm. This is a sign that our construct is...leaky and the expression and function of I SceI is so efficient that it...']"},{"machine":"BBa_J31008","videoId":"BBa_J31008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4M - [ Reporter ] [' RFP reverse is a reversed mRFP...']"},{"machine":"BBa_K634002","videoId":"BBa_K634002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4N - [ Composite ] ['promoter the system could proceed in the absence of AgmR ibid ....This part is a promoterless monocistronic operon ready to be put under a...desired promoter. When expressed in a cell containing part...where exaDE was induced under the ParaBAD promoter by arabinose the...']"},{"machine":"BBa_K123002","videoId":"BBa_K123002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4O - [ Regulatory ] ['the ERE and disrupting the constitutive promoter LacIQ from producing TetR via...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K779311","videoId":"BBa_K779311","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 4P - [ Reporter ] ['environment. After the hammerhead mKate sequence is transcribed the mRNA... The circuit above shows Hef1A constitutive promoter driving an mKate red...Hef1A constitutive promoter driving a hammerhead before an mKate. Once the...hammerhead is transcribed one could assume that since it is self cleaving ...TagBFP DNA. There is less red fluorescence in the hammerhead constructs...']"},{"machine":"BBa_K1055000","videoId":"BBa_K1055000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5A - [ Measurement ] ['mKate is a fluorophor derived from dsRed...mKate is a fluorophor derived from dsRed and is a FRET partner of LssmOrange...ATTENTION If you want to make a fusion protein with this part please refer...mKate is a red fluorescent protein that we want to use as a acceptor for FRET...that the excitation maximum is at 579 nm and the emission maximum is 611 nm....The emission maximum is big enough to get stimulated by...database http www.rcsb.org pdb explore.do structureId 1UIS which is shown...The expression of mKate is not toxic towards the bacterial host E.coli ...']"},{"machine":"BBa_I732102","videoId":"BBa_I732102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5B - [ Coding ] ['affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....The sequence produce LRLb repressor protein which is based on natural lacR...added to both ends of this part for standard assembly....']"},{"machine":"BBa_K538002","videoId":"BBa_K538002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5C - [ Coding ] ['resistance enhancing BioBricks both contain a promoter an RBS and this...K538202 this part is placed under control of the Lac operon s promoter. ... DnaK is a 70 kilodalton heatshock protein involved with many different...and GrpE . It s been debated whether or not DnaK is involved with...case. 2 http rnajournal.cshlp.org content 9 12 1418.full It is also...it is reported to be a causative agent of systems failure in E. coli at low...temperatures than EcoDnaK which is characteristic for cold active...']"},{"machine":"BBa_K404112","videoId":"BBa_K404112","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5D - [ Project,function, celldeath ] ['Cytosine Deaminase CD EC 3.5.4.1 in E.coli is encoded by codA and plays a...1989 Anderson et al. 1989 . The expression of codA is regulated by the...pyrimidines the expression is repressed while lack of any nitrogen leads to...The CD s function is based on conversion of 5 Fluorocytosine 5 FCyt to the...loss of function of cytosine permease codB which is located adjacent to codA...suicide gene therapy. 5 FUra itself is metabolized to...1989 . FdUMP inhibits thymidylate synthetase which is responsible for...advantage of 5 FUra is its solubility and ability to freely diffuse into...']"},{"machine":"BBa_K1051000","videoId":"BBa_K1051000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5E - [ Reporter ] ['Red fluorescent protein with assembly standard 23 is engineered mutant of red...']"},{"machine":"BBa_M1004","videoId":"BBa_M1004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5F - [ Coding ] ['Membrane protein involved in type I secretion. When protein is fused to the...']"},{"machine":"BBa_J52642","videoId":"BBa_J52642","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5G - [ Reporter ] []"},{"machine":"BBa_K899012","videoId":"BBa_K899012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5H - [ Composite ] ['The data is given in a table table 1 and can also be seen plotted on a...logarithmic scale figure 1 . Hour nr. 7 is left out because it was measured...As you can see clearly SST is decreasing the growth rate of the bacteria....This is most likely because SST produces an indigestible polysaccharide from...disadvantages concerning growth. This is probably because FFT produces a...1 kestosefrom sucrose that the bacteria is able to digest. ...SST is decreasing the growth rate of E. coli Top10 but not FFT. ...The goal of this experiment is to test the inulin production of our bacteria... This method is purely developed by the students and has been based on...The idea of this method is to crystallize inulin by adding ethanol. This...experiment twice. The negative is less stained than the positive throughout...the experiments. Also the FFT is mostly more powerful in color than SST. ...inulin added FFT SST. First 2 rows is the first round third and fourth row...Also the FFT sample is slightly more colored than the SST sample. This could...correct we can conclude that FFT is producing a small amount of inulin most...']"},{"machine":"BBa_K763000","videoId":"BBa_K763000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5I - [ Reporter ] ['This construction is made up of three elements ...1 . The transcription factor binding site inside the promoter ...2 . the repressor binding site outside the promoter and...When is the protein synthesized In order to obtain the blue fluorescent...protein two conditions have to be met. First condition there is no glucose in...the medium. Second condition lactose is present in the medium it also works...The molecular mechanism underlying this phenomenon is as follows a lack of...transcription unless lactose is also present in the medium. Once lactose...enters the cell it is converted to allolactose 3 and this molecule binds...differential expression when glucose is absent and lactose present and vice...INDUCED PROMOTER . For fluorescence intensity FI measures cell growth i.e....']"},{"machine":"BBa_K216003","videoId":"BBa_K216003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5J - [ Translational_Unit,cds, receptor ] ['promoters such as PompC see Baumgartner J.W. Kim C. Brisette R.E. ...This part is intended to be used with the hybrid signal transduction Trz...with the template DNA to make this part we should note that the results from...']"},{"machine":"BBa_K1088024","videoId":"BBa_K1088024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5K - [ Device ] ['HRT2 prenyltransferase from Hevea Brasilianis ara promoter without araC ...This part encodes the rubber producing prenyltransferase HRT2 from the rubber...The part is designed to express the enzyme when induced with arabinose under...glucose scarce conditions. Arabinose binds the ara promoter regulator AraC ...promoter....detected. The addition of the promoter regulator AraC device did not prove to...necessary for expression control of the arabinose promoter. B Northern blot...A 3xFLAG tag is C terminal to the HRT2 prenyltransferase but ins t part of...arabinose promoter. The purification was done according to the SOP developed...following information is available at our wiki as well An introduction to...H1 NMR is based on the absorption and re emitting of electromagnetic...properties of the magnetic field as well as the isotope which is affected....of 0 it is only possible to detect chemical shifts from atoms with an unequal...number. The most common types of NMR is C13 and H1. It is sometimes useful to...be noted that the C13 NMR is much less sensitive since the natural abundance...of C13 atoms is 1.109 whereas the natural abundance for H1 is 99.98 and...therefore this method is more sensitive. There are also more Hydrogen atom s...see from our data below only the H1 NMR is shown since the C13 NMR simply was... Spectrum illustrating our HRT2 DXS part. In this spectrum it is important to notice the same peaks as before ...purification . The peak at 0.00 ppm is the defining peak of the ppm axis and...represents TMS which is a calibrating standard.... The peak at 5.12 is vaguely present and the rest of the peaks assigned to isoprene are hidden in the noise ... The peak at 5.12 is a triplet which corresponds to the previously observed shape of the 5.12 peak and we ... expect that it is a indicator of the presence of polyisoprene production...hidden in the background noise which is most likely due to cell debris and...estimation is far from optimal however only the sensitivity of H1 NMR...']"},{"machine":"BBa_K360127","videoId":"BBa_K360127","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5L - [ Device ] ['J23105 constitutive promoter LovTAP Photosensor...factor trp repressor. The resulting protein is called LovTAP LOV and...of the LOV domain is often flanked by amino or carboxy terminal helices ...DNA binding affinity decreases and LovTAP is in an inactive conformation....The reason of the conformational change is the following ...Cys450 side chain is involved in light state in bond formation with the...The isoleucine 427 is quite big. But not enough to push the cystein s side...by an PHE427 an amino acid which is much bigger and have more or less the...']"},{"machine":"BBa_K322123","videoId":"BBa_K322123","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5M - [ Translational_Unit ] ['Phycobilin is chromophores light capturing molecules found in cyanobacteria...could be added at the end of the operon. The there is a weak RBS B0032 ...']"},{"machine":"BBa_K343000","videoId":"BBa_K343000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5N - [ Coding ] ['flagella is a complex and energy consuming process so the expression of the...involved proteins is tightly regulated by the extracellular environment. One...of the most well studied flagella synthesis systems is that of Eschericia...Apart from initiation of flagella synthesis FlhDC is also a repressor of cell...FlhDC is a hexameric transcription factor that consists of four FlhD subunits...factor 28 which is responsible for the expression of the class III genes....that an upregulation of the expression of the operon is responsible for the...']"},{"machine":"BBa_J33207","videoId":"BBa_J33207","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5O - [ Reporter ] ['lac promoter and lacZ...This part submitted in pSB1A2 consists of the lac promoter and lacZ gene ...site of the Biobrick prefix. This is designed to be used as a cloning vector...']"},{"machine":"BBa_K801100","videoId":"BBa_K801100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 5P - [ Generator,classic, reporter, pret ] ['This is an improved version of the RFP generating device...the standard shipping part that is required for submission of backbones ...contributed to the characterisation of this part by testing the time of...contain a degradation tag and the RBS is strong....This part is commonly used but can fail if the system contains LacI or CAP...of this part as a cloning tool. When ligating any part or part assembly into...any standard backbone that contains this part the non restricted and single ...BioBrick insert the size of the BioBrick insert and whether the insert is an...restriction sites into the prefix and suffix of this part. Additionally two...This part may be used as a standard insert for RFC10 as well as...lysate in a cuvette is shown in the figure on the right. The absorption of the...cell extract was measured in a photometer. The spectrum recorded is shown in...present as it is described in literature....']"},{"machine":"BBa_K331023","videoId":"BBa_K331023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6A - [ Composite ] ['This part has a oligo arginine sequence fused to the C terminus of an enhanced...']"},{"machine":"BBa_J176027","videoId":"BBa_J176027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6B - [ Regulatory ] ['Constitutive CMV promoter PCR cloned from pcDNA3.1 ... wiki images thumb 9 94 Haynes Promoters mCh.png 400px ...Haynes Promoters mCh.png File Haynes Promoters mCh.png ... File Haynes Promoters mCh.png Enlarge ... Comparison of human promoters in U2OS cells ...The cytomegalovirus promoter CMV promoter drives expression at a level...greater than the ubiquitin C promoter Ubc and human phosphoglycerate kinase...']"},{"machine":"BBa_K300004","videoId":"BBa_K300004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6C - [ Protein_Domain ] ['This part is a highly engineered intein that is able to self cleave its...C terminus cleavage is also strongly affected by temperature 20 C see...']"},{"machine":"BBa_I718004","videoId":"BBa_I718004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6D - [ Coding ] ['dapA Dihydrodipicolinate synthase is an essential gene in the lysine and the...The expression of dapA is controled by the dapAp promoter see part I71800x ...whose activity is regulated by DAP concentration through an unknown mechanism....Lysine is also known to have an allosteric feedback effect on the DapA...The lysine pathway is pretty well conserved across all kingdoms. In plants ...DAP is only an intermediate in the lysine biosynthesis. There is no...constitutive need for DAP and there is a strong negative feedback of lysine...DAP which is consistent with the fact that there is a medium negative...Dihydrodipicolinate synthase is the first enzyme unique to lysine...aldolase with respect to carbon carbon bond formation. The enzyme is inhibited... Expression from the Escherichia coli dapA promoter is regulated by intracellular levels of diaminopimelic acid. Acord J Masters M 2004 FEMS Microbiol Lett 235 1 131 7. PMID 15158272 ...']"},{"machine":"BBa_K165004","videoId":"BBa_K165004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6E - [ Protein_Domain,chassis, eukaryote, yeast, function, reporter, fluorescence ] ['This is the mCherry fluorescent protein yeast codon optimized and biobricked...']"},{"machine":"BBa_K1060009","videoId":"BBa_K1060009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6F - [ Generator ] [' constitutive promoter and medium RBS...Chloramphenicol is placed on the left a control plate on the right aphids...extract from the lacI operator medium strength promoter construct. These bands...are less clear in the medium and high strength promoter lane. The expected...size of the EBF synthase protein is around 66kDa which could fit with the...promoter construct did not influence aphid behaviour. Possibly the expression...of EBF synthase is just too high which would be equally inhibitory as a too...the growth medium as it is suggested to improve solubility and functionality...']"},{"machine":"BBa_K352011","videoId":"BBa_K352011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6G - [ Reporter,cds, ligand, chassis, prokaryote, ecoli, classic, reporter ] ['pCooM Promoter coupled with RBS RFP Double terminator...pCooM Promoter coupled with RBS RFP double terminator...This component is used to measure high levels of carbon monoxide in the...sensitive promoter which is pCooM promoter from Rhodospirillum rubrum. This...device is only active when there is CooA transcriptional activator and Carbon...monoxide gas in the environment. When there is CO in the environment the...PcooF and PcooM the two CooA regulated R. rubrum promoters contain 2 fold...CooA regulated promoters are analogous to class II CRP dependent promoters. We...chose PcooF for this study because it is the stronger promoter based on the...Promoter coupled with RBS RFP Double terminator output RFP...']"},{"machine":"BBa_K779312","videoId":"BBa_K779312","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6H - [ Reporter ] ['environment. After the hammerhead mKate sequence is transcribed the mRNA... The circuit above shows Hef1A constitutive promoter driving an mKate red...Hef1A constitutive promoter driving a hammerhead before an mKate. Once the...hammerhead is transcribed one could assume that since it is self cleaving ...TagBFP DNA. There is less red fluorescence in the hammerhead constructs...']"},{"machine":"BBa_K322921","videoId":"BBa_K322921","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6I - [ Translational_Unit ] ['SacB is used as a negative selection marker which allows to insert genes onto...Measurement of SacB promoter ...We SMS Shenzhen Team tested the strength of this promoter by comparing it...with J23100. According to our measurement SacB promoter is a functional...promoter in E.coli expression system....For detailed information about SacB promoter please see the...']"},{"machine":"BBa_J176017","videoId":"BBa_J176017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6J - [ Regulatory,function, regulation, transcriptional, promoter ] ['Doxycycline inducible promoter from Invitrogen vector pcDNA FRT TO T Rex... When used in cells without Tet the promoter is constitutive always on ... Tetracycline is also an effective inducer. The levels of tetracycline in tet treated cows is sufficient to cause a leaky off state. Tet free fetal bovine serum is highly recommended.... CMVTetO2 is a hybrid DNA element composed of the naturally occurring...cytomegalovirus promoter See CMV ...stimulates formation of the transcription initiation complex at the promoter....The off state of the promoter is maintained when the Tet repressor protein...doxycycline or tetracycline is added to the cell culture medium the chemical...repressor s affinity for the binding sites and the promoter become active. ... promoter...']"},{"machine":"BBa_K1122673","videoId":"BBa_K1122673","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6K - [ Coding,cds, biosynthesis ] ['This part codes for the fusion of Pyruvate decarboxylase and Alcohol...Microbial production of ethanol is of great importance due to its possible...application as a biofuel. Increasing ethanol yields in bacteria is potentially... Figure A. Ethanol is generated from pyruvate fed into the pathway from... Figure B. Putative structure of a fused protein. Pdc tetramer red is an...N terminus of AdhB blue . Presented AdhB enzyme is a dimer and just one of...the monomers is linked to Pdc....of J33207 IPTG inducible promoter combined with LacZ reporter. This process...are missing and an additional band of increased size is observed. In vector...only lane none of above described bands is present. To see full SDS PAGE go to...In order to present that functionality of adhB is attributed to a peptide of a...']"},{"machine":"BBa_I739001","videoId":"BBa_I739001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6L - [ Generator ] ['control of the constitutive promoter...transcription of tetR is terminated by the double terminator... ATc http openwetware.org wiki ATc is added TetR action is inhibited and...the promoter gets derepressed....the system. In the project description this part is also termed Part 1 . The...constitutively synthesized TetR interacts with the double promoters...both BioBricks could be confirmed by Nano Glo assay which is why the...Fig. D . The total NanoLuc activity is only present in bacteria that are...transformed with a plasmid encoding the luciferase and there is a clear...NanoLuc is attached to the cells and only proteins from lysed cells are...supernatant of the cultures was analyzed the luciferase activity is present in... Discussion The autotransporter is working and can present small protein...tetracyclin repressed promoter the secretion into the bacterial periplasm as...extremely strong fold is too big in size for the autotransporter and can not...using recombinant BirA biotin ligase is well established but could not be show...']"},{"machine":"BBa_K360021","videoId":"BBa_K360021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6M - [ Coding ] ['factor trp repressor. The resulting protein is called LovTAP LOV and...of the LOV domain is often flanked by amino or carboxy terminal helices ...DNA binding affinity decreases and LovTAP is in an inactive conformation....The reason of the conformational change is the following ...Cys450 side chain is involved in light state in bond formation with the...The isoleucine 427 is quite big. But not enough to push the cystein s side...by an PHE427 an amino acid which is much bigger and have more or less the...']"},{"machine":"BBa_K781001","videoId":"BBa_K781001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6N - [ Composite ] ['This is the modified RFP protein obtained from J04450 that has been...This part was successfully characterized and determined to show expression of... The flagellin domains may hinder proper folding of the RFP. This may be why the more constrained deletion variant is showing less expression compared to the insertion variant which has more flexibility. ...This part can be used as a template for making other PCR overlap insertions...']"},{"machine":"BBa_K515005","videoId":"BBa_K515005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6O - [ Translational_Unit,classic, reporter ] ['A depiction of the primer binding and a representative gel is below....It is a component of the composite...']"},{"machine":"BBa_P0478","videoId":"BBa_P0478","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 6P - [ Generator,classic, generator, rct ] []"},{"machine":"BBa_K208000","videoId":"BBa_K208000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7A - [ Coding ] ['This is a new Silver fusion compatible GFP BioBrick part. This particular GFP...containing this GFP with a Lac promoter....reporter. The cycle 3 mutant developed by Crameri et al. 1996 is of special...base pair is removed from the prefix and suffix directly next to the part. ...The scar that is formed from ligating XbaI and SpeI between two fusion...compatible parts is 5 ACTAGA 3 which is six base pairs long and does not...method. Additionally this part is still useful and functional for non fusion...']"},{"machine":"BBa_M1600","videoId":"BBa_M1600","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7B - [ Coding ] []"},{"machine":"BBa_K196014","videoId":"BBa_K196014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7C - [ Device,cds, enzyme, function, biosynthesis, plasmidbackbone, copynumber, high ] ['This is the most important biobrick we constructed in order to test the glue... Caulobacter crescentus . C.crescentus is an aquatic Gram negative...bacterium that divides asymmetrically. Besides the bacterium is able to...synthesize a strong glue. This glue is mainly composed of polysaccharide....']"},{"machine":"BBa_K912001","videoId":"BBa_K912001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7D - [ Coding ] ['HokkaidoU Japan 2017 analyzed this part. This protein s activity falls as...']"},{"machine":"BBa_K879011","videoId":"BBa_K879011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7E - [ Coding ] []"},{"machine":"BBa_J61032","videoId":"BBa_J61032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7F - [ Reporter,cds, enzyme, function, reporter, color ] ['Alkaline phosphatase coding sequence no rbs promoter or terminator present ...relative to the stated sequence but the construct is fully functional. This... pBca1020 Bca1032 under the control of a Tet promoter and RBS b0034....The reporter gene phoA encoding Alkaline phosphatase is used to report gene...']"},{"machine":"BBa_K309020","videoId":"BBa_K309020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7G - [ Reporter ] ['This is a reporter for use in a C. elegans chassis. Excitation wavelength of...']"},{"machine":"BBa_K914008","videoId":"BBa_K914008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7H - [ Generator ] ['I SceI homing endonuclease expression is controlled by pRha... 1. Those two plasmids are not compatible. Plasmids could have different origins of replication. That might be the reason why double transformation is unsuccessful. ... 2. Our system works. Our system perfectly works but there is some leakage in the promoter leading to the expression of I SceI meganuclease. In such case it very efficiently cuts I SceI restriction site digesting the second plasmid with ampicillin resistance.... E.Coli strain. The first plasmid in this experiment is analogous to the one...second plasmid is the same as in the previous experiment ...Only the version with pLac promoter was tested because they all have the same...that our circuits work but there is some leaky expression of I SceI...promoter. Results are presented on the next photos ...on the plates containing both Amp and Cm. This is a sign that our construct is...leaky and the expression and function of I SceI is so efficient that it...']"},{"machine":"BBa_K1189008","videoId":"BBa_K1189008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7I - [ Coding ] ['Beta lactamase BLA is an enzyme frequently present in plasmids for...selection. Beta lactamase is a 29 kDa monomeric enzyme. Its enzymatic activity...these antibiotics Qureshi 2007 . Kinetically beta lactamase is simple and...that we are expressing and purifying functional protein which is degrading the...protein is functional....from red to yellow. This is because there is phenol red a pH indicator added...reporter activity. Our kinetic activity shows that the biggest decrease is in...at 10 micrograms. This decrease is lessened as we decrease the amount of TALE...target sequences. If capture is successful the B lac is present in the well...been captured and is present in the sample which is a very important...']"},{"machine":"BBa_K360128","videoId":"BBa_K360128","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7J - [ Device ] ['J23114 constitutive promoter LovTAP Photosensor...factor trp repressor. The resulting protein is called LovTAP LOV and...of the LOV domain is often flanked by amino or carboxy terminal helices ...DNA binding affinity decreases and LovTAP is in an inactive conformation....The reason of the conformational change is the following ...Cys450 side chain is involved in light state in bond formation with the...The isoleucine 427 is quite big. But not enough to push the cystein s side...by an PHE427 an amino acid which is much bigger and have more or less the...']"},{"machine":"BBa_K590032","videoId":"BBa_K590032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7K - [ Coding ] ['This part encodes an enzyme that reduces cellular fatty acyl ACPs from the... ADC this part forms the...which generates alkanes from the fatty acid biosynthesis pathway. This part...fatty acid biosynthetic pathway. Alkane production is enhanced when growing...']"},{"machine":"BBa_K257002","videoId":"BBa_K257002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7L - [ Coding ] ['ClyA or HlyE is an alpha PFT for Pore Forming Toxins.... ClyA is capable of co localizing a variety of structurally diverse fusion partners to the surface of E. coli and their released vesicles but only when the periplasmic disulfide bond forming machinery was present it s makes OMVs an ideal structure to transport hydrophobic compounds like membrane proteins into the host.... 3. F.J del Castillo F. Moreno. and I.del Castillo. Secretion of the Escherichia coli K 12 SheA hemolysin is independent of its cytolytic activity 2001 FEMS Microbiol.Lett. 204 281 285. 11731136 http www.ncbi.nlm.nih.gov pubmed 11731136 ...']"},{"machine":"BBa_K180000","videoId":"BBa_K180000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7M - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Hybrid promoter trp lac regulated tac pR ...The Ptac promoter is a functional hybrid promoter derived from the trp and...lac promoters that are regulated by trp and lac 1 . The Ptac sequence has...The Ptac promoter sequence here is preceded by a coding region for lacIq the...function of this is to repress the promoter in its natural state within a...system. The promoter will then have to be induced for example by IPTG for...the promoter to function in the ON state. Ptac is also useful compared to...its single parent promoters trp pR and lac pR as it has a stronger binding...affinity than either of its parent promoters....This year LINKS China improved the previous ptac promoter part...2009 by reversing its lacI promoter RBS and terminator which will improve...promoter....experiment we tested four ptac promoter the old one the new one the one...with RiboJ and with SccJ. We convinced that all for ptac promoters are able...promoter starts at a similar level as the concentration of IPTG increases ...of ptac promoter to investigate whether they can fit our experiments or not....results imply that all five promoters can be activated obviously and the same...as in glucose promoters with ribozyme also obtain high sensitivity to the... T LINKS China Figure 5 different ptac promoter.jpeg wiki images thumb 4 4e T LINKS China Figure 5 different ptac promoter.jpeg 600px T LINKS China Figure 5 different ptac promoter.jpeg.png File T LINKS China Figure 5 different ptac promoter.jpeg ...modified four new ptac promoter parts which are convinced to have higher... promoter ...control trp lac direction forward n a Hybrid promoter trp lac...']"},{"machine":"BBa_J36850","videoId":"BBa_J36850","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7N - [ Generator ] ['This device contains a lac promoter and strong ribosome binding site for lac ...NOTE ABOUT THE SEQUENCE The mixed site between parts is only six base...pairs ACTAGA. There is no spacer T or G nucleotide. These spacer nucleotides...the y axis is the event frequency and the x axis is the fluorescence intensity...1mM IPTG. This data shows that there is no appreciable difference between the...increased retention between the beads and the flouophore. The black is beads...with no flouophore the red is with 10 nM and the purple is 100 nM. These...peptide of 11 amino acids into OmpA. After our improvement this part was...given a new function. We used a surface display system Lpp OmpA from this part...through co culturing E. coli containing this part with v 3 positive and...']"},{"machine":"BBa_I712004","videoId":"BBa_I712004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7O - [ Regulatory,rnap, eukaryote, direction, forward, chassis, eukaryote, promoter, regulation, constitutive ] ['CMV promoter...a constitutive expression promoter for use in mammalian cells. Ribosome...binding site is included....K203100 as a first application for its newly developed units of promoter...Mammalian Promoter Units...We furthermore found that CMV is not a truly constitutive promoter but we... argue http 2009.igem.org Team Heidelberg Project Measurement There are no truly constitutive promoters in mammalian cells ...that no such promoter exists . In... Fig. 1 Strength of the CMV promoter in different cell lines in REU ....truly constitutive promoters in mammalian... Fig. 3 Real time RT PCR data of CMV and JeT promoters. One group of HeLa...cells were transfected with plasmid containing CMV promoter coupled to GFP....Another group with JeT promoter coupled to GFP was used as reference. RNA was... Fig. 4 Real time RT PCR data of CMV promoter Arbitrary units of CMV...divided by that of JeT is the...further characterized this CMV promoter part by cloning it upstream of a GFP ...As part of the characterization this part was also directly compared to parts...Fluorescence of the CMV promoter device was measured relative to these...The CMV promoter device successfully expressed GFP in HEK293FT cells. Part...experiment however does reveal the relative strength of the CMV promoter...selected artificial sequence GGGGATTCCC. We evaluated the optimized promoter...activity with EGFP and evaluated the promoter in various cells with the Dual ...we did not find any systematic data on the function of commonly used promoters...promoter that would lead to reliable and strong expression of transfected...EYFP and TagBFP encoded on plasmids under the CMV and hEF1a promoters and...under a CMV promoter shown in blue or hEF1a promoter shown in red for a ...As an improvement of the natural CMV promoter that shows no activation...following LPS stimulation we designed a promoter based on the CMV promoter...CMV enhancer and large parts of the promoter by NF B and AP1 binding sites...promoter....approach we have developed a promoter that shows 25 fold basal expression of...the CMV enhancer promoter named Synthetic promoter 1...One of the central aspects of our inflammatory toxin sensor is the LPS ...sensitivity of its promoter. Because of that one of our goals was to design a...LPS sensitive promoter showing high induction following LPS treatment. In a...enhancer promoter shows NF B and c Jun dependent regulation in response to...followed by a decrease in promoter activity Lee et al. 2004 . This...results promoter CMV.png Figure 1 Relative activity of CMV promoter in HeLa...untreated control significance level 10 significance is indicated by...To achieve high induction of the CMV promoter following LPS treatment of the...cells we had to modify the promoter enhancer regions of the CMV promoter....LPS sensitivity of the CMV promoter is mediated through NF B and AP1...effects of other transcription factors on promoter activity the CMV enhancer...and large parts of the promoter were removed just leaving a minimal CMV...promoter with the TATA box and the initiator sequence which are essential for...promoter activity. To make the promoter sensing we added AP1 and NF B...transcription factor binding sites right in front of the CMVmin promoter.... TGAXTCA for AP1 where Y is C or T R is A or G X is C or G and N is any... Synthetic promoter 1 ...consisting of three NF B AP 1 sites Synthetic promoter 2 ...results synthpromoters.png ...promoters. Combination of both transcription factor binding site sequences 3...times each and the minimal CMV promoter A yielded the two synthetic...promoter sequences used for our project B ....In order to test the synthetic promoters described above their activity...pEGFP C2 using AseI HindIII to linearize the vector CMV enhancer promoter and...results promoter minCMV 1.png Figure 3 Relative activity of NF B ...AP1 minCMV1 promoter in HeLa cells 24 hours A and 48 hours B after...results promoter minCMV 2.png Figure 4 Relative activity of NF B ...AP1 minCMV2 promoter in HeLa cells 24 hours A and 48 hours B after...For both synthetic promoters a significant upregulation of the promoter...Whereas the activity of the synthetic promoter 1 maximally increases about 40...promoter 2 rises up to approximately 100 over the basal activity. For both...promoters the highest values were observed for cells treated with 2 g mL...LPS. Furthermore the basal activities of both synthetic promoters were...compared using the basal activity of the CMV promoter as a standard see...results promoter basal.png Figure 5 Relative basal activity of all tested...promoters in HeLa cells 48 hours A and 72 hours B after transfection. Data...was normalized to CMV promoter which served as reference. Data shown...The results indicate that both synthetic promoters exhibit a higher basal...activity than the original CMV promoter. This could be due to higher...clarify. The naturally occurring LPS sensitive human IL 6 promoter shows a...basal activity comparable with the CMV promoter. For the usage as a LPS sensor...the promoter ideally exhibits a low basal activity like the IL 6 promoter. But...even more important is its LPS sensitivity. Figure 6 indicates that the gain...of IL 6 activity is significant but much smaller compared to the synthetic...promoters....results promoter IL6.png Figure 6 Relative activity of IL6 promoter in HeLa...untreated control significance level 10 significance is indicated by...improved CMV promoter that is capable of detecting LPS in the surrounding of...It is much more sensitive than the naturally occurring LPS sensitive...interleukin 6 promoter but shows a higher basal activity than the IL 6 and the...CMV promoter. Regarding the basal activity and LPS sensitivity the Synthetic...promoter 2 has tremendous advantages over Synthetic promoter 1 making it the...better LPS sensor. But it is of note that the basal activity of the Synthetic...promoter 1 is up to approximately 25 times higher than of the natural CMV ...promoter. This tremendous enhancement of promoter activity makes it applicable...enhancer promoter in response to lipopolysaccharide and bacterial CpG ... promoter ...']"},{"machine":"BBa_K912000","videoId":"BBa_K912000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 7P - [ Coding,chassis, prokaryote, ecoli, Kit plates, probiotics, production ] ['Phytase is an enzyme that breaks down phytic acid. This particular phytase was...down the phytate to the point where the chelated particle is released....cell. Once the phytase is released it is free to act upon the phytic acid....HokkaidoU Japan 2017 analyzed this part. As temperature rises this phytase s...']"},{"machine":"BBa_K331025","videoId":"BBa_K331025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8A - [ Composite ] ['This part has a oligo arginine sequence fused to the C terminus of an enhanced...']"},{"machine":"BBa_K515105","videoId":"BBa_K515105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8B - [ Composite,classic, reporter, constitutive ] ['J23100 promoter sfGFP...This part is superfolder GFP a very brightly fluorescent protein under the...control of the constitutive promoter J23100. This BioBrick has been sequence...This test is to show the thermostability of sfGFP by identifying the...As is visible from these plates fluorescence was detected in bacteria...The insert is very clearly visible at just below 2 kb. This confirms the...this is representative....miniprep. No DNA was yielded in this miniprep. It is therefore likely that the...spectra for mCherry ranges from 551 nm to 800 nm. There is an overlap of 77 nm...each fluorescent protein is accurate....']"},{"machine":"BBa_K137007","videoId":"BBa_K137007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8C - [ Coding,function, recombination, fim ] []"},{"machine":"BBa_K360129","videoId":"BBa_K360129","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8D - [ Device ] ['J23117 constitutive promoter LovTAP Photosensor...factor trp repressor. The resulting protein is called LovTAP LOV and...of the LOV domain is often flanked by amino or carboxy terminal helices ...DNA binding affinity decreases and LovTAP is in an inactive conformation....The reason of the conformational change is the following ...Cys450 side chain is involved in light state in bond formation with the...The isoleucine 427 is quite big. But not enough to push the cystein s side...by an PHE427 an amino acid which is much bigger and have more or less the...']"},{"machine":"BBa_K342003","videoId":"BBa_K342003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8E - [ Regulatory,Kit plates, biofilm ] ['OmpR234 protein with higher effect on Curli promoter...This part is coding for a mutated version of the response regulator OmpR J...associated sensor EnvZ. This mutated phosphorylated protein is a better...activator of the curli csgD promoter than the wild type OmpR. OmpR234 can...This part can be used to induce a constitutive biofilm producing phenotype in...bacteria. OmpR234 is now used by several labs in the world in USA for...representative picture is presented here....The complete protocol is available here http 2011.igem.org Team Lyon INSA ...We can see that the strain containing the pIG16 plasmid is more adherent than...the strain containing the control plasmid pIG3 and is able to produce thick...the PHL1414 strain. The strain harboring the pIG16 plasmid is noted S31. The...control strain with the pIG3 plasmid is noted S30....mean value of 6 measures the corresponding standard deviation is indicated. ...The OD600 is not significantly different for the two strains which shows...there is no significant effect of the plasmids on the growth....deviation is indicated. The crystal violet staining of the attached bacteria...There is a significant increase p 0.0008 in Student t test of stickiness...biofilm is solubilized in ethanol. C Absorbance is measured at 500 nm. ...found that CsgG is around 30 kDa whereas CsgA B C E and F are all around...increases adhesion to glass surfaces. B Stained biofilm is solubilized in...ethanol. C Absorbance is measured at 500 nm. ...']"},{"machine":"BBa_K274371","videoId":"BBa_K274371","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8F - [ Composite ] ['PoPS P2 ogr PO promoter PoPS...']"},{"machine":"BBa_K527002","videoId":"BBa_K527002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8G - [ Coding ] ['CYP79B1 is an N hydroxylase converting L Tryptophan into indole...3 acetaldoxime is generally toxic to fungi and is frequently used as a...As is observed from the TLC the bond of the reference oxime has moved...We believe that the difference in migration is due to the fact that the...A specific characteristic of p450 s is their absorbance of light at 450 nm in...CO carbon monoxide is added to a membrane sample by blowing bubbles at...approximately 1 bubble sec in 60 seconds. The reason for doing this is that...to bind it is necessary to reduce the heme group with a strong reducing agent...observe peaks at 420. This is most probably something endogenous substance in...active state it is in some cases possible to have an active enzyme without...As the CO measurement shows there is no peak at 450 nm for the User assembled...We have included a spectrum of an active p450 below. This is what we would...This is why there is an increase in the absorbance at 450 nm. Accordingly...there is a decrease at 420 nm as the cytochrome shifts to absorbing at 450...nm. Also there is an increase and decrease at 420 and 450 nm respectively ...at the latest measurement. This is due to the enzyme being oxidized and...']"},{"machine":"BBa_K331030","videoId":"BBa_K331030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8H - [ Intermediate ] [' which is a yellow fluorescent protein...control of the tetracycline repressible promoter...to add a tetracycline repressible promoter...N terminal oligoarginine is reducing the half life of the protein to which it...']"},{"machine":"BBa_K557001","videoId":"BBa_K557001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8I - [ Translational_Unit ] ['paired and translation of CheZ is inhibited. In the absence of CheZ the...which the ribosome binding site is exposed and CheZ is expressed thus... The results Figure2 3. show that the Aptamer cheZ Device is functional ...and the 0.3 agar is the best ratio for the migration experiments. ...']"},{"machine":"BBa_K360121","videoId":"BBa_K360121","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8J - [ Signalling,function, regulation, transcriptional, function, sensor, light ] ['factor trp repressor. The resulting protein is called LovTAP LOV and...of the LOV domain is often flanked by amino or carboxy terminal helices ...DNA binding affinity decreases and LovTAP is in an inactive conformation....The reason of the conformational change is the following ...Cys450 side chain is involved in light state in bond formation with the...The isoleucine 427 is quite big. But not enough to push the cystein s side...by an PHE427 an amino acid which is much bigger and have more or less the...4 . The part does not include a promoter. We eliminated the inverting...must be low we plan to test weak promoters to choose the best option and...']"},{"machine":"BBa_K300002","videoId":"BBa_K300002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8K - [ Protein_Domain ] ['This part is derived from phaP gene from Ralstonia eutropha which encodes for...by phasins assembled in tandem can increase the affinity with PHA. This part ...Because this part is a head domain the Prefix is compatible with RFC10 and...the Suffix is compatible with RFC23....It is an update of...']"},{"machine":"BBa_K245050","videoId":"BBa_K245050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8L - [ Composite ] ['The part is designed to prepare a polypeptide composed of gyrase B fragment on...N terminus and CutA1 on C terminus. CutA1 is a bacterial protein that binds...metal ions and is a trimeric protein. Gyrase B fragment can dimerize in the...novobiocin. The purpose of this construct is to prepare material that can be...coding for His tag is inserted between ATG and multiple cloning site which...Figure 1 where CutA1 coding sequence is at the 3 and GyrB coding sequence...The polypeptide product of this composite part is a combination of a...dimerization GyrB and a trimerization CutA1 domain. Assembly of is protein...Because this protein construct is a combination of a dimerization GyrB and a...domain of CutA1 is shown in grey. Right Hexagonal packing can cover the...CutA1 packing light blue is shown in scale for comparison. ...']"},{"machine":"BBa_K1065000","videoId":"BBa_K1065000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8M - [ Translational_Unit ] ['2 oxoglutarate oxygenase decarboxylase is an Ethylene Forming Enzyme EFE ...This part was cloned by the iGEM Trento 2013 team for the creation of an... Please note that this part has a modified Prefix and Suffix compatible to...This part produces ethylene a compound that can be inflammable at a...concentration between 2.7 to 36 . We characterized this part under the control...of an AraC pBAD promoter. With a air volume culture volume ratio 4 we...detected about 200 ppm of Ethylene. This concentration is not dangerous and...not inflammable. However we suggest to manage this part carefully. See...This part was characterized with with two different inducible systems in E.... EFE characterization with AraC pBAD promoter... 5mM arabinose is a strong induction that causes stress on cells . However ...cell growth is not completely inhibited so EFE is not highly toxic...Ethylene is produced upon blue light exposure 92 15 ppm while it is not...was better defined with this part. Further experiments need to be done to...']"},{"machine":"BBa_K274392","videoId":"BBa_K274392","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8N - [ Composite ] ['PoPS PhiR73 pag PP promoter PoPS...']"},{"machine":"BBa_K112305","videoId":"BBa_K112305","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8O - [ Translational_Unit,function, celldeath ] ['information about the BBb Format is available at ...']"},{"machine":"BBa_K204047","videoId":"BBa_K204047","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 8P - [ Composite ] ['This is a representative image from several independent replicates. S ...used in this particular replicate was an uninduced culture of strain...cultures above background in the 20 25 kDa range which is where the AHL...']"},{"machine":"BBa_I746916","videoId":"BBa_I746916","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9A - [ Coding ] ['This is the coding sequence of superfolder GFP Pedelacq et al 2006 ...with the naked eye even without UV or blue light illumination that is to say...the amount of blue light in normal daylight or lablight is sufficient ....Additionally it is more stable in vitro and refolds faster after in vitro...Note Superfolder GFP is available in constructs driven by the pBAD and T7...promoters part numbers I746908 and I746909 respectively. Additionally 6 his...calibration. The result is shown in the graph....2Rep sfGFP is the recombinant chromoprotein that can mix with the NT 2Rep CT...synthesized the part NT 2Rep CT to for artificial silk spinning is the...is an extensive repetitive region Rep . We believe this part can realize the...part is only responsible for to form continuous silk that are colorless. In...increasing trend as regions are added this result is constant in all three of...our chromoprotein. This suggests that our 2Rep protein domain is successfully...the most transmittance The stable feature of this particular silk spun...circularity is qualified as a uniformly distributed silk. For sfGFP when 2Rep...is added to the front of chromoprotein the silk formed is has the smallest...Promoter T7 promoter ...indicates the increase of fluorescence in the medium is based on the secretion...of sfGFP CInt TRX and not on lysis of cells and sfGFP is carrying CInt TRX...coli . The original version is shown in Fig. 1. Pc is a constitutive...promoter Pcp6 promoter and it promotes the expression of HucR and YgfU. When...uric acid is absent HucR can bind to PhucR which suppresses dsRed...We also constructed a recombined pet28a plasmid composed of T7 promoter and...intensity of blank group without any sfGFP is 113 A.U. the ordinate at the...origin should be 113. So the b should be 113. It is easy to understand that...superfolder GFP designed by Overkamp W et al at 2013 4 which is a codon...free and the BbsI restriction endonuclease is an economical and efficient...fragments. And its fluorescence intensity is higher than superfolder GFP...that the sfGFP is fused to the CBDcipA...expressing pUC19 CBD sfGFP. To the left is a control with Vmax expressing...carbenicillin is partially caused by the higher protein production of Vmax...increasing at 0.3 C per second. Temperature C is displayed on the x axis ...and d Fluor dT is displayed on the y axis....From the results of the derivative curve we observe that sfGFP is less... Conclusion There is no variation in the intensity of fluorescence for...environment. It is also observed that there is no variation in fluorescence... Summary A codon optimized version of this part was constructed in...Further information for this part in Flavobacteria will be added during the...If there is a need for faster responses in the system and in consequence for...Therefore the addition of the ASV tag becomes ideal as it is supposed to be...with the same promoter double terminator and RBS was done to see how the tag...Figure 1. Experimental data extracted from the Plate reader. Each curve is a...between the two degradation rates as the production rate is the...been proved that the degradation rate is increased approximately 25 when...the ASV tag is added on the sfGFP gene sequence. All in all it has been...Therefore the introduction of an ASV tag is a good approach to reduce the...']"},{"machine":"BBa_K215001","videoId":"BBa_K215001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9B - [ Tag ] ['which already has a strong promoter and RBS attached. In order for the...secretion tag to function this part needs to be used in conjunction with...This part works as designed. This is documented in the BioBrick page...which adds a promoter and RBS to this part so that it can be tested....']"},{"machine":"BBa_K346001","videoId":"BBa_K346001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9C - [ Translational_Unit,binding, metal, cds, transcriptionalregulator ] ['This part was designed as a translational unit for MerR expression....domain at the N terminal. The signature of MerR family is a helix turn helix...inducible promoter PmerT which has an unusually long spacer of 19 bp the...contact of RNA polymerase is sloppy. When Hg II is available in the...regulator binds to the operator region of PmerT promoter and recruits RNA...polymerase forming a ternary complex. Transcription is slightly repressed...because the apo MerR regulator dimer has bent the promoter DNA such that RNA...ions the metallated MerR homodimer causes a realignment of the promoter such...family merR pMerR sfGFP terminator. This sensor has a constitutive promoter...would de repress its cognate promoter merR on murcury binding and trigger the...We select three constitutive promoters of varying strengths from iGEM promoter...promoter that is the lower the MerR receptor concentration the more... Figure 4 A Different constitutively J23 family promoter measured... The Hill constant EC50 is the inducer concentration that provokes half maximal activation of a sensor EC50 is negatively correlated with sensitivity.... KTop is the sensor s maximum output expression level KTop is positively correlated with output amplitude....']"},{"machine":"BBa_I732086","videoId":"BBa_I732086","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9D - [ Composite ] ['This part is similar to...there is a mutation induced by PCR in...convinced that the mutation has nothing to do and this part works as well as...']"},{"machine":"BBa_M45995","videoId":"BBa_M45995","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9E - [ Coding ] []"},{"machine":"BBa_K566023","videoId":"BBa_K566023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9F - [ Generator ] ['promoter....It is the best characterized member of the ferredoxin dependent bilin...from ferredoxin. B when BV13 an isomer of BV is used as the substrate PcyA...']"},{"machine":"BBa_K157043","videoId":"BBa_K157043","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9G - [ Coding,function, reporter, fluorescence ] ['CFP under the control of a CMV promoter....']"},{"machine":"BBa_K1031301","videoId":"BBa_K1031301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9H - [ Reporter,chassis, prokaryote, ecoli, function, reporter, fluorescence, rbs, prokaryote, constitutive, constitutive, terminator, double ] ['For detailed information concerning HbpR and Pc promoter please visit 2013...HbpR is the activator of two promoters Pc and Pd they are 54 dependent....space between the centers of UASs C 1 and C 2 is critical for cooperative...placed in an appropriate position with respect to the promoter region the Pc...promoter is still inducible with 2 HBP albeit at a lower level. It shows that...the presence of UAS pair C 3 C 4 mediated a higher promoter activity for... Fig 1 The sequences preceding hbpC and hbpD promoter contains the binding...on Pc promoter there are 4 UASs responsible for binding with HbpR. b ... HbpR binding sites on Pd promoter there are 2 UASs for binding with HbpR....K1031301 is composed of three elements the inducible promoter Pc RBS...promoter for HbpR. The green oval stands for RBS B0031. sfGFP coding sequence...is shown with dark blue while terminator B0015 is in dark red....circuit consists of Pc promoter RBS B0031 and reporter gene sfGFP. The curve...circuit adopting different RBS. Fluorescence intensity of sfGFP is detected...']"},{"machine":"BBa_K156009","videoId":"BBa_K156009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9I - [ Coding,function, reporter, fluorescence ] ['expression in cells. OFP is yet another fluorescent protein like GFP that...']"},{"machine":"BBa_K398006","videoId":"BBa_K398006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9J - [ Coding,function, degradation ] []"},{"machine":"BBa_K1033919","videoId":"BBa_K1033919","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9K - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['the color development is slower. The color is readily observed in both LB or... Important This part is not available in the registry yet however the same...part is available from the registry with the standard RBS...This part is useful as a reporter....']"},{"machine":"BBa_K332033","videoId":"BBa_K332033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9L - [ Translational_Unit,cds, transcriptionalregulator, chassis, prokaryote, lactobacillus, classic, generator, plasmids, classic, regulatory, other, function, cellsignalling, function, dna, plasmidbackbone, copynumber, high, proteindomain, repression, regulation, negative ] ['It is a transcriptional unit including 37 induced RBS tetR double...It can be added various promoter to adapt your conditions....']"},{"machine":"BBa_K199118","videoId":"BBa_K199118","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9M - [ Reporter ] ['T7 promoter RBS RFP...T7 Promoter R0085 RBS B0034 RFP E1010 ...We wanted to add new normalised RFU data for two promoters from the Anderson...the different promoters with mRFP1. All the values were analysed by blank ...RFU OD600 values during overnight growth of three different promoters...RFU OD600 values during overnight growth of three different promoters...RFU OD660 values during overnight growth of three different promoters...RFU OD660 values during overnight growth of three different promoters...Biological replicates of BL21 DE3 cells for T7 promoter....constitutive promoters as well as the T7 promoter started with a very high...followed by the weak constitutive promoter J23106 as we would expect and...proteins at the beginning one of them is mRFP. To develop an oral cancer...candidate reporter genes. This part is composed of T7 promoter RBS mRFP ...fluorescent intensity is similar to the excitation graph. To the peak...is quite weak there is little difference between each pH value only the...absorbance wavelength of pH12 is lower than other pH values in both graph That...2 . T7 promoter RBS mRFP...']"},{"machine":"BBa_K1031441","videoId":"BBa_K1031441","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9N - [ Coding,cds, transcriptionalregulator, activator, chassis, prokaryote, ecoli, function, regulation, transcriptional ] ['library of Pc constitutive promoters collocating with a library of RBS...three elements the constitutive Pc promoter...arrowheads represent promoters RBS is shown as a green oval and the red...promoters collocating with RBSs Ribosome Binding Sites at different...stands for different HcaR biosensor with Pc promoters of different strength....The expression strength of these constitutive promoters J23113 J23109 ...J23114 J23105 J23106 is 21 106 256 623 and 1185 respectively according...The best performed biosensor Ph J23106 HcaR with RBS B0032 is then...']"},{"machine":"BBa_K249002","videoId":"BBa_K249002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9O - [ Coding ] ['Lumazine Synthase is an enzyme which creates Lumazine a product which...B12. As the inside layer of the lumazine synthase capsid is negatively...have been made called AALS neg and AALS 13 where the first is a more...negatively charged variant and the second is an optimized version of AALS neg...']"},{"machine":"BBa_K175041","videoId":"BBa_K175041","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 9P - [ Generator ] ['if LacI is present in the cell. I SceI has an LVA degradation tag....I SceI meganuclease and used the same pLac promoter but they had two...promoters which would be very useful for the modularity of our system. That...']"},{"machine":"BBa_K199021","videoId":"BBa_K199021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10A - [ Reporter ] ['This part is oriented opposite to typical BioBrick arrangement in terms of...placement of BioBrick prefix and suffix. This part can be ligated to a...promoter to measure promoter activity....']"},{"machine":"BBa_K1080009","videoId":"BBa_K1080009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10B - [ Coding ] ['the double bonds on GGPP. The final product is chlorophyll a . ...The plasmid is under the control of the lac...The N terminal of the sequence considered is M Met ....The instability index II is computed to be 26.91 This classifies the protein...Nikolai S. et al. 2009 . Expression of chlorophyll synthase is also...']"},{"machine":"BBa_K953000","videoId":"BBa_K953000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10C - [ Composite ] ['in E. coli . This part differs from Part...that it also includes a T7 promoter Part...']"},{"machine":"BBa_K638001","videoId":"BBa_K638001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10D - [ Coding ] ['This is the coding region for Reflectin A1...In the squid this protein is believed to self assemble with membranes to form...reflects light 3 . Reflectivity in these animal tissues is achieved by...a Bragg reflector creates a thin film interference pattern which is the...Optical characterization of these proteins is an important work for studies...using reflectin proteins. However it is hard to characterize the refractive...']"},{"machine":"BBa_K143064","videoId":"BBa_K143064","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10E - [ Composite ] ['The double terminator is the most commonly used terminator and is a...']"},{"machine":"BBa_K274391","videoId":"BBa_K274391","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10F - [ Composite ] ['PoPS PhiR73 pag PO promoter PoPS...']"},{"machine":"BBa_K082004","videoId":"BBa_K082004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10G - [ Coding,cds, transcriptionalregulator, repressor ] []"},{"machine":"BBa_K208038","videoId":"BBa_K208038","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10H - [ Composite ] ['Lac Promoter RBS GeneIII PhaP Terminator...This is a composite part that was created to demonstrate phasin secretion. The...lac promoter was used....NOTE The scar between the signal peptide and the protein is not presented...correctly in the sequence below. The scar is the Silver fusion scar ACTAGA ...targeting signal peptide sequence is genetically fused to the phasin protein...phasin with PHA is required for secretion based granule recovery because PHA...22kDA is observed in the sample from the phasin expressing E. coli cells that...being produced by the E. coli cells and is being secreted outside the cell...']"},{"machine":"BBa_K554005","videoId":"BBa_K554005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10I - [ Coding ] ['IL12 is an heterodimeric cytokine composed of a disulfide bound 35 kDa...adaptative immune system. It is primarily produced by antigen presenting cells...signaling is required for Th1 development It drives na ve Th0 differentiation...for Il 12 synthesis. The IL 12 gene is used by UNICAMP EMSE Brazil... As MORRIS et al. 2008 4 recollect Early approaches in generating recombinant IL 12 involved co transfection of cells with two different vectors each expressing one of the two genes p40 or p35 or expression of the individual genes under the control of separate promoters in a single plasmid or viral vector. Both approaches were disadvantaged due to inefficient expression of the functional heterodimer with the likelihood of p40 homodimer production And thus competitive IL 12 antagonist action. ...reveals that IL 12 is similar to class 1 cytokine receptor complexes. This is... A synthesis trigger promoter flhDC... We need a device that only works when needed recombinant IL 12 expression must not be continuous it has to be a reaction to a Th2 imbalance and stop when the balance is reestablished. Therefore we need a promoter that would be a sensible trigger .... With this right promoter a ribosome binding site RBS the IL 12 gene and a terminator E.Coli is now able to synthesize IL 12 in response to a Th2 imbalance. But being a bacteria it doesn t have the required material to secrete it in the body. Hence we also need to construct a secretion system that will be described in the dedicated part of this wiki....This sequence is used by UNICAMP EMSE Brazil...producing and secreting IL 12. This part is shown in red in the following...']"},{"machine":"BBa_K137069","videoId":"BBa_K137069","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10J - [ Coding,cds, enzyme ] ['This is the pyruvate oxidase from Streptococcus pneumoniae R6. It catalyzes...']"},{"machine":"BBa_K258001","videoId":"BBa_K258001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10K - [ Tag,cds, membrane, transporter ] ['acidic residue Glu. In our Wound Dressing project EGF is one of tke key...']"},{"machine":"BBa_K1031302","videoId":"BBa_K1031302","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10L - [ Reporter,chassis, prokaryote, ecoli, function, reporter, fluorescence, rbs, prokaryote, constitutive, constitutive, terminator, double ] ['For detailed information concerning HbpR and Pc promoter please visit 2013...HbpR is the activator of two promoters Pc and Pd they are 54 dependent....space between the centers of UASs C 1 and C 2 is critical for cooperative...placed in an appropriate position with respect to the promoter region the Pc...promoter is still inducible with 2 HBP albeit at a lower level. It shows that...the presence of UAS pair C 3 C 4 mediated a higher promoter activity for... Fig 1 The sequences preceding hbpC and hbpD promoter contains the binding...on Pc promoter there are 4 UASs responsible for binding with HbpR. b ... HbpR binding sites on Pd promoter there are 2 UASs for binding with HbpR....K1031302 is composed of three elements the inducible promoter Pc RBS...promoter for HbpR. The green oval stands for RBS B0032. sfGFP coding sequence...is shown with dark blue while terminator B0015 is in dark red....circuit consists of Pc promoter RBS B0031 and reporter gene sfGFP. The curve...circuit adopting different RBS. Fluorescence intensity of sfGFP is detected...']"},{"machine":"BBa_J18932","videoId":"BBa_J18932","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10M - [ Protein_Domain,classic, reporter, proteindomain ] ['The protein was expressed under T7 promoter in E.coli BL21 DE3 with 6x His...protein. The size of the complete protein with 6x Histag is about 26kDa. We...heavier band is the non truncated protein and the lighter one is its truncated...K2319009 uninduced K2319009 induced. The top band is the non truncated...protein and the the bottom band is the truncated protein....to proteins with a 6x His tag which is absent in the truncated protein....however is not true because the binding of 6xHis to Ni NTA is not perfect....is the non truncated protein and the bottom band is the protein truncated at... By combining the fluorescence and gel intensity data of the Ni NTA purification fractions supernatant after binding wash and elution .This is done assuming that truncated and non truncated protein has the same fluorescence. The fluorescence of each of the above fractions was divided into fluorescence due to truncated and non truncated protein based on their corresponding band intensities. The sum of fluorescence values of truncated and non truncated protein were then used as a measure of their concentration to determine truncation.... From this mcherry is estimated to have a truncation of 39.73 7.95 ... From this mcherry is estimated to have a truncation of 38.82 2.52 ...fluorescence of mCherry decrease quite sharply. But It is also observed that...there is no variation in the intensity of fluorescence depending on whether...']"},{"machine":"BBa_K274395","videoId":"BBa_K274395","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10N - [ Composite ] ['PoPS PhiR73 pag PLL promoter PoPS...']"},{"machine":"BBa_K364309","videoId":"BBa_K364309","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10O - [ Coding ] ['ER is a 17 estradiol activated steroid receptor member of the nuclear...ER is expressed at low to moderate levels in major physiological systems...']"},{"machine":"BBa_K925003","videoId":"BBa_K925003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 10P - [ Coding ] ['This part encodes a 6 desaturase derived from Synechocystis sp PCC 6803. The...enzyme is a membrane bound protein able to introduce a double bond at the 12...derived from cells transformed with 6 desaturase C18 2 is present unlike...our standard meaning the 18 2 found in the transformed cells is the expected...desaturase is able to catalyze the desaturation of oleic acid to give linoleic...acid. We also suspect this enzyme is able to desaturate alpha linoleic acid...']"},{"machine":"BBa_J176022","videoId":"BBa_J176022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11A - [ Protein_Domain ] [' Requires promoter and translation start e.g. Kozak for expression...Human codon optimized Anemonia majano cyan fluorescent protein AmCyan1 is a...']"},{"machine":"BBa_K091225","videoId":"BBa_K091225","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11B - [ Regulatory ] []"},{"machine":"BBa_I712028","videoId":"BBa_I712028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11C - [ Coding,function, reporter, fluorescence ] ['This protein is used to show that T7 polymerase is actually going into the...']"},{"machine":"BBa_K1124110","videoId":"BBa_K1124110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11D - [ Generator ] ['This parts express amilGFP LVA ....The protein amilGFP is very useful yellow chromoprotein and is used as...This parts is amilGFP with degradation tag LVA tag which increase decay rate...']"},{"machine":"BBa_K531006","videoId":"BBa_K531006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11E - [ Coding ] ['The wild Type esp is secreted by S. epidermidis a bacteria that has low G C...content in its genome. It is then optimized to give a high G C content without...growth is calculated by subtracting the ODmean of S. aureus only treatment...Esp which is known to target S. aureus biofilm specifically has a better...inhibition effect than DspB which is generally targeting most biofilms....Figure 5. All promoters were working great in Caulobacter. No significant...difference among three promoters were shown....']"},{"machine":"BBa_K1031444","videoId":"BBa_K1031444","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11F - [ Coding,cds, transcriptionalregulator, activator, chassis, prokaryote, ecoli, function, regulation, transcriptional ] ['library of Pc constitutive promoters and RBSs Ribosome Binding Sites at...stands for different HcaR biosensor with Pc promoters of different strength....The expression strength of these constitutive promoters J23113 J23109 ...J23114 J23105 J23106 is 21 106 256 623 and 1185 respectively according...']"},{"machine":"BBa_I732092","videoId":"BBa_I732092","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11G - [ Reporter ] ['The activity of upstream promoter can be qualitatively observed on a X gal...']"},{"machine":"BBa_I732113","videoId":"BBa_I732113","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11H - [ Coding ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K554008","videoId":"BBa_K554008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11I - [ Coding ] ['HlyD is part of the hemolysin secretion system Device 3 Protein Secretion...components of the system. This system is composed of 4 essential parts the...target protein to be secreted is IL 12. ...A more realistic schema of ABC transport system is shown below ... Usage and Biology HlyD is part of the hemolysin secretion system very...and a large periplasmic domain it is believed to establish specific links...membranes and the periplasm Thanabalu et al. 1998 . HylD is predicted to...based on hlyD a gene that is absent in most commensal E. coli but present in...']"},{"machine":"BBa_K530001","videoId":"BBa_K530001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11J - [ Coding ] ['This part has been improved by the DTU Denmark 2016 team by removing the...Enzyme in the pathway required for B Carotene Synthesis. This enzyme is named...compared with a wild type control. tHMG1 is used to funnel more initial...This is the sequencing for colony 4....']"},{"machine":"BBa_K1033932","videoId":"BBa_K1033932","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11K - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['naked eye. The strong color is readily observed in both LB or on agar plates... Important This part is not available in the registry yet however the same...part is available from the registry with the standard RBS...This part is useful as a reporter....the high copy plasmid pSB1C3 from the promoters J23110 left and J23106...Summary We have improved the characterization of this part by constructing it...Yeast cells were transformed with plasmids backbone pRS424 Promoter TEF2 ...']"},{"machine":"BBa_K173019","videoId":"BBa_K173019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11L - [ Generator ] ['This part is a PoPS alcohol dehydrogenase II generator. Alcohol...part the adhB gene is codon optimized for E. coli....']"},{"machine":"BBa_K864404","videoId":"BBa_K864404","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11M - [ Composite ] ['This is an expandation of chromoprotein cjBlue...provides a turqoise color visible to the naked eye. The sequence is codon...This part is useful as a reporter....']"},{"machine":"BBa_K500002","videoId":"BBa_K500002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11N - [ DNA ] ['Synthetized by Geneart Laccase is a polyphenol oxidase which belongs to the...']"},{"machine":"BBa_K258004","videoId":"BBa_K258004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11O - [ Coding,chassis, eukaryote, human ] ['Keratinocyte growth factor KGF is a locally acting epithelial mitogen that...The Keratinocyte Growth Factor KGF also known as FGF7 is a growth factor...keratinocytes are covering the wound forming the epithelium 3 . KGF is weakly...expressed in human skin but is strongly upregulated in dermal fibroblasts...In our Wound Dressing project KGF is responsible from the migration of new...']"},{"machine":"BBa_K415000","videoId":"BBa_K415000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 11P - [ Composite ] ['expressing mCherry. The promoter requires two inputs an environment free of...triggering the pLux promoter....The following is a plasmid map of the part in the pSB1A2 backbone ...It is clear from the above figure that the average mCherry fluorescence and...']"},{"machine":"BBa_K613013","videoId":"BBa_K613013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12A - [ Coding ] [' pSB3K1 http parts.igem.org Part pSB3K1 under a constitutive promoter...consensus pTet promoter B0040 http parts.igem.org Part B0040 in...2500 normalized RFUs which is the same level of expression as for the wild ...type TetR. This shows that the mutant is able to bind and inactivate pTet with...inhibit TetR function this inhibiton is less striking compared to the wild ...ATC action on the TetR mutant is clearly visible on this graph. From 200...ng mL RFP expression is reaching a plateau indicating that the maximal TetR...inhibition has been attained. The mutant is less repressed in presence of ATC...']"},{"machine":"BBa_K953004","videoId":"BBa_K953004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12B - [ Translational_Unit ] ['in E. coli . This part differs from Part...that it does not includes a T7 promoter Part...']"},{"machine":"BBa_K407008","videoId":"BBa_K407008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12C - [ Reporter ] ['This part is meant to serve as a device that constitutively expresses the cyan...fluorescent protein CFP by means of the promoter ptetR while repressing the...more number of cells under a given field of view it is recommended to spin...is expressed by itself by means of the repressible pTetR promoter....']"},{"machine":"BBa_K395400","videoId":"BBa_K395400","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12D - [ Generator ] ['is incorrect. Therefore we resistered this part again. ...positive control and used promoterless gfp on pSB3K3 as a negative control....We confirmed that product of lacIM1 shows weaker repression to lac promoter...']"},{"machine":"BBa_K143033","videoId":"BBa_K143033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12E - [ Coding,cds, transcriptionalregulator, repressor ] ['LacI is the regulator protein for the lactose operon in E. coli and the...hyper spank promoter of B. subtilis 1...these promoters in the absence of lactose or IPTG . LacI is not endogenous to...hyper spank promoter to be regulated. In the presence of IPTG or lactose the...LacI tetramer is unable to bind DNA and so transcription resumes....LacI can be used in conjunction with the lac operon promoter ...']"},{"machine":"BBa_K274394","videoId":"BBa_K274394","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12F - [ Composite ] ['PoPS PhiR73 pag Psid promoter PoPS...']"},{"machine":"BBa_K525517","videoId":"BBa_K525517","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12G - [ Coding,chassis, prokaryote, ecoli, function, degradation, bisphenol, proteindomain, internal ] ['Fusion protein of BisdA and BisdB behind constitutive promoter...Fusion protein of BisdA and BisdB behind constitutive promoter leading to...endocrine disruptor bisphenol A BPA . BPA is mainly hydroxylated into the...is oxidized during this reaction. BisdB in its oxidized status is reduced by...strong T7 promoter as Sasaki et al. ...medium strong constitutive promoter...promoter upstream of a polycistronic bisdAB gene we were able to completely...21 24 h. This data is shown in the following figure ...degradation is shown in fig. 3....BisdB striped behind the medium strong constitutive promoter...polycarbonates or epoxy resins and thus can often be found were BPA is also...present. Accordingly their presence is a potential disruptive factor that...could lead to a false positive signal with our biosensor. This is especially...true for BPS that in some cases is used as a substitute for BPA in baby...indicate their potential harmfulness but further research is needed to fully...medium strong constitutive promoter...medium strong constitutive promoter...possible that the decrease in BPF and BPS concentration is due to...phases. Cell growth is a first order...order reactions and is mathematically described as...specific growth rate is dependent on the concentration of the growth limiting...Because LB medium is a complex medium we cannot measure the substrate...The specific BPA degradation rate per cell q D is modelled with an...growths on the good imaginary substrate S1 no BPA degradation is observed....When this substrate is consumed the BPA degradation starts. The model for...this diauxic behavior is as follows ... polycistronic bisdAB genes behind medium strong promoter shown in black ...promoter shown in red were cultivated at least five times in E. coli KRX... open dots is plotted against the cultivation time. ...The specific BPA degradation rate per cell qD is about 50 higher when using... BPA is thermally stable you can autoclave it together with the medium... the characterization experiment setup is shown on the picture on the right... for LC MS analysis of BPA 300 mg BPA L 1 is rather too much...n a Fusion protein of BisdA and BisdB behind constitutive promoter...']"},{"machine":"BBa_K398030","videoId":"BBa_K398030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12H - [ Generator ] [' Figure 1 Complete Alkane degradation pathway ALDH is the 3rd step herein...ALDH is an aldehyde deyhydrogenase that facilitates the third step in alkane... NOTE This part contains the same protein...promoter RBS region. Figure 3 shows both activities. The following text is the...This part consists of an aldehyde dehydrogenase from the thermophile...This part was characterized using NAD NADH enzyme assay. By disrupting the...recombinant strain E. coli 030A which expresses this part have a dodecanal...the empty plasmid pSB1A2 . This activity is equivalent to 42 of the cell...']"},{"machine":"BBa_J176018","videoId":"BBa_J176018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12I - [ Tag ] ['degraded by the proteasome. This part is derived from yeast. We have used it...']"},{"machine":"BBa_K1051053","videoId":"BBa_K1051053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12J - [ Reporter ] []"},{"machine":"BBa_K204500","videoId":"BBa_K204500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12K - [ Coding ] ['FliH the regulator of ATPase FliI is one of soluble components of export...secretion level we used p Tet and p T7 promoters. Salmonella typhimurium ...MMHI0117 which is the fliH fliI null mutant. So it was speculated that less...Because T7 promoter is leaky in the absence of T7 RNAP in Salmonella...does not exist . And the secretion level of flagellar protein is also...']"},{"machine":"BBa_K873003","videoId":"BBa_K873003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12L - [ Conjugation ] ['This part contains a reporter gene I13521 combined with OriTR the R plasmid...nic region is where the relaxosome nicks the plasmid and conjugative transfer... For more information on how this part operates in our system please visit SEU A http 2012.igem.org Team SEU A ... The biobrick safety matters that we may involved in is that we construct a plasmid with the conjugation...']"},{"machine":"BBa_J36848","videoId":"BBa_J36848","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12M - [ Generator ] ['This device contains a lac promoter and strong ribosome binding site for lac ...NOTE ABOUT THE SEQUENCE The mixed site between parts is only six base...pairs ACTAGA. There is no spacer T or G nucleotide. These spacer nucleotides...Also the inconsistent sequence data is due to the fact that in order to...conform to the composite parts format an 8 base scar is shown in the get...selected sequence readout. The sequencing data is checked against this...had this part induced with IPTG. In this experiment increased florescence...Our results are described below in the histogram the y axis is the event...frequency equivalent to the number of cells counted and the x axis is the...This data shows that there is no appreciable difference between the induced...and uninduced cells at any given level of fluorophore. There is an increase in...believe this is because there is due to residual fluorophore present in...and the flouophore. The black line is beads with no flouophore the red is...with 10 nM and the blue is 100 nM. These showed a clear difference between...']"},{"machine":"BBa_K496003","videoId":"BBa_K496003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12N - [ Tag ] ['Leucine rich repeat protein SlrP is one of the effector protein secreted by...Salmonella Type 3 Secretion System T3SS . It is known that N terminus 191...this part to inject GFP to eukaryotic cell....that GFP is located in the cytosol of RK13. In contrast compairing B 4 and...']"},{"machine":"BBa_K352001","videoId":"BBa_K352001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 12O - [ Coding,cds, transcriptionalregulator, activator, chassis, prokaryote, ecoli, proteindomain, activation, proteindomain, binding ] ['change of tryptophan. We see a little difference between binding of promoter...The structure of CooA is given above by Jmol ...environment. CO dependent CooA is at the dimer structure when CO does not...exist. CooA is 28 identical 51 similar to CRP cAMP receptor protein and...binding domains. Identified structure of the protein is not symmetric and one...']"},{"machine":"BBa_J04450","videoId":"BBa_J04450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24O - [ Reporter,cds, reporter, chromoprotein, classic, reporter, pret, function, reporter, color, function, reporter, pigment ] ['contain a degradation tag and the RBS is strong....LacI and induced by IPGT. Plac is one of the most common promoter in life...science research field. It is mainly composed of Lac operon containing LacO...the binding of RNA polymerase to the promoter. So the expression of downstream...genes is blocked. Serving as inducer IPTG can bind with LacI repressor ...making the latter s conformation changes so LacI is detached from LacO site ...generator driven by Plac promoter however there is no LacI gene in it....Although the E. coli could express some LacI it is not enough for inhibition...promoter. It contains LacI gene which can lower significantly the RFP leakage...expression so that no excessive LacI expression which is considered as waste...identification result is showed in Fig.1. ...fluorescent intensity is fluorescence per OD600 standardized with fluorescence...leakage expression is very low and it is sensitive to the IPTG induction. ...induction. Relative fluorescent intensity is fluorescence per OD600...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...very sensitive to the IPTG induction and the RFP leakage expression is very... 4. Add 100 l bacteria culture medium into a sterile 96 well plate. IPTG is added to final concentrations of 1 2 5 10mM. M9 medium is the blank control. The colony without RFP expression is the negative control....This part is commonly used but can fail if the system contains LacI or CAP... Team TU Munich 2012 http 2012.igem.org Team TU Munich improved this part... Team Warwick 2015 http 2015.igem.org Team Warwick improved this part by...characterisation of this part by showing equal functionality in simulated...contributed to the characterisation of this part by testing the time of...apparition of fluorescence in presence of IPTG or not because the promoter...leaks as well as they contributed to the improvement of this part by using...contributed to the characterization of this part by showing decreased...contributed to the characterization of this part by analyzing the rate of...contributed to the characterisation of this part by testing the delay before...contributed to the characterisation of this part by testing the fluorescence...part by replacing the induced promoter lacI with the strong constitutive pf 5...promoter PampC. see ...Alpes Contribution contributed to the characterisation of this part by...testing the effect of cAMP on the promoter s leakages and protein expression...charazterization of this part by testing the effect of different media...the characterization of this part by introducing it in Trans10 to observe its...contributed to the charazterization of this part by testing the effects of...characterization of this part by testing the effect of glucose on the protein...contributed to characterization of this part by testing radiation tolerance of...replication that could explain this effect. This part is a reversion of this...successfully produce colonies. In these results is the negative control...plate streaked with pSB1C3 containing J04450 RFP . This is the most...origin which has expression in vibrio. However pGGA is not compatible with...plasmid per genome. These values indicate that K3445002 is effective in both...in a plasmid that is still capable of replication in E. coli but now also...Escherichia coli Nissle 1917 EcN is widely used as a probiotic since it s...contains a CAP sensitive promoter and glucose can inhibit its expression. ...We then investigate whether this phenomenon is influenced by the strain and...amount of IPTG added for respective treatment is 500 M. ... The red color absorbance under 588 nm wavelength is recorded around 2.5 3 OD units....the role of RBS and Promoter parts in giving rise to intrinsic noise in E....of this part as a cloning tool. When ligating any part or part assembly into...any standard backbone that contains this part the non restricted and single ...insert the size of the BioBrick insert and whether the insert is an assembly...we characterized its expression under lac promoter. We did the transformation...Violaceum competent cells with the protocol that is in our wiki we concluded...that the best O.D. for the heat shock transformation is 0.5 since it showed...expression. This part is useful for characterizing the expression of different...proteins using the lacI sensitive promoter. For better application of this...promoter in controlling protein expression the effects of different hosts...fluorescence intensity at different temperature is much higher than those of...leak appeared in 34 oC. This finding is different from our expectation where...medium containing flask is significantly higher than others indicating that...oxygen is an important factor which will affect the protein expressin and cell...by using different IPTG induction Fig 3 . However it is interesting that the...driven by PrplJ promoter and expressed in DH10B. In addition we also applied...weaker E.coli endogenous promoters PdapA and PcaiF Figure 1 ....PcaiF promoter....However it is difficult for us to perform additional experiments with... The goal was to characterize the effect of cAMP on the promoter s leakages...without production of cAMP. BTH101 strain is streptomycin resistant. ...inducible promoter lactose promoter to create an auto amplifier system. ...It is apparent that without IPTG there is a visible difference between strains...the leakage of the promoter. ...data suggest that the promoter does not leak in that condition. ...lactose promoter has almost no leakage suggesting that the leakage of the...lactose promoter is due to cAMP in absence of IPTG. When the cAMP production...is restored the promoter is activated and the protein is expressed. It is also...expression if no IPTG is added. ...SHuffle strains. In order to test this lacI regulated promoter in our chassis ...functionality of the promoter. Protein expression was analysed through an SDS ...leakiness in the promoter. IPTG concentrations were chosen based on conditions...worked previously when using a T7 promoter 0.2 mM and recommendations of the...show bands if the promoter lacked leakiness nevertheless a faint band can be...stronger bands compared to the uninduced control. Thus the promoter is...promoter....and have been excluded. In case of 532 605 the noise is disturbing the...EcN. The lag phase is shorter compared to the other two media while the...logarithmic phase is longer. In TB Media the lag phase is extended and the...growth is not as high as before but still exhibits a clear logarithmic phase....In sharp contrast to that the lag phase in LB Media is almost double and the...exponential phase is quite brief. These results are expected since the media...the RFP production in LB is significantly lower. For E. coli BL21 DE3 Figure...lowest RFP levels. The expression in LB media is only slightly higher than in...Enriched media. The protein expression in TB Media however is notably higher...the control of a lactose promoter is a good alternative to produce inducible...could divide 24h into three different growth phases 0 2h is lag phase 2 15h...is an exponential phase 15 24 is a stationary phase. ...spectra for mCherry ranges from 551 nm to 800 nm. There is an overlap of 77 nm...each fluorescent protein is accurate....showed the highest fluorescence readings. This is probably because cell...concentration of 87 5 which is 3 5 times higher than the recommended...We transformed the plasmid which RFP is inserted in psB1C3 into DH5 and...We transformed DH5 with the plasmid which RFP is inserted in psB1C3 and... At first the cells are cultured in liquid medium and the medium is replaced...with Butterfield s Phosphate Buffer BPB . This is because when the gamma ray...versus 10 Gy. From this result we concluded that E. coli is highly...sensitive to gamma irradiation when it is irradiated with 50 and more doses of...This graph shows that the number of cells is significantly reduced with...']"},{"machine":"BBa_K902019","videoId":"BBa_K902019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13A - [ Coding ] ['S7 micrococcal nuclease also known as MNase is native to Staphylococcus...']"},{"machine":"BBa_I732108","videoId":"BBa_I732108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13B - [ Coding ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_K1100006","videoId":"BBa_K1100006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13C - [ Reporter ] ['There is currently no text in this page. You can search for this page...']"},{"machine":"BBa_J06501","videoId":"BBa_J06501","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13D - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_J58105","videoId":"BBa_J58105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13E - [ Coding,cds, enzyme, phosphorylation, cds, membrane, receptor, function, odor ] ['This part corresponds to the coding sequence of a computationally engineered...This protein is based on a ribose binding protein template and has been...molecule. The closed conformation is able to bind a Trg protein. This part can...We can use this part to construct a sensor device. It requires using E. coli...computational methodology is general and can be used to sense other molecules....allosteric motion is propagated to the cytoplasmic EnvZ kinase domain of our...OmpR transcription factor OmpR P which is then able to induce transcription...of the pOmpR promoter....']"},{"machine":"BBa_K091002","videoId":"BBa_K091002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13F - [ Coding,cds, enzyme, phosphorylation ] ['This part codes for the LsrK protein from E. coli strain MG1655. This protein...']"},{"machine":"BBa_J45008","videoId":"BBa_J45008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13G - [ Coding,function, biosynthesis, odorant, function, odor, s ] ['which is a precursor to isoamyl acetate banana odor ....']"},{"machine":"BBa_K957000","videoId":"BBa_K957000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13H - [ Generator ] ['The purpose of this part is to upregulate mtrB expression in response to...when such a complemented strain is inoculated in a microbial electrochemical...arsenic inducible promoter upregulating expression of downstream protein....Because mtrB activity is requisite for functionality of the mtr electron...oneidensis MR 1 is capable of shuttling electrons through the Mtr pathway to...transfer is energetically favorable to the organism. In short a potentiostat...data is preliminary Because of the care we took to establish a thorough...arsenate reductase activity is indeed confounding and antimonite to estimate...production over time is plotted for continuous flow reactors inoculated with...It is also important to point out that we have not normalized any data to a...concentrations of arsenite as would be expected. Therefore it is likely that...']"},{"machine":"BBa_K777109","videoId":"BBa_K777109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13I - [ Coding,chassis, prokaryote, ecoli, function, motility ] [' The fliC gene codes for flagellin. This protein is the subunit that forms the flagellar filament of E. coli ....natural promoter travelled approximately 1 5cm radius whereas no swimming...']"},{"machine":"BBa_K633001","videoId":"BBa_K633001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13J - [ Coding,cds, membrane, transporter ] ['EstA is an outer membrane anchored esterase from Pseudomonas aeruginosa . It...the C terminal domain formes a barrel like structure. EstA is inserted in...the bacterial outer membrane where the N terminal domain is translocated...models. The approximate location of the OM core is indicated by horizontal...']"},{"machine":"BBa_J97003","videoId":"BBa_J97003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13K - [ Reporter,cds, cds, reporter, rfp, chassis, prokaryote, ecoli, function, reporter, fluorescence, legal, ip-free ] ['This part was created by DNA 2.0 as part of their IP Free series of...fluorescent and chromogenic proteins. It is available to use under the...DNA 2.0 created a poster to show how the parts were created which is available...creation of the Kit plate is summarized in the sections below....create the Kit plate is described in the figure to the left. Genes encoding...or PT5 promoters and fluorescent colonies were picked under various...Small copy.png https biobricks.org bpa contributions 62 This part was...']"},{"machine":"BBa_K141002","videoId":"BBa_K141002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13L - [ Coding,cds, membrane, transporter ] ['The uncoupling protein UCP 175 deleted is a proton carrier which is obtaines...UCP 175 deleted is a 33kd protein. The protein has a tripartite structure. The...structure displays an around 100 residues region which is three times...hydrophilic loop.The functional carrier unit is an homodimer....nuclear codification is the lack of the importation targeting to the...The second loop of the matrix is essential for the insertion of the protein in... second equation Galactose evolution Galactose is the metabolite which induces the thermogenin expresion....']"},{"machine":"BBa_J176037","videoId":"BBa_J176037","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13M - [ Protein_Domain ] []"},{"machine":"BBa_I732104","videoId":"BBa_I732104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13N - [ Coding ] ['affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....The sequence produce LRLd repressor protein which is based on natural lacR...added to both ends of this part for standard assembly....']"},{"machine":"BBa_K094100","videoId":"BBa_K094100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13O - [ Coding,cds, enzyme, phosphorylation, function, motility ] ['This part contains the cheZ operon coding region without an rbs nor a...terminator. cheZ protein is responsible for the dephosphorylation of cheY...']"},{"machine":"BBa_K1129050","videoId":"BBa_K1129050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 13P - [ Coding ] ['Cinnamoyl CoA reductase from Arabidopsis thaliana under arabinose promoter...ATCCR1 is a Cinnamoyl CoA reductase found in Artabidopsis thaliana it...enzyme belongs to the oxioreductase family and is involved in both the...were assembled into one PSB1C3 plasmid under constitutive promoters and...PSB1C3 under constitutive promoters alone. The last panel shows experimental...EncP 4CL and ATCCR1 gene construct under a constitutive promoter. The mass...']"},{"machine":"BBa_K197019","videoId":"BBa_K197019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14A - [ Coding ] ['The TypeIII secretion system TTSS is present in many pathogenic bacteria...such as E. Coli O157 H7 and is a mechanism of their virulence. Specifically ...EspA a subunit of the TypeIII secretion complex is a virulence factor...when the cells are lysed only the bound espA protein is released into...antibody conjugated to HRP is used to probe the blot for the his tagged espA....There is some detectable background as denoted by the slight signals in the...No detectable signal is present in the set of experiments run with only...']"},{"machine":"BBa_P10000","videoId":"BBa_P10000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14B - [ DNA ] ['LexA promoter with 5 UTR...']"},{"machine":"BBa_K1080012","videoId":"BBa_K1080012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14C - [ Coding ] ['reduction is essential for chlorophyllide a synthesis but can probably...the double bonds on GGPP. The final product is chlorophyll a . ...The plasmid is under the control of the lac...The N terminal of the sequence considered is M Met ....The instability index II is computed to be 31.02 This classifies the protein...']"},{"machine":"BBa_P10100","videoId":"BBa_P10100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14D - [ DNA ] []"},{"machine":"BBa_K196004","videoId":"BBa_K196004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14E - [ Coding ] [' Caulobacter crescentus is an aquatic Gram negative bacterium that divides...asymmetrically. Besides the bacterium is able to synthesize a strong glue....This glue is mainly composed of polysaccharide. Different proteins are...esterase. Here is the biobrick composed og the hfsG and hfsH genes....']"},{"machine":"BBa_P10001","videoId":"BBa_P10001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14F - [ DNA ] []"},{"machine":"BBa_K1051203","videoId":"BBa_K1051203","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14G - [ DNA ] ['One such sequence is known as the PEST sequence because short stretch of about...eight amino acids is enriched with proline P glutamic acid E serine S ...']"},{"machine":"BBa_P10002","videoId":"BBa_P10002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14H - [ DNA ] []"},{"machine":"BBa_K249008","videoId":"BBa_K249008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14I - [ Reporter ] []"},{"machine":"BBa_P10101","videoId":"BBa_P10101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14J - [ DNA ] []"},{"machine":"BBa_K883001","videoId":"BBa_K883001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14K - [ Device,viral_vectors ] ['CCMV wt coat protein under IPTG induced promoter... CCMV http 2012.igem.org Team Wageningen UR ModifyingtheCCMV is an...Particles http 2012.igem.org Team Wageningen UR VLPs VLPs . This part is...vitro using the Wageningen UR iGEM 2012 protocols. This part is provided for...the iGEM community so that they can use this part to produce these VLPs for...This part is made from the wild type CCMV coat protein. CCMV is the...abbreviation of Cowpea Chlorotic Mottle Virus and is a well studied black...eyed pea infecting virus. It is a virus in the family Bromoviridae and it is...procedures involved. Interest in this virus is especially in the ability to...In figure 1 it shows that with the protocol it is possible to form VLPs of the...strenghtening that this part is working and that the protocol is able to...is around 15 nm which is roughly the size of the radius of the wild type...CCMV is a virus that can be useful in nanotechnology this is because it is a...CCMV VLPs are renown for its wide pH stability. It is stable between a pH...range of 4.7 and 6.5. At a pH of 4.7 the CCMV is in it s unswollen form with a...radius of around 14 nm. At a pH of 6.5 it is in it s swollen form the VLPs...radius is around 15 16nm. It is possible to change form but change the pH...This part is isolated from a virus and when assembled will form particles...viral information is stored in this part and viral infection and or...replication can therefore be ruled out. It is completely safe for use in...']"},{"machine":"BBa_P10200","videoId":"BBa_P10200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14L - [ DNA ] []"},{"machine":"BBa_K364310","videoId":"BBa_K364310","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14M - [ Coding ] ['The ecdysone receptor is a nuclear receptor found in arthropods where it...The receptor is a non covalent heterodimer of two proteins the EcR protein...and ultraspiracle protein USP . It binds to and is activated by ecdysteroids....']"},{"machine":"BBa_P10400","videoId":"BBa_P10400","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14N - [ DNA ] []"},{"machine":"BBa_K1189007","videoId":"BBa_K1189007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14O - [ Coding ] ['Beta lactamase with His Tag under the control of the inducible lacI promoter...This part was built to allow for the extraction of Beta lactamase with the...inducible promoter J04500 with RBS....that we are expressing and purifying functional protein which is degrading the...protein is functional....from red to yellow. This is because there is phenol red a pH indicator added...Beta lactamase with His Tag under the control of the inducible lacI promoter...This part was built to allow for the extraction of Beta lactamase with the...inducible promoter J04500 with RBS....that we are expressing and purifying functional protein which is degrading the...protein is functional....from red to yellow. This is because there is phenol red a pH indicator added... lactamase gene under control of the inducible lacI promoter...expression is affected by different conditions. In our experiments we used two...plasmid with lactamase gene under control of the inducible lacI promoter...plasmid with lactamase gene under control of the inducible lacI promoter...under control of the inducible lacI promoter...under control of the inducible lacI promoter...provided by lactamase and resistance to Cm is provided by Cm resistance gene...inducible lacI promoter...plasmid with lactamase gene under control of the inducible lacI promoter...Amp than in the presence of only Cm or Amp. Gene expression is observed...without induction with IPTG due to promoter leakage. Figure...under control of the inducible lacI promoter...under control of the inducible lacI promoter...that the lacI promoter can be used without induction and expression can be...observed due to promoter leakage....corresponds to the lactamase gene regulated by an inducible lacI promoter....This Biobrick part is only functional in vivo and cannot be expressed with...lack of an appropriate promoter recognized by either T3 T7 or SP6...polymerase . Aiming to fit this part into our cell free system and make it...promoter with a T7 constitutive promoter...to regulate its expression just as the lacI promoter does we incorporated a...prove our improvement upon this part we used the chromogenic substrate...consists of a T7 promoter Pardee s Toehold Switch 32B 1 a lactamase gene...consists of a T7 promoter Pardee s Trigger 32B and a T7 terminator. These...sequence and also prove that it is able to reach the expression levels of the...substrate nitrocefin hydrolysis 490nm is divided by cell growth 600nm ...substrate nitrocefin hydrolysis 490nm is divided by cell growth 600nm ...that our improved part is not only functional in vivo but also in cell free... lactamase is not functional in vitro and cannot be expressed with our in...kits due to the lack of an appropriate promoter recognized by either T3 T7 ...']"},{"machine":"BBa_P10401","videoId":"BBa_P10401","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 14P - [ DNA ] []"},{"machine":"BBa_K763004","videoId":"BBa_K763004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15A - [ Reporter ] [' 1. The transcription factor binding site inside the promoter ... 2. The repressor binding site inside the promoter and ... 3. the coding sequence which contains a synthetic fluorescent green protein. The promoter was taken from the recA gene of E. coli which participates in the orchestrated bacterial SOS response 1 that involves more than forty independent SOS genes most of which encode protein sengaged in protection repairing and replication regulate our construction. ...When is the protein synthesized In order to obtain the green fluorescent...protein one condition should be met. Since there is a repressor lexA that...blocks any possible transcription it is needed to UV irradiate the cells to...The molecular mechanism underlying this phenomenon is as follows when a...and a positive regulator of the SOS response RecA . The idea is that UV...irradiation promotes LexA autocatalytic activity and RecA is activated. Then ...LexA will not be able to bind to the promoters SOS boxes or LexA boxes and...transcription will start here is our construction with the protein we want ....The process is relatively slow reaching higher values of expression more than...promoter and then we have inserted a GFP sequence. Then after irradiating we...the ZsGreen1 gene under the control of the lexA promoter was grown on LBA LB...INDUCED PROMOTER of lexA promoter although lethal effects were observed...']"},{"machine":"BBa_K777001","videoId":"BBa_K777001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15B - [ Composite,chassis, prokaryote, ecoli, promoter, anderson, regulation, constitutive ] ['Tar receptor under the control of constitutive promoter J23100...Anderson promoters. Activity according to Berkeley 2006 ...according Anderson promoters. Our data were compared to the activity of the...promoters that can be found on the main page of Anderson...This part can be used for chemotaxis assays.... Here is the complete sequence of this part as an ApE file http 2012.igem.org wiki images f fc Tar receptor under the control of constitutive promoter.zip .... Fig. 2 Promoter comparison through a chemotaxis assay....The different promoter constructs K777001 K777008 were all tested for...chemotaxis towards aspartate Fig. 2 . Eight promoters of the Anderson ...correspond to the promoter activities reported by the Berkley University in...promoters J23100 x2547 and J23104 x1831 had a slightly bigger radius than...the other promoter constructs. In addition slight chemotaxis could be...during the application and is therefore not evaluable. B The constructs...halo size did not vary strongly. The halos of the strongest promoters J23100 ...showed the smallest radius although this promoter has the third stronges...Here we mutated this part at in total 5 amino acid sites which are important...same respective chemicals this is evidence for a functional part. ...The improved BioBrick K1992004 contain the promoter J23100 a strong RBS...promoter RBS Tar receptor and terminator.... promoter anderson ...positive regulators J23100 constitutive promoter protein Tar...']"},{"machine":"BBa_P0455","videoId":"BBa_P0455","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15C - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K112624","videoId":"BBa_K112624","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15D - [ Coding ] ['This part is assembled with pBad promoter rbs.pelB pelB prepro with native...This part is in BBb Format. It is flanked by BamHI and BglII sites instead of...XbaI and SpeI. More information about the BBb Format is available at ...']"},{"machine":"BBa_K1149035","videoId":"BBa_K1149035","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15E - [ Coding ] []"},{"machine":"BBa_K1088005","videoId":"BBa_K1088005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15F - [ Coding ] ['This sequence is a copy of the sequence 70 387 71 265 from E. coli K 12...MG1655 which is the coding sequence of the pBAD repressor araC.... The arabinose regulator AraC is a transcription factor that regulates...Transcription of these operons is induced when E. coli is grown in the...promoter devices with and without this regulatory device were assayed....to be necessary for expression control of the arabinose promoter. B Northern...We haven t tested if the lack of improvement is due to a fault in the design...so that no AraC is expressed. Instead we have tested devices of similar design...']"},{"machine":"BBa_K283005","videoId":"BBa_K283005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15G - [ Coding,classic, generator, prc, function, reporter, fluorescence ] [' visit our wiki for further information .This part does not pose any...']"},{"machine":"BBa_K141003","videoId":"BBa_K141003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15H - [ Coding,cds, membrane, transporter ] ['The uncoupling protein UCP 76 deleted is a proton carrier which is obtaines...UCP 76 deleted is a 33kd protein. The protein has a tripartite structure. The...structure displays an around 100 residues region which is three times...hydrophilic loop.The functional carrier unit is an homodimer....nuclear codification is the lack of the importation targeting to the...The second loop of the matrix is essential for the insertion of the protein in...That protein is without direct regulation and its generation time depends on... second equation Galactose evolution Galactose is the metabolite which induces the thermogenin expresion....']"},{"machine":"BBa_K592012","videoId":"BBa_K592012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15I - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['The color is slightly weaker than RFP. On agar plates and in liquid culture ...the color is readily visible to naked eye in less than 24 hours of incubation.... Important This part is not available in the registry yet however the same...part is available from the registry with the RBS...This part is useful as a reporter....Peking iGEM 2016 has fused this part with triple spytag. The fused protein is...An improved part has been constructed. Since this part is a coding sequence ...we added a RBS which is on the upstream of sfGFP...following the constitutive promoter J23119 to achieve further control of...IPTG concentration under the regulation of the lac T7 promoter....correct the molecular mass of eforRed protein is about 27kDa and more...chromoprotein. The predicted molecular mass of this protein is about 27kDa ...and the exact size is 27306.3Da the value of the highest peak is shown as the...']"},{"machine":"BBa_I732109","videoId":"BBa_I732109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15J - [ Coding ] ['sequence which is the composition of amino acid of recognition helix Figure...I . Standard BioBrick Prefix and Suffix are added to both ends of this part... This artificial lac repressor can bind to the specific promoters with high affinity while weakly bind to other promoters with relatively low affinity. The repression intensity is indicated in the Repression Matrix shown as below. How to acquire this repressor and how to obtain Repressor Promoter pairs will been shown in This Page http 2007.igem.org USTC Repressor Evolution on Plates . ...affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....']"},{"machine":"BBa_J06701","videoId":"BBa_J06701","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15K - [ Reporter,classic, reporter, ret ] []"},{"machine":"BBa_K929202","videoId":"BBa_K929202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15L - [ Coding ] ['Epidermal growth factor receptor EGFR also known as HER1 or ErbB1 is a...periplasm where it is cleaved by the membrane anchored peptidase. Generated...Sortase is an enzyme which catalyzes specific ligation of two proteins to each...his tag is used to purify the expressed Protein EGFR in E. coli....']"},{"machine":"BBa_K091109","videoId":"BBa_K091109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15M - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] ['LuxS is a synthase that produces DPD which spontaneously forms the AI 2...S ribosylhomocysteine lyase EC 4.4.1.21 is a metalloenzyme that cleaves the...foundation of edible vaccines. This part was used for the second goal ...treatment of the project FlavoFlow. This part if for... S ribosylhomocysteine lyase is involved in the synthesis of autoinducer 2...expression mechanisms are regulated corresponding to cell density is called...studies show that S ribosylhomocysteinase is coded by the highly conserved... luxS gene and is present in the majority of bacteria 2 . LuxS protein...Autoinducer 2 is proposed to be a universal bacterial communication molecule 3...unlike the AI 1 which is species specific. E. coli has a set of genes...metal ion is tetrahedrally coordinated by the side chains of histidines 54 and...ligand environment is very similar to that of peptide deformylase. LuxS enzyme...that determines reaction velocity is calculated using different substrate...methods to achieve our goal. It was found that there is a possibility to...eqn. 1 is in the form of equation 2 1....Here S substrate concentration Vmax is the limiting rate under...saturation conditions Km is Michaelis constant v is velocity of the reaction...Lambert W function is a multivalued transcendental equation which has...TNB dependence on reaction time is depicted in Figure 2....using different substrate concentrations. Also there is a possibility to...substrate concentration though further proof is required....']"},{"machine":"BBa_K173003","videoId":"BBa_K173003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15N - [ Generator ] ['reported in literature is also able to work in the opposite direction ...']"},{"machine":"BBa_K133055","videoId":"BBa_K133055","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15O - [ Reporter,function, reporter, fluorescence ] ['mCherry is a red fluorescent protein used for analysis of localisation of...']"},{"machine":"BBa_K141000","videoId":"BBa_K141000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 15P - [ Coding,cds, membrane, transporter ] ['Ucp1 is a gene which encodes for UCP1 protein....The uncoupling protein UCP1 is a proton carrier characteristic of brown...UCP1 is a 33kd protein which is exclusively located in the brown adipocites....It is an integral protein present in inner mitocondrial membrane....residues region which is three times repeated. Each part encodes for two...unit is an homodimer....codification is the lack of the importation targeting to the mitochondria in...The second loop of the matrix is essential for the insertion of the protein in... second equation Galactose evolution Galactose is the metabolite which induces the thermogenin expresion....']"},{"machine":"BBa_I757011","videoId":"BBa_I757011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16A - [ Coding ] []"},{"machine":"BBa_P10303","videoId":"BBa_P10303","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16B - [ DNA ] []"},{"machine":"BBa_K098997","videoId":"BBa_K098997","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16C - [ Coding ] ['that loses binding efficiency with the cI promoter between 35 and 42 degrees...for sequencing at GATC and this is the result ...were red thanks to the mRFP. So in conclusion we could use this part as a...gene reporter to show that clts is present pSB1C3....mRFP expression is meant to be regulated by the cI857 repressor and expressed...']"},{"machine":"BBa_P10305","videoId":"BBa_P10305","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16D - [ DNA ] []"},{"machine":"BBa_K608016","videoId":"BBa_K608016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16E - [ Measurement ] ['medium promoter and strong RBS with RFP...This part consists of a medium promoter with strong RBS PR4 and tagged with...which is a multi mode microplate reader. Samples were pipetted into the...the protein concentration with the bradford assay. This is a method to...bound Coomassie dye is 595nm. The absorbance is proportional with the amount... marker because the concentration of BSA is known and with a linear...With RFP Red Fluorescence Protein the activity of promoter and RBS can be...level. RFP is excited at a wavelength of 580nm. The more RFP in the solution...the more is the RFP fluorescence intensity.The plate reader illuminates the...create the exact wavelength. The more RFP in the sample the higher is the RFP...fluorescence intensity. The intensity is collected with the second optical...system and is detected with a side window photomultiplier tube....RFP fluorescence intensity dependent on the strenght of promoter and RBS... Promoter and RBS ...PR1 strong Promoter J23104 strong RBS B0034 ...PR2 strong Promoter J23104 medium RBS B0032 ...PR3 strong Promoter J23104 weak RBS B0031 ... PR4 medium Promoter J23110 strong RBS B0034 ...PR5 medium Promoter J23110 medium RBS B0032 ...PR6 medium Promoter J23110 weak RBS B0031 ...The results of this test show that PR4 is 14.1 times stronger than PR6. The...repeat this experiment. We have also tested the promoter and RBS activity with...']"},{"machine":"BBa_P10306","videoId":"BBa_P10306","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16F - [ DNA ] []"},{"machine":"BBa_K566015","videoId":"BBa_K566015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16G - [ Composite ] ['Composite part for Biphasic switch tests. Include pRM promoter from phage ...pRM promoter from Lambda phage. It may be positively and negatively regulated...']"},{"machine":"BBa_P10003","videoId":"BBa_P10003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16H - [ DNA ] []"},{"machine":"BBa_K801080","videoId":"BBa_K801080","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16I - [ Coding,cds, cds, biosynthesis, chassis, eukaryote, yeast ] ['The BioBricks contains the coding region for Prepro Thaumatin that is believed...Thaumatin is a natural protein which is synthesized by the katamfe plant...Thaumatin is a single chain with 207 amino acids residues and eight...disulfide bonds and a molecular weight of 22.2 kDa . It is highly water...acidic conditions. The production of thaumatin is induced by an attack upon...the plant by viroid pathogens. Thus it is involved in systematically acquired...The general idea is to create via genetic engineering of Saccharomyces...precursor preprothaumatin . The N terminal pre part is the internal...that the pre sequence is necessary for the correct procession Ide et al. ...The sweet taste receptor is a heterodimeric receptor composed of T1R2 ...in the taste buds is induced Ide et al. ...decrease in the intracellular cAMP accumulation is measured. Released calcium... The SDS PAGE performed from the reference and the fractions 12 to 15 showed a weak band at the height of the reference. This band having the same size as the reference see running properties on SDS PAGE in figure D and the same isoelectric point both eluted in fraction 14 is very likely to be thaumatin which was produced by the yeast cells....']"},{"machine":"BBa_P10402","videoId":"BBa_P10402","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16J - [ DNA ] []"},{"machine":"BBa_K1051500","videoId":"BBa_K1051500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16K - [ Coding ] [' Sic1 a protein is a stoichiometric inhibitor of Cdk1 Clb B type...prevents premature S phase entry.Multisite phosphorylation of Sic1 is thought...promoter the cells will stop at late G1 and the cell becomes larger than the...the degradation. This is the version with stop codon. ...']"},{"machine":"BBa_P10201","videoId":"BBa_P10201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16L - [ DNA ] []"},{"machine":"BBa_K899011","videoId":"BBa_K899011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16M - [ Composite ] [' Results br The data is given in a table table 1 and can also be seen...plotted on a logarithmic scale figure 1 . Hour nr. 7 is left out because it...As you can see clearly SST is decreasing the growth rate of the bacteria....This is most likely because SST produces an indigestible polysaccharide from...disadvantages concerning growth. This is probably because FFT produces a...1 kestose from sucrose that the bacteria is able to digest. br br ...SST is decreasing the growth rate of E. coli Top10 but FFT does not. br br ...The goal of this experiment is to test the inulin production of our bacteria... This method is purely developed by the students and has been based on...The idea of this method is to crystallize inulin by adding ethanol. This...experiment twice. The negative is less stained than the positive throughout...the experiments. Also the FFT is mostly more powerful in color than SST. ...inulin added FFT SST. First 2 rows is the first round third and fourth row...Also the FFT sample is slightly more colored than the SST sample. This could...correct we can conclude that FFT is producing a small amount of inulin most...']"},{"machine":"BBa_P10202","videoId":"BBa_P10202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16N - [ DNA ] []"},{"machine":"BBa_K404111","videoId":"BBa_K404111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16O - [ Project,function, celldeath ] ['mutant E72Q D103N is a functional adenylate kinase. Protein engineering ...']"},{"machine":"BBa_P10300","videoId":"BBa_P10300","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 16P - [ DNA ] []"},{"machine":"BBa_I9200","videoId":"BBa_I9200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17A - [ Coding,cds ] ['Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K362004","videoId":"BBa_K362004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17B - [ Regulatory ] ['sodA promoter is controlled by some transcription factors including SoxS.... sodA promoter is controlled by some transcription factors including SoxS....']"},{"machine":"BBa_K133046","videoId":"BBa_K133046","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17C - [ Coding,cds, function, immunology ] ['This is a part that is composed of C terminal end of chimeric flagellin...Chimeric flagellin is composed of C and N terminal part of E.coli flagellin...This part was used in combination with CF213 chimeric flagellin...']"},{"machine":"BBa_I732103","videoId":"BBa_I732103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17D - [ Coding ] ['affinity of different repressor candidates with various specific promoters by...appear. While the lighter the blue is the weaker the repression will show....The sequence produce LRLc repressor protein which is based on natural lacR...added to both ends of this part for standard assembly....']"},{"machine":"BBa_K133016","videoId":"BBa_K133016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17E - [ Coding,cds, function, immunology ] []"},{"machine":"BBa_K899001","videoId":"BBa_K899001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17F - [ Coding,chassis, prokaryote, ecoli, Kit plates, probiotics, production ] ['This part is the coding sequence for Fructan Fructan 1 Fructosyltransferase...the same as this part but with a double RBS containing both the shine ...']"},{"machine":"BBa_K592010","videoId":"BBa_K592010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17G - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['exhibits strong yellow color when expressed. The color is readily visible to... Important This part is not available in the registry yet however the same...part is available from the registry with the standard RBS...This part is useful as a reporter....Peking iGEM 2016 has fused this part with triple spytag. The fused protein is...An improved part has been constructed. Since this part is a coding sequence ...we added a RBS which is on the upstream of sfGFP...following the constitutive promoter J23119 to achieve further control of...This part was characterized by the iGEM Bulgaria 2018 team. We cloned this...promoter and strong RBS . Additionally similar constructs with amilCP cjBlue ...a strong promoter and on a high copy number vector. We also measured its...colour device and a pSB1C3 vector with an AmilGFP CDS without promoter and...vector value of 1.00 . The growth rate of pSB1C3 Amil GFP is 0.52 and the...pSB1C3 mRFP red colour device not with a strong promoter has a value of...This part was characterized in the measurement of amilGFP s absorption and...chromoprotein we cloned this part downstream T7 promoter on pET21 vector and...absorption peak is 502 nm and the emission peak was at 512 nm. Figure 3 ...The fluorescence intensity of fluorescent protein is related to protein...expression. The protein expression level is related to the culture time and...protein is also related to excitation and emission spectra. We designed...containing 5 ml LB which is called 0h. At the same time we also inoculated...culture bacterial cells at 37 C 220 rpm. The sampling time point is 24h....microplate reader. Total fluorescence is divided by OD600 to obtain...To assess whether glucose is affecting the formation of amilGFP two...']"},{"machine":"BBa_K116401","videoId":"BBa_K116401","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17H - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive ] ['external phosphate sensing promoter...promoter of phoB in E.coli an external phosphate regulated promoter which can... promoter ...']"},{"machine":"BBa_K1185001","videoId":"BBa_K1185001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17I - [ Reporter,chassis, prokaryote, bsubtilis, classic, reporter, function, reporter, fluorescence ] ['fluorescent protein sfGFP . HBsu is a non specific DNA binding protein that...binds to DNA as a homodimer. The HBsu is joined to the sfGFP through ten amino...and amp for E.coli and also contains lacI lacZ and Pspac promoter which is...an IPTG induced promoter which regulated the transcription of this BioBrick....An alternative method to use this part would be to clone this BioBrick out and...use any Assembly protocol to attach a desired promoter RBS and antibiotic...control. There is no colonies on the negative control plate Plate 3 ...To gain evidence that our BioBrick is actually binding to DNA we stained the...HBsu sfGFP at 560nm suggesting that the HBsu RFP is binding to the B.... 0.8mM is an inadequate time span to elicit visible HBsu sfGFP expression....After 30minutes there is a marked increase in expression of HBsu sfGFP in... Micka B. Marahiel M. 1992. The DNA binding protein HBsu is essential for...']"},{"machine":"BBa_J36846","videoId":"BBa_J36846","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17J - [ Composite ] ['NOTE ABOUT THE SEQUENCE The mixed site between parts is only six base...pairs ACTAGA. There is no spacer T or G nucleotide. These spacer nucleotides...']"},{"machine":"BBa_K157004","videoId":"BBa_K157004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17K - [ Protein_Domain,chassis, eukaryote, function, reporter, proteindomain, binding, proteindomain, internal ] ['engineered variant of this anticalin which is also compatible to RFC 10 and...']"},{"machine":"BBa_K317030","videoId":"BBa_K317030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17L - [ Device ] ['this part is chimeric protein of the enzyme relating propandiol metabolize and...green fluorescent protein. this part was localize to BMC....']"},{"machine":"BBa_J176006","videoId":"BBa_J176006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17M - [ Coding ] []"},{"machine":"BBa_K625000","videoId":"BBa_K625000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17N - [ Translational_Unit ] ['LacIM1 Bba K625000 is a LacI variant with the same protein sequence as the...promoters without recombination happening between them. This feature can be...BioBrick by adding a lac dependent GFP reporter. A tet promoter was put in...In the non induced state of the system lacI M1 expression is repressed and...the cells produce GFP. If anhydrotetracycline is added TetR is released from...Ptet and LacI is produced. LacI inhibits gfp transcription and the...anhydrotetracycline. This indicates that LacIM1 is induced and thus represses...supposing that the expression of lacI M1 is fully induced at this level and...thus the IPTG amount present in the system is not sufficient anymore to...In the case where no anhydrotetracycline is present in the medium there can...systems. The reason for this is likely due to the leaky expression of the...']"},{"machine":"BBa_K389002","videoId":"BBa_K389002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17O - [ Coding,cds, transcriptionalregulator, activator, chassis, prokaryote, ecoli, classic, signalling, receiver, function, regulation, transcriptional ] ['This is the virG response regulator from the VirA G receptor system. The...virA G receptor system is used by Agrobacterium tumefaciens to detect...presence of these substances VirG is activated by the VirA receptor and...induces the transcription of genes under the control of a vir promoter....to work in Escherichia coli but this virG BioBrick is mutated so it works...Because this BioBrick is synthesized Mr.Gene GmbH codon usage is optimized... vir promoter...']"},{"machine":"BBa_I742113","videoId":"BBa_I742113","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 17P - [ Composite ] []"},{"machine":"BBa_K316012","videoId":"BBa_K316012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18A - [ Coding ] ['TEV protease S219P autocatalysis resistant variant. This part had been...This is the nuclear inclusion protease endogenous to Tobacco Etch Virus and...recognition sequence is ENLYFQG S 1 between QG or QSDue to it s stringent...sequence specificity TEV is commonly used to cleave genetically engineered...TEV proteinase is used to cleave fusion proteins. It is useful due to its high...the protein. The rate of inactivation is proportional to the concentration of...']"},{"machine":"BBa_P10304","videoId":"BBa_P10304","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18B - [ DNA ] []"},{"machine":"BBa_K398018","videoId":"BBa_K398018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18C - [ Coding ] [' Figure 1 Complete Alkane degradation pathway ADH is the 2nd step herein...This part was characterized using NAD NADH enzyme assay. By disrupting the...']"},{"machine":"BBa_P10302","videoId":"BBa_P10302","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18D - [ DNA ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K404319","videoId":"BBa_K404319","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18E - [ Project,function, reporter ] ['proteins from jellyfish Aequorea macrodactyla. mCyan is an enhanced version of...the cyan flourescent protein. The cyan spectral region is from 470 up to 500...used as gene of interest in the vector plasmid. In this content it is able to...']"},{"machine":"BBa_P10301","videoId":"BBa_P10301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18F - [ DNA ] []"},{"machine":"BBa_K763003","videoId":"BBa_K763003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18G - [ Reporter ] [' 1. The transcription factor binding site inside the promoter and ... 2. the coding sequence which contains a synthetic fluorescent yellow protein. We chose as the promoter sequence the one of the glnA gene. There is long evidence that this promoter is regulated by nitrogen concentration 1 . Moreover the promoter is not the canonical one sigma70 but an alternative one sigma54 2 3 . ...When is the protein synthesized In order to obtain the yellow fluorescent...protein a condition should to be met. That condition is related to nitrogen ...The molecular mechanism underlying this phenomenon is as follows in gram ...under the control of the glnA promoter was grown on LBA medium until an OD of...REGULATED PROMOTER nitrogen starvation induces the expression of the...']"},{"machine":"BBa_P10004","videoId":"BBa_P10004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18H - [ DNA ] []"},{"machine":"BBa_K1080011","videoId":"BBa_K1080011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18I - [ Coding ] ['The chelation of magnesium in protoporphyrin IX is dependant on several genes....function of ChlI1 is well known and documented. The second isoform ChlI2 is...The plasmid is under the control of the lac...']"},{"machine":"BBa_P10500","videoId":"BBa_P10500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18J - [ Other ] ['This is the universal acceptor plasmid for creating new PhytoBricks parts. It...This sequence is contained within the BioBricks vector pSB1C3.... Marburg 2018 improved this part...chassis for cloning we investigated if the wild type strain is compatible...Our part not only suits for V. natriegens but is convenient for the...without the use of UV light and is just or even more distinguishable from the...can be saved and the risk of not functional plates for selection is decreased....clones from non is feasible for strains which are not compatible with blue ...']"},{"machine":"BBa_K554006","videoId":"BBa_K554006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18K - [ Coding ] ['QseC is QseB Clarke et al 2006 and the genes encoding this two component...producing and secreting IL 12. The QseC is essential to the functioning of...this device since it is responsible for the sensing the levels of CAs and...AI 3 activation of the response regulator QseB which is the transcription...binding to flhDC promoter being the...solved by X ray crystallography at 2.5 A resolution. This is a jmol applet in...']"},{"machine":"BBa_K542000","videoId":"BBa_K542000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18M - [ Intermediate ] ['Lumazine Synthase with Transciptional Terminator No Promoter ...Since this part is lacking the promoter Lumazine Synthase production may be...regulated by the addition different promoters upstream. Regulation of Lumazine...Synthase will be dependent on the promoter being utilized. ...This part was characterized in...']"},{"machine":"BBa_J04051","videoId":"BBa_J04051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 18O - [ Reporter,function, reporter ] []"},{"machine":"BBa_K339007","videoId":"BBa_K339007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19A - [ Reporter ] ['cpxR promoter upstream of an RFP generator....This part was used in order to characterixe the cpxR promoter specifically...which act to correct the misfolding agent. There is also a new regulon that is...periplasmic regulon found in E. coli is the Cpx regulon. Cpx pathway is...periplasmic heat shock pathway. The Cpx pathway is activated by factors which...pathway is activated by misfolded proteins or excessive protein concentration...CpxP protein is docked on CpxA transmembrane protein. In the presence of...CpxR is a transcription factor that is generally dephoshorylated inactive...CpxR is phosphorylated by CpxA which autophosphorylates itself and also has...kinase activity towards CpxR. The phosphorylated CpxR then binds to promoter... Characterization of the cpxR promoter s response to folding and misfolding...promoter in cpxR reporter competent cells Unversity of Calgary 2010 ...Arabinose inducible promoter I0500 coupled with standard ribosome binding...different levels of arabinose. Figure 1 shows that CpxR I13507 is activated at...the highest level when MalE31 the periplasmic misfolder is expressed. This...case of MalE which is a periplasmic folder. MalE and MalE31 activate the...the line of best fit is studied it is seen that MalE has very minimal level...could mean that the MalE31 is activated at levels that saturate the cellular...and chaperone activities. Another interesting pattern observed is the fact...that when MalE is constructed with CpxR I13507 on the same plasmid Green ...the cell RFP output is much lower compared to cells co transfected with... Characterization of the cpxR promoter s response to varying temperatures over...stress. When the system is placed at 42 C the RFP output is much higher at t 0...steeper slope. This indicates that the system is being stressed and it...produces its downstream product which is RFP in this case and DegP and other...again because it is still under heat shock stress. But if the cell was placed...']"},{"machine":"BBa_J06803","videoId":"BBa_J06803","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19B - [ Inverter,classic, inverter, uncategorized ] []"},{"machine":"BBa_J97000","videoId":"BBa_J97000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19C - [ Reporter,cds, cds, reporter, cfp, chassis, prokaryote, ecoli, function, reporter, fluorescence, legal, ip-free ] ['This part was created by DNA 2.0 as part of their IP Free series of...fluorescent and chromogenic proteins. It is available to use under the...DNA 2.0 created a poster to show how the parts were created which is available...creation of the Kit plate is summarized in the sections below....create the Kit plate is described in the figure to the left. Genes encoding...or PT5 promoters and fluorescent colonies were picked under various...Small copy.png https biobricks.org bpa contributions 62 This part was...']"},{"machine":"BBa_K500001","videoId":"BBa_K500001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19D - [ DNA ] ['so far studied. The catalytic cycle of MnP is similar to that of other plant... Pichia pastoris under the control of the AOX1 promoter...is controlled by the AOX1 promoter and is cloned in frame to an N terminal...']"},{"machine":"BBa_K1031803","videoId":"BBa_K1031803","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19E - [ Reporter,chassis, prokaryote, ecoli, function, reporter, fluorescence, rbs, prokaryote, constitutive, terminator, double ] ['For detailed information concerning XylR and Pu promoter please visit 2013... Promoter structure ... Pu promoter which is activated by XylR is 54 dependent. It is composed of...three elements. The UBS Upstream Binding Site site which is responsible for... http igem.org wiki images thumb 1 16 Peking2013 part XylR promoter.png 800px ...Peking2013 part XylR promoter.png ... Figure.1 Structure of Pu promoter. The UAS of this promoter shown as...blue sequence in the blue frame interacts with DmpR. IHF binding site is shown...XylR is an intensively studied regulatory protein mined from Pseudomonas...weakly to 3 methyl benzyl alcohol 1 . XylR activates the Pu promoter to... . It also activates the Ps1 i promoter thus to produce another... Fig.2 Fig.3 . Notably the entire regulatory network is also controlled...cluster XylS and XylR. XylR is the master regulator that regulates Pu ...promoter controls upper pathway XylMABC and Ps2 promoter controls...The XylR protein consists of FOUR domains Fig.4 Domain A is the...affinity of Domain C before the conformational change 4 5 . Domain B is a...Domain C is the effector binding domain with ATPase activity that is crucial...for XylR dimerization. A subdomain in domain C is assumed to account for the...dimerization. Domain D is the DNA binding domain featured by helix turn helix...motif whose DNA binding is sequence specific....XylR is capable of forming tetramer when bound with ATP 7 . Without ATP...of XylR tend to further cooperatively tetramerize thus to bend the promoter...transcription activation at the Pu promoter....As discussed above the XylR Pu pair usually needs fine tuning. Promoter...engineering is considered to be an answer. A XylR conrolled Pu promoter shows...a high basal level. But the cognate promoter of XylR homolog DmpR has a...fairly low basal level. We found that XylR could activate the Po promoter of...DmpR. A hybrid promoter has been accordingly designed using the binding site...of XylR from the Pu promoter. This design has shown that the basal level of...the hybrid promoter is low and the XylR binding affinity is high 12 .... Pc promoter J23114 is selected to initiate the transcription of XylR. Based...level of reporter gene sfGFP. K1031803 consists of Pu promoter RBS B0031 and...arrow represents Pu promoter for XylR. The green oval stands for RBS...B0031. sfGFP coding sequence is shown with dark blue while terminator...constitutive promoters Pc to control the expression level of XylR. We...previous studies indicated that the expression level of XylR is critical for...its regulatory performance on Pu promoter. Results showed that the XylR...which is probably due to the vaporization of hydrophobic aromatic compounds ...As shown in Fig.7 the performance of XylR is quite different from the...integration host factor site of the 54Pu promoter of Pseudomonas putida by in...']"},{"machine":"BBa_K500003","videoId":"BBa_K500003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19F - [ DNA ] ['chrysosporium. Synthetized by Geneart Glyoxal oxidase GLOX is an...']"},{"machine":"BBa_K133139","videoId":"BBa_K133139","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19G - [ Coding ] []"},{"machine":"BBa_K390501","videoId":"BBa_K390501","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19H - [ Composite ] ['LacPromoter RBS PhaP HlyA Terminator...This is a composite part that was created to allow us to test the...individual part pages. The lac promoter was used....NOTE The scar between the protein and the signal peptide is not presented...correctly in the sequence below. The scar is the Silver fusion scar ACTAGA ...targeting signal peptide sequence is genetically fused to the phasin protein...phasin with PHA is required for secretion based granule recovery because PHA...intensity of the 1H NMR spectra indicate that PHA is released into the...extracellular media when HlyA targeted phasin is expressed....The bottom spectrum reports PHA in the negative control that is producing PHA...n a LacPromoter RBS PhaP HlyA Terminator...']"},{"machine":"BBa_K1051001","videoId":"BBa_K1051001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19I - [ Reporter ] []"},{"machine":"BBa_K091137","videoId":"BBa_K091137","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19J - [ Generator ] ['This part was made by ligating I13025 to B0015....']"},{"machine":"BBa_K864402","videoId":"BBa_K864402","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19K - [ Composite ] ['eforRed eforRed is previously described as...eforRed in UV light. The right picture is a pellet of BL21 DE3 in white... Figure 2. Colonies in the same host as previously is presented in white... Figure 3. To the left is a spectrometry experiment of BL21 s DE3 protein...the one on the right side is E.coli BL21 DE3 with a different expression...corresponds to the molecular weight of eforRed which is 26.1 kDa.... Note This part did not have a reference sequence. A reference sequence...']"},{"machine":"BBa_J04671","videoId":"BBa_J04671","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19L - [ Reporter,function, reporter ] ['This is an EYFP coding sequence plus a LVA tag and the Terminator Sequence...']"},{"machine":"BBa_S03271","videoId":"BBa_S03271","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19M - [ Coding,cds ] []"},{"machine":"BBa_K676002","videoId":"BBa_K676002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19N - [ Device ] ['with mNark promoter and enhanced YFP with LVA tag. This device is an improved...A very common issue faced in industrial grade bioreactor fermentations is the...presence of dead spots inside the fermenter vessel where oxygen is not...the presence of hypoxic regions is inevitable and cannot be detected always by...have showed that NarK protein expression in E. coli is upregulated 100 fold... 1 . Therefore the Nark promoter can essentially be used as a sensory tool for...Since then the nark promoter sequence has been studied and is now known to...binding sites that initiate transcription from the promoter by sigma factor...70. The chief protein in this sensory pathway is Fnr which is always present...oxygen the 4Fe 4S 2 cluster of Fnr monomer is oxidised to a 2Fe 2S 2 ...But in the absence of oxygen the 4Fe 4S 2 cluster is retained and the Fnr...promoter is slightly different from the consensus region and therefore has a...lower affinity for Fnr. For this reason a modified NarK promoter sequence was...the final mNark promoter sequence is shorter and has a better affinity for...Also this device is an improved and modified version of...']"},{"machine":"BBa_K315014","videoId":"BBa_K315014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19O - [ Coding ] ['This sequence is the wild type TetA gene which has been optimized from base...pairs 1 to 141. This is a basic part that can be placed behind a promoter and...']"},{"machine":"BBa_K274370","videoId":"BBa_K274370","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 19P - [ Composite ] ['PoPS P2 ogr PF promoter PoPS...']"},{"machine":"BBa_M36042","videoId":"BBa_M36042","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20A - [ Coding ] ['This is the reconstructed gene for the EfeU iron transporter. This gene is...']"},{"machine":"BBa_I20270","videoId":"BBa_I20270","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20B - [ Measurement ] ['Promoter MeasKit J23151 ...J23151 inserted in the Promoter MeasKit...I20270 serves as the positive control for the iGEM InterLab study. It is in...']"},{"machine":"BBa_K331033","videoId":"BBa_K331033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20C - [ Intermediate ] ['under the control of a tetracycline repressible promoter...tail is indeed causing the protein to which it is attached to localize within...chose is CFP as the donor and yellow fluorescent protein YFP as the...tetracycline repressible promoter...occurring at approximately 510 nm is consistent with results obtained by...']"},{"machine":"BBa_R0040","videoId":"BBa_R0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20D - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, negative, rnap, prokaryote, ecoli, sigma70 ] ['TetR repressible promoter...Sequence for pTet inverting regulator. Promoter is constitutively ON and...repressed by TetR. TetR repression is inhibited by the addition of...Medium strength promoter. jb 5 24 04 ... In contrast to tetracycline anhydrotetracycline is a particularly useful... antibiotic activity is 100 fold lower and concentrations of 50 ng ml as...University of Groningen has improved the pTet promoter in E. voli using a...R0040 is a highly characterized part and many teams before have already...ptetR is determined by the expression and combination on particular promotor...explicating how the expression level of tetR influence ptetR is essential to...to set up gradient for tetR expression. Since the best inducer aTc is not...accessible to us tetracycline is chosen as an alternate. Besides a GFP...tetracycline of different concentration by time is plotted....As a well characterized promoter PtetR has been studied thoroughly with its...expressing system here we take a unique idea to created a new promoter fusion...to create a new promoter that are regulated by tetracycline while with a...desired expression intensity. It is a fusion of tetO operon and the 35...upstream 35 10 parts 10 downstream of the stronger PL promoters in lambda...phages to create a improved promoter with proper expression level while... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many... promoter ...']"},{"machine":"BBa_K1051259","videoId":"BBa_K1051259","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20E - [ Measurement ] ['The K1051208 is the improvement of M0052. See more about M0052 at...as positive control because of the same promoter and fluorescent protein. ...']"},{"machine":"BBa_J364000","videoId":"BBa_J364000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20F - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 1 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...the GFP is used as the reporter gene. So other teams who have the need of...Ice nucleation protein INP is a secretory outer membrane protein from...result is consistant with fact that we found in the literature 2 that the... 1. We improved this part. GFP is an intracellular reporter gene and we achieved the expression of GFP on the surface of E.coli. ... 2. Based on the current results there is space for further improvement in the efficiency of system expression and the key point is that the activity of INPNC needs to be improved....']"},{"machine":"BBa_K349003","videoId":"BBa_K349003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20G - [ Coding ] ['This is the RFP BbsI BA Base Plasmid v.2 for the construction of components of...This plasmid is a useful tool for creating BA Bytes in compliance with the...cassette is reinserted or white if the part of interest is inserted . This...This data demonstrates that the RFP cassette itself is functional and that...']"},{"machine":"BBa_J364001","videoId":"BBa_J364001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20H - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 2 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...aim is to convert relative fluorescent values to absolute units using the...']"},{"machine":"BBa_K531007","videoId":"BBa_K531007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20I - [ Composite ] ['PrsaA constitutive promoter esp optimized for Caulobacter and rsaA ...PrsaA constitutive promoter from Caulobacter crescentus esp a...growth is calculated by subtracting the ODmean of S. aureus only treatment...Esp which is known to target S. aureus biofilm specifically has a better...inhibition effect than DspB which is generally targeting most biofilms....Figure 5. All promoters were working great in Caulobacter. No significant...difference among three promoters were shown....']"},{"machine":"BBa_J364002","videoId":"BBa_J364002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20J - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 3 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...']"},{"machine":"BBa_K274381","videoId":"BBa_K274381","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20K - [ Composite ] ['PoPS PSP3 pag PO promoter PoPS...']"},{"machine":"BBa_J364003","videoId":"BBa_J364003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20L - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 4 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...']"},{"machine":"BBa_K1051257","videoId":"BBa_K1051257","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20M - [ Measurement ] ['as positive control because of the same promoter and fluorescent protein. ...']"},{"machine":"BBa_J364004","videoId":"BBa_J364004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20N - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 5 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...']"},{"machine":"BBa_K132018","videoId":"BBa_K132018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20O - [ Generator ] []"},{"machine":"BBa_J364005","videoId":"BBa_J364005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 20P - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 6 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...']"},{"machine":"BBa_K133071","videoId":"BBa_K133071","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21A - [ Coding,cds, enzyme ] ['Urease B UreB is one of the main H. pylori antigens. It is a subunit of...']"},{"machine":"BBa_K228236","videoId":"BBa_K228236","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21B - [ Composite ] []"},{"machine":"BBa_K1033933","videoId":"BBa_K1033933","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21C - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, color ] ['the naked eye. The strong color is readily observed in both LB or on agar... Important This part is not available in the registry yet however the same...part is available from the registry with the standard RBS...This part is useful as a reporter....1 is a picture of the pink white screening....BL21s which are expressing the biobrick. It is lysate from the culture above... C Centrifuged lysate of BL21 culture which express the biobrick. It is the...colonies indicate a successful ligation and the pink colonies is AsPink...end to end rotator. The figure is the result after the incubation with a... iGEM2013 Uppsala Expression of asPink in E. coli DH5alpha by promoter...under the name asFP595 GenBank AAG02385.1 . This version is codon optimized...']"},{"machine":"BBa_K590016","videoId":"BBa_K590016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21D - [ Coding ] ['This part was made by UW iGEM Team...This part consists of the mamI gene from Magnetospirillum magneticum ...a membrane localized protein that is essential for magnetosome vesicle...formation and is also known to bind the...We transformed this part into a E. coli BL 21 lacIq strain and observed...']"},{"machine":"BBa_I0500","videoId":"BBa_I0500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, other ] ['Inducible pBad araC promoter...pBad is an E. coli promoter that is tightly controlled by ... When grown with 0.2 arabinose promoter is weak medium. jb 5 24 04 Part may not be compatible with MC4100 as cell line is araD 139....pBAD promoter. Check results on...catabolite repression of expression from the promoter by glucose. Check... Team Glasgow 2017 http 2017.igem.org Team Glasgow improved this part by...under regulation of LacI regulated promoter. This allows for greater control...characterized this part again and added new documentation to it. See more... From an OWW article on pBAD and lac promoters http openwetware.org wiki Titratable control of pBAD and lac promoters in individual E. coli cells pBAD promotersOpenWetWare ... Import of arabinose into cells is mediated by the araE gene. Induction of the arabinose transporter encoded by araE can be uncoupled from the endogenous PBAD promoter by deleting the chromosomal araE gene and replacing it with a plasmid borne copy of araE under control of a constitutive promoter 1 . However this does not seem to be enough to allow for homogenous expression from PBAD promoters in a population of cells 2 .... At low concentrations of arabinose degradation of the sugar within cells also effects the homogeneity of expression from PBAD promoters 2 . Arabinose degradation is mediated by the araBAD genes. Strains lacking functional araE araFGH another transporter and araBAD can be made to be responsive to arabinose for PBAD promoter induction 2 . This is achieved by introduction of a mutant lacY gene. LacY A177C allows for downhill transport of arabinose as well as maltose palatinose sucrose and cellobiose 3 but does not actively transport these sugars 4 . Lactose import is not affected in this mutant. So PBAD promoters in cells lacking endogeneous arabinose importers and containing LacY A177C are linearly responsible to arabinose at the individual cell level.... By the way AraC is the repressor of the PBAD promoter. It is encoded on the pBAD vector series and is still present in the above described strains.... At least one registry stock contains a deletion of the C at base 1194. This is after the transcriptional start but before the translation start so it may not be significant. Parts with this mutation have been qualitatively observed to function normally.... Induction and Subsequent Inhibition of the pBAD Promoter... Expression by the pBAD promoter can be regulated tightly by induction and...The pBAD promoter holds great potential to control the expression of genes...that require tight regulation as it is capable of both an induction and...from 2015 found that the pBAD promoter exhibits an almost all or none...was evident that this promoter on a high copy vector would be inappropriate...promoter.png http 2017.igem.org wiki images archive f f5 20171102025131 21T... SDU Denmark pBAD promoter.png ...promoter is both inducible and repressible as required when cloned into the... Induction of the pBAD Promoter...Promoter pBAD is induced with inexpensive and non toxic monosaccharide...promoter is tightly regulated and can reach moderately high levels of...characterize the pBAD araC promoter on respectively medium copy number pSB3C5...and low copy number pSB4A5 in TOP10 and found the fluorescense is increased as...that the expression of dCas9 from pBAD promoter can be modulated over a wide... The performance of two inducible promoters AraC pBAD compared to Xyls Pm ...The pBAD promoter holds great potential to control the expression of genes...that require tight regulation as it is capable of both an induction and...repression. The pBAD promoter exhibits an almost all or none behavior upon...The inducer with their respective promoters AraC pBAD are coupled with...sfGFP to see if there is actually expression leakage when inducer is present... AraC are present the promoter pBAD is initiated therefore sfGFP is...expressed while sfGFP shouldn t be expressed if inducer is absent. When...fluorescence of pBAD have increased exponentially. This is another sign that...value suddenly increased to 7641 a.u. which is 7590 a.u. higher than the...verified the presence of expression leakage of the system when inducer is not... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...Inducible pBad araC promoter...We also used this part in our project. ...on bacteria. However related studies are all used by the T7 promoter and E....coli BL21 DE3 strain. This year we used the Inducible pBad araC promoter...First we measured the function of the promoter by GFP. We got the gene part...The gene circuit we used is as below ...The protocol is as below ...of D arabinose. To study whether glucose and trehalose affect the promoter we...and trehalose afected the promoter....The result is quite clear. First L arabinose efficiently induced the...have any effect. Secondly glucose and trehalose suppressed the promoter even...trehalose was even worse than that of glucose. The effect of glucose is well ...known. However that of trehalose is not. We give a hypothesis here. One...glucose. Thus at a low concentration trehalose is more insufferable to the...promoter than glucose....storage. We used the promoter to express CAHS 106094 in E. coli DH5 strain to...The gene circuit we used is as below ...The protocol is as below ... 1 If fluorescence induced by the iPTG is detectable in the control group... 1 equals to 109 cells. If the OD600 value is between 0.1 and 1 There is a... 3 If the density above is not suitable take 100 L of the solution and...106094 exhibited a higher survival rate which indicated that the promoter and...This part contains an arabinose operon which constitutes the arabinose...This part contains an arabinose operon which constitutes the arabinose...reproduction of bacteria will be inhibited when arabinose is present. ...be inhibited when there is arabinose in the medium. ... promoter ...pBad araC promoter negative regulators o h o l positive regulators ...']"},{"machine":"BBa_K292006","videoId":"BBa_K292006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21F - [ Composite,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['This part contains a strong ribosome binding site the LacI repressor and a...In E.Coli pLac is a part of the lactose operon. LacI is constantly expressed...and represses the pLac. In the presence of Lactose LacI is inhibited and pLac...The LacI repressor represses pLac promoter from the E.coli lactose operon. So...control a gene expression by using pLac promoter. In fact when LacI is not...expressed pLac is activated and when there is an expression of LacI pLac is...terminator so this brick is ready to use ...']"},{"machine":"BBa_J31000","videoId":"BBa_J31000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21G - [ Coding,function, recombination, function, recombination, hin ] ['Generates the Salmonella typhimurium Hin protein. This protein is used to...invert DNA that is flanked by Hix sites. The actual part sequence should have...about the BioBrick sequences on this part ....']"},{"machine":"BBa_K274380","videoId":"BBa_K274380","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21H - [ Composite ] ['PoPS PSP3 pag PF promoter PoPS...']"},{"machine":"BBa_M45116","videoId":"BBa_M45116","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21I - [ Coding ] ['Green fluorescent protein GFP is a 27 kDa protein of 238 amino acids in...length. GFP is intrinsically fluorescent and hence is ideal as a non invasive...marker in living cells. It is used as a cell lineage tracer reporter of gene...at 475 nm. Fluorescence emission peaks at 509 nm. It is stable within a range...As stated before the maximum excitation spectra of GFPuv is 395nm while its...maximum emission spectra is 509nm which is similar to that of wild type GFP....The main advantage of this variant over wild type GFP is its large amount of...fluorescence when excited by ultra violet UV light at 395nm. GFPuv is 18...Furthermore GFPuv expressed in E. coli is a soluble fluorescent protein in...protein in inclusion bodies. Consequently the GFPuv gene is expressed very...The UGent Belgium 2016 iGEM team improved this part by adding mutations that...']"},{"machine":"BBa_K925001","videoId":"BBa_K925001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21J - [ Coding ] ['This part encodes a delta 15 desaturase derived from Synechocystis sp PCC...6803. The membrane bound enzyme is able to introduce a double bond at the 15...feeding oleic acid to E. coli transformed with this part in addition to ...this fatty acid is not present in unmodified E. coli BL21....transformed cells is the expected 18 3 9 12 15 ....desaturase is able to catalyze the desaturation of linoleic acid to give...']"},{"machine":"BBa_K590031","videoId":"BBa_K590031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21K - [ Coding ] ['This part encodes an enzyme Aldehyde Decarbonylase ADC that removes the...to produce odd chain length alkanes. This part is an important component of...the cell s fatty acid biosynthetic pathway. Alkane production is enhanced when...']"},{"machine":"BBa_K228005","videoId":"BBa_K228005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21L - [ Composite ] ['AraC protein and Pbad promoter...This part contains AraC protein...The expression of any coding sequence following the Pbad promoter is repressed...']"},{"machine":"BBa_K256008","videoId":"BBa_K256008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21M - [ Coding ] ['Infrared fluorescent protein is a monomeric protein engineered from a...Biliverdin IX is in fact a natural product of heme catabolism by the enzyme...heme oxygenase 1 HO 1 . BV is essential because in a mouse experiment...']"},{"machine":"BBa_K274382","videoId":"BBa_K274382","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21N - [ Composite ] ['PoPS PSP3 pag PP promoter PoPS...normalised GFP rate was compared to that produced by the standard promoter...']"},{"machine":"BBa_J31007","videoId":"BBa_J31007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21O - [ Coding,cds, selectionmarker, antibioticresistance ] ['membrane associated protein in the forward orientation. This part requires a...promoter and RBS for proper expression....overexpression however is detrimental to cell growth....']"},{"machine":"BBa_K427005","videoId":"BBa_K427005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 21P - [ Device ] ['This is a sensitivity tuner created form the C protein and Pmom promoter of...protein encoded in the first part of the construct is the activator of the...Pmom promoter which does not begin transcription until the C protein binds to...The activation of the promoter requires the holenzyme 70 which normally...binds to the 35 and 10 consensus sequences the promoter has the 10 but...at 51 where the activator protein binds. Once the protein is located there ...the holenzyme 70 recognizes the promoter and transcription begins. ...of the pBad promoter any promoter would work and change its almost linear...production into an almost Boolean one. This part has the following structure ...activator protein transcriptional stop and phage promoter. The sensitivity...to be inserted between the desired promoter and the desired coding sequence. ...This part has no special safety considerations....represent individual measurements. The line is of a Hill equation fitted to...']"},{"machine":"BBa_K1230007","videoId":"BBa_K1230007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22A - [ Generator ] ['this part as a part of its project. Given Trieste Team couldn t characterise...this part properly we analysed the problems with theirs characterisation to...They used Lac promoter to express this peptide hoping to inhibit cell growth....that Lac promoter has a very high basal level of transcription. Given pSB1C3...has a high copy number it is transcribing a high amount of LL 37 still with...no IPTG in the media. This could mean that there is selection pressure on E....addressed this problem by changing the promoter constructing device...arabinose. This promoter has a basal level of almost 0 so we are sure that it...another promoter we inoculated 12.5 ml of LB of the strain without the...As we can see here there is no basal level transcription on this experiment....']"},{"machine":"BBa_P10599","videoId":"BBa_P10599","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22H - [ DNA ] []"},{"machine":"BBa_K274374","videoId":"BBa_K274374","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22C - [ Composite ] ['PoPS P2 ogr Psid promoter PoPS...']"},{"machine":"BBa_K249009","videoId":"BBa_K249009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22E - [ Reporter ] []"},{"machine":"BBa_J70312","videoId":"BBa_J70312","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22G - [ Translational_Unit ] []"},{"machine":"BBa_K091001","videoId":"BBa_K091001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22I - [ Coding,cds, transcriptionalregulator, repressor ] ['is an repressor of the pLsrA promoter that can be derepressed upon binding to...Part information is collated here to help future users of the BioBrick...The AI 2 signal quorum sensing signal molecule is actively transported into...']"},{"machine":"BBa_K216006","videoId":"BBa_K216006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22K - [ Translational_Unit,cds, enzyme ] ['This is the coding sequence for the enzyme pentaerythritol tetranitrate...source. PETN reductase is an FMN binding flavoprotein of the Old Yellow Enzyme...family. It is reduced by NADPH and its main activity is reductive denitration...nitroglycerine . The nitrogen is liberated as nitrite anion NO2 . Nitrate...with two or fewer thus PETN is rapidly denitrated to pentaerythritol...trinitrate and then pentaerythritol dinitrate but further denitration is much... KAR 400 58 micromolar this is the dissociation constant for unproductive binding of NADPH to the reduced form of the enzyme ....']"},{"machine":"BBa_K629010","videoId":"BBa_K629010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22M - [ Composite ] ['recA cheZ eGFP.In our project this part consist of recAp cheZ and eGFP...when this part is under irradiation recAp can be started to promote the...clockwise. As a result this part will make e.coli move forward to the...rec promoter inside the genome of the BL21 itself beside the one caused by...rec promoter in the plasmid may be the reason of another crest. At first the...recA promoter is triggered by the increasing NAL concentration which leads to...was damaged but the rec promoter in the genome has not been triggered yet...results in the trough between the two crests. Finally the rec promoter in the...genome is triggered by the relatively high concentration of NAL and produces...']"},{"machine":"BBa_K274384","videoId":"BBa_K274384","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 22O - [ Composite ] ['PoPS PSP3 pag Psid promoter PoPS...']"},{"machine":"BBa_K125502","videoId":"BBa_K125502","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23A - [ Coding,function, biosynthesis, plastic ] []"},{"machine":"BBa_K318514","videoId":"BBa_K318514","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23B - [ Regulatory ] []"},{"machine":"BBa_K343004","videoId":"BBa_K343004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23C - [ Generator ] ['This part entails a TetR repressed POPS RIPS generator including RBS the...FlhDC master operon and a dual terminator. This part will cause...flagella is a complex and energy consuming process so the expression of the...involved proteins is tightly regulated by the extracellular environment. One...of the most well studied flagella synthesis systems is that of Eschericia...Apart from initiation of flagella synthesis FlhDC is also a repressor of cell...FlhDC is a hexameric transcription factor that consists of four FlhD subunits...factor 28 which is responsible for the expression of the class III genes....that an upregulation of the expression of the operon is responsible for the...suggesting that the plasmid is only stable within the cell for a few...generations 20 . This is presumably due to the strain brought upon the...plasmid like pSB1C3 K343004 it is to expect that the bacteria will quickly...shed the plasmid when no longer exposed to a selection pressure. It is likely...pSB1C3 K343004 suggests that it is highly unfavourable for the bacteria ...phase of the bacteria. Whether this is the case can not be concluded based on...as this is done in at least a level 1 safety lab by trained people. No special...care is needed when working with this BioBrick....following 9 amino acids are a linker. The last part is HtrII fused with...evidence that the genes this BioBrick is made from or any near homologs are...The BioBrick does not produce a product that is secreted into the environment ...nor is it s gene product itself toxic. It would not produce anything that...other hand the BioBrick is very large and this will naturally slow down its...The stability of pSB1C3 K343004 is most likely 20 generations however the...']"},{"machine":"BBa_K750107","videoId":"BBa_K750107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23D - [ Signalling ] ['This part contains promoter pBAD RBS of 0.07 strength cI lva protein and...double terminator. When arabinose is added the promoter pBAD will be...promoter PcI and repress the production of reporter gene behind it. In our...repressed by cI protein. And this part can provide cI protein for PcIGLT ....arabinose which effect on promoter PBAD an E.coli promoter see more 4 . In...the absence of arabinose cI regulated promoter PcI expresses GFP with...repressor CI protein is translated and represses PcI ....called Dual input BCD Decoder. Once the construction is completed Engineered...gfp LVA tt failed to function which is supposed to express GFP without...But we got no result from the SDS PAGE it is possible to hypothesize that the...SDS PAGE is not so sensitive to detect the low concentration of CI protein ...aim of constructing this new part is to reduce the hypothetic leakage of CI...']"},{"machine":"BBa_K531011","videoId":"BBa_K531011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23F - [ Composite ] ['RsaA. Esp is a suspected serine protease that breaks up Staphylococcus...growth is calculated by subtracting the ODmean of S. aureus only treatment...Esp which is known to target S. aureus biofilm specifically has a better...inhibition effect than DspB which is generally targeting most biofilms....Figure 5. All promoters were working great in Caulobacter. No significant...difference among three promoters were shown....']"},{"machine":"BBa_K132000","videoId":"BBa_K132000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23G - [ Translational_Unit ] []"},{"machine":"BBa_K331031","videoId":"BBa_K331031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23H - [ Intermediate ] ['with the tetracycline repressible promoter...The long term goal of our team is to utilize an oligoarginine tail to...affects the stability of the protein to which it is fused. ...to add a tetracycline repressible promoter...N terminal oligoarginine is reducing the half life of the protein to which it...']"},{"machine":"BBa_K173007","videoId":"BBa_K173007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23I - [ Device ] ['aTc inducible system aTc PoPS with J23100 promoter...This BioBrick is an aTc http openwetware.org wiki ATc input PoPS...inhibits tetR promoter...When aTc is added to the medium it binds tetR and inhibits it. So the PoPS...output is a function of the aTc concentration....']"},{"machine":"BBa_K215002","videoId":"BBa_K215002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23J - [ Generator ] ['placing it under the control of a strong IPTG inducible promoter R0011 and... 2. Reverse Primer 15 21bp complementing your gene of interest ending BEFORE the stop codon make sure it is a muliple of three to stay in frame NheI or XbaI or SpeI 8 random bp s ... 4. Your fusion protein is tagged and ready for secretion and streptavidin binding ...demonstrate that protein is produced from K215002 and at least in the case...']"},{"machine":"BBa_K243032","videoId":"BBa_K243032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 23L - [ Composite ] ['This part is composed of the essential Fok a part protein domain...on the membrane. There is a signal corresponding to 49 kDa which matches the...It is possible to use the GFP tag or as in our case YFP for purification by a...a GFP column is under progress....']"},{"machine":"BBa_K182005","videoId":"BBa_K182005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24A - [ Regulatory ] ['This is a part using the biobrick...the cI repressor and is repressed when it binds.It is identical to...in the 35 promoter binding region 15th base is C instead of T ....tag attached to its end. TetR binds to TetR regulated promoters such as...it to be released from the promoter and reintroducing transcription....This part comes without a terminator....Since K182005 is on an Ampicillin chloramphenicol vector pSB1AC3 and...I13600 is on an Ampicillin vector we decided to first transform I13600 into a...']"},{"machine":"BBa_P10598","videoId":"BBa_P10598","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24H - [ DNA ] []"},{"machine":"BBa_K398108","videoId":"BBa_K398108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24C - [ Generator ] ['differs from environment to environment. It is difficult for a species to...protein is called bbc1.The exact mechanism of the increased salt tolerance is...proteins it is theorized that it may prevent stabilize the folding structure...observed the resistance to high salt concentrations is significantly improved...effects resulting from salt stress. It is possible that our BioBrick assists...wild type is stronger....']"},{"machine":"BBa_K1051258","videoId":"BBa_K1051258","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24E - [ Measurement ] ['as positive control because of the same promoter and fluorescent protein. ...']"},{"machine":"BBa_K500000","videoId":"BBa_K500000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24G - [ DNA ] ['chrysosporium. Synthetized by Geneart Lignin peroxidase Lip is a monomeric...']"},{"machine":"BBa_K909000","videoId":"BBa_K909000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 4, 24I - [ Coding ] []"},{"machine":"BBa_K1362053","videoId":"BBa_K1362053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1A - [ DNA ] ['This is a carrier construct for N terminal tags of the RFC 105 . Tags can be...']"},{"machine":"BBa_K1763000","videoId":"BBa_K1763000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1B - [ Coding ] ['This is the coding region for the honeybee silk protein 3. Previous...literature has shown that it is possible to generate honeybee fibers by...into fibers in vitro Sutherland This part does not contain any of the... Because this is just the coding region for the honeybee silk sequence it is...Although it is not quite as strong as these other types of silks working with...The size of the honey bee silk protein gene is considerably smaller than the...silk genes of spiders or silkworms. More importantly the gene sequence is non... Here is the SDS gel of our expression of the honeybee silk protein. It was purified using this inclusion body protocol http wolfson.huji.ac.il purification PDF Protein Expression Extraction NOVAGEN BugBuster protein extraction.pdf ... Here http 2015.igem.org Team UCLA Notebook Honeybee Silk 28 July 2015 is the link to the protocol that we used for expressing the protein starting from a colony. We were using Kanamycin as our antibiotic but chloramphenicol should be used if using this biobrick. ... Fig. 1 Expected size of product is 40.0 kDA... There are contaminating bands present on the SDS PAGE gel indicating that the purification is not completely effective. ...The new part is ...the codon of this part to make it more suitable for expression in plants ...providing a basis for subsequent research on this part in plants. The new part...']"},{"machine":"BBa_K1362054","videoId":"BBa_K1362054","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1C - [ Composite ] ['degradation of this protein. This is a C terminal tag. This part functions as...']"},{"machine":"BBa_K1763001","videoId":"BBa_K1763001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1D - [ Composite ] ['This part will allow for expression of honeybee silk protein under control of...a lac promoter....spiders or silkworms. Although it is not quite as strong as these other types...importantly the gene sequence is non repetitive which allows us to...using one of these proteins Amelf3 is sufficient to reproduce the physical...']"},{"machine":"BBa_K1362055","videoId":"BBa_K1362055","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1E - [ Composite ] ['cell membrane in E. coli. This part functions as an RFC 105 insert. It...']"},{"machine":"BBa_K1763004","videoId":"BBa_K1763004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1F - [ DNA,awards, part_Kit plate, 2015 ] ['This part contains the core sequence of MaSp2 that has been assembled with a...the 3 end of the sequence. This part was designed for use with Iterative...together. Before using in ICA this part should be digested with BsaI a type...applications. Spider silk is a proteinaceous fiber whose proteins consist of...content is nearly impossible using traditional cloning methods due to the...ligated one at a time into a receiving plasmid. Concatemerization is another...cloned into plasmids. This particular technique is useful for creating a...not offer any control over the length or genetic composition as is the case...for concatemerization. As it currently stands there is no one technique that...Iterative Capped Assembly ICA is a cloning method that is used to...monomer is responsible for binding to a specific nucleotide in the target...chains. The full length sequence is flanked by unique primer annealing sites ...for attaining sufficient DNA is as follows ...The plasmid containing this part should be transformed into E. coli. Grow a...Gel purify the digestion on 1.5 agarose gel. The product is the digested 102...bp fragment which will be directly used for ICA. An example digestion is shown...performed in duplicate. The expected product is 102 bp. The 102 bp bands were...After gel purification typical yields were 30 ng uL in 12 uL. This is 75 ...']"},{"machine":"BBa_K1362056","videoId":"BBa_K1362056","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1G - [ Composite ] ['This part includes a sequence for myristoilation. Fused to the N terminus of a...eucaryotic organisms.This part functions as an RFC 105 insert. It consists of...']"},{"machine":"BBa_K1763009","videoId":"BBa_K1763009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1H - [ DNA,awards, part_Kit plate, 2015 ] ['This part contains the core sequence of MaSp2 that has been assembled with a...the 3 end of the sequence. This part was designed for use with Iterative...together. Before using in ICA this part should be digested with BsaI a type...applications. Spider silk is a proteinaceous fiber whose proteins consist of...content is nearly impossible using traditional cloning methods due to the...ligated one at a time into a receiving plasmid. Concatemerization is another...cloned into plasmids. This particular technique is useful for creating a...not offer any control over the length or genetic composition as is the case...for concatemerization. As it currently stands there is no one technique that...Iterative Capped Assembly ICA is a cloning method that is used to...monomer is responsible for binding to a specific nucleotide in the target...chains. The full length sequence is flanked by unique primer annealing sites ...for attaining sufficient DNA is as follows ...The plasmid containing this part should be transformed into E. coli. Grow a...Gel purify the digestion on 1.5 agarose gel. The product is the digested 102...bp fragment which will be directly used for ICA. An example digestion is shown...performed in duplicate. The expected product is 102 bp. The 102 bp bands were...After gel purification typical yields were 30 ng uL in 12 uL. This is 75 ...Only one of this particular sequencing core may be incorporated into the final...']"},{"machine":"BBa_K1362057","videoId":"BBa_K1362057","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1I - [ Tag ] ['of a protein the protein is localized to the nucleus. This part functions as...']"},{"machine":"BBa_K1763010","videoId":"BBa_K1763010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1J - [ DNA,awards, part_Kit plate, 2015 ] ['This part contains the core sequence of MaSp1 that has been assembled with a...the 3 end of the sequence. This part was designed for use with Iterative...together. Before using in ICA this part should be digested with BsaI a type...applications. Spider silk is a proteinaceous fiber whose proteins consist of...content is nearly impossible using traditional cloning methods due to the...ligated one at a time into a receiving plasmid. Concatemerization is another...cloned into plasmids. This particular technique is useful for creating a...not offer any control over the length or genetic composition as is the case...for concatemerization. As it currently stands there is no one technique that...Iterative Capped Assembly ICA is a cloning method that is used to...monomer is responsible for binding to a specific nucleotide in the target...chains. The full length sequence is flanked by unique primer annealing sites ...for attaining sufficient DNA is as follows ...The plasmid containing this part should be transformed into E. coli. Grow a...Gel purify the digestion on 1.5 agarose gel. The product is the digested 102...bp fragment which will be directly used for ICA. An example digestion is shown...performed in duplicate. The expected product is 102 bp. The 102 bp bands were...After gel purification typical yields were 30 ng uL in 12 uL. This is 75 ...']"},{"machine":"BBa_K1362058","videoId":"BBa_K1362058","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1K - [ Tag ] ['protein to the E. coli periplasm. This part functions as an RFC 105 insert....']"},{"machine":"BBa_K1763011","videoId":"BBa_K1763011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1L - [ DNA,awards, part_Kit plate, 2015 ] ['This part contains the core sequence of MaSp1 that has been assembled with a...the 3 end of the sequence. This part was designed for use with Iterative...together. Before using in ICA this part should be digested with BsaI a type...applications. Spider silk is a proteinaceous fiber whose proteins consist of...content is nearly impossible using traditional cloning methods due to the...ligated one at a time into a receiving plasmid. Concatemerization is another...cloned into plasmids. This particular technique is useful for creating a...not offer any control over the length or genetic composition as is the case...for concatemerization. As it currently stands there is no one technique that...Iterative Capped Assembly ICA is a cloning method that is used to...monomer is responsible for binding to a specific nucleotide in the target...chains. The full length sequence is flanked by unique primer annealing sites ...for attaining sufficient DNA is as follows ...The plasmid containing this part should be transformed into E. coli. Grow a...Gel purify the digestion on 1.5 agarose gel. The product is the digested 102...bp fragment which will be directly used for ICA. An example digestion is shown...performed in duplicate. The expected product is 102 bp. The 102 bp bands were...After gel purification typical yields were 30 ng uL in 12 uL. This is 75 ...']"},{"machine":"BBa_K1362059","videoId":"BBa_K1362059","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1M - [ Tag ] ['protein the protein is exported from the nucleus to the cytoplasm. This part...']"},{"machine":"BBa_K1763012","videoId":"BBa_K1763012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1N - [ DNA,awards, part_Kit plate, 2015 ] ['This part contains the core sequence of MaSp1 that has been assembled with a...the 3 end of the sequence. This part was designed for use with Iterative...together. Before using in ICA this part should be digested with BsaI a type...applications. Spider silk is a proteinaceous fiber whose proteins consist of...content is nearly impossible using traditional cloning methods due to the...ligated one at a time into a receiving plasmid. Concatemerization is another...cloned into plasmids. This particular technique is useful for creating a...not offer any control over the length or genetic composition as is the case...for concatemerization. As it currently stands there is no one technique that...Iterative Capped Assembly ICA is a cloning method that is used to...monomer is responsible for binding to a specific nucleotide in the target...chains. The full length sequence is flanked by unique primer annealing sites ...for attaining sufficient DNA is as follows ...The plasmid containing this part should be transformed into E. coli. Grow a...Gel purify the digestion on 1.5 agarose gel. The product is the digested 102...bp fragment which will be directly used for ICA. An example digestion is shown...performed in duplicate. The expected product is 102 bp. The 102 bp bands were...After gel purification typical yields were 30 ng uL in 12 uL. This is 75 ...']"},{"machine":"BBa_K1362100","videoId":"BBa_K1362100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1O - [ Composite ] ['This intein assembly construct is part of the iGEM team Heidelberg 2014 s...sequence into an N terminal and a C terminal split intein one is left with a...This Part is an N intein assembly part according to RFC...']"},{"machine":"BBa_K1692001","videoId":"BBa_K1692001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 1P - [ Coding,awards, part_Kit plate, 2015 ] ['Ferulic acid decarboxylase FDC with T7 promoter and RBS...Ferulic Acid Decarboxylase with T7 promoter...site directed mutagenesis was successful. This part includes a T7 promoter ...']"},{"machine":"BBa_K1491005","videoId":"BBa_K1491005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2A - [ Reporter ] []"},{"machine":"BBa_K1806004","videoId":"BBa_K1806004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2B - [ Composite ] ['The part is to act as a backbone for the T7 ibPB RNA Thermometer pelB 6xHis...be integrated into the system. The part that is added to the backbone will be...Heat shock is a major process for the survival of all species. 1 In an...forces the organism to adapt to temperature shifts. This is where heat shock...organisms and is present in the most primitive bacteria species to the most...to be handled by the most common structures found in all that is living RNA....thermometers is that they function through conformational shifts in structure....sequence is common. Aside from that temperature is the factor responsible for...The Rna thermometer that will be utilized in our project is the ibpb RNA...organisms the ibpb thermometer is a standard cis acting heat shock regulated...rna thermometer. The heat shock process is stimulated by the medium of the...attached protein. This heat shock response is effectively stimulated at 37 C...result of the functioning of the iPTG Inducible Promoters in different...temperatures. The functioning of the promoters increased cumulatively with... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1491007","videoId":"BBa_K1491007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2C - [ Reporter ] []"},{"machine":"BBa_K1806005","videoId":"BBa_K1806005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2D - [ Composite,awards, composite_part, 2015 ] ['The part is designed to produce RFP in higher temperatures. The RNA...Heat shock is a major process for the survival of all species. 1 In an...forces the organism to adapt to temperature shifts. This is where heat shock...organisms and is present in the most primitive bacteria species to the most...to be handled by the most common structures found in all that is living RNA....thermometers is that they function through conformational shifts in structure....sequence is common. Aside from that temperature is the factor responsible for...The Rna thermometer that will be utilized in our project is the ibpb RNA...organisms the ibpb thermometer is a standard cis acting heat shock regulated...rna thermometer. The heat shock process is stimulated by the medium of the...attached protein. This heat shock response is effectively stimulated at 37 C...contained Hind3 unlike the RFP in this part. For this reason the part was...result of the functioning of the iPTG Inducible Promoters in different...temperatures. The functioning of the promoters increased cumulatively with...']"},{"machine":"BBa_K1491009","videoId":"BBa_K1491009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2E - [ Reporter ] []"},{"machine":"BBa_K1674000","videoId":"BBa_K1674000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2F - [ Protein_Domain,awards, basic_part, 2015 ] [' 4. The SP is been degraded and the exoprotein is going through some last modification....In both samples it can be seen that there is a mild decrease in the...mCherry is 2.5 times higher than those shown by the not secreted mCherry....signal peptide is 300 higher relative to the fluorescence observed from the...mCherry is secreted....']"},{"machine":"BBa_K1491015","videoId":"BBa_K1491015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2G - [ Coding ] []"},{"machine":"BBa_K1674001","videoId":"BBa_K1674001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2H - [ Coding ] ['The 3 hydroxysteroid dehydrogenase 3 HSD is an enzyme which converts...figure 1. The isoform that has been chosen to create this part is AKR1C9 ...originated from rat liver. Its advantage is the greater specificity to DHT...We over expressed the 3 HSD enzyme using T7 promoter in E.coli BL21 strain ...over produced in BL21 under T7 promoter. ...After a successful overexpression of the 3 HSD enzyme under pT7 promoter we...3 HSD gene we can see clearly the graph slope is steeper in presence of...concentration between 40 60uM. This behavior is compatible with the Michaelis ...']"},{"machine":"BBa_K1491016","videoId":"BBa_K1491016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2I - [ Composite ] ['Codon optimized KillerRed with WTLac promoter allows for induction of...']"},{"machine":"BBa_K1674002","videoId":"BBa_K1674002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2J - [ Composite ] ['This part was created especially for checking the activity of the basic part...degradation of dihydrotestosterone DHT which is the main cause of male...']"},{"machine":"BBa_K1491017","videoId":"BBa_K1491017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2K - [ Coding ] ['2017 SSTi SZGD Team has improved the this part. The improvement was made by...']"},{"machine":"BBa_K1674003","videoId":"BBa_K1674003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2L - [ Composite ] ['This part was created especially for checking the expression of the basic part...degradation of the dihydrotestosterone DHT which is the main cause of male...']"},{"machine":"BBa_K1491018","videoId":"BBa_K1491018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2M - [ Composite ] ['Supernova is the monomeric version of KillerRed BB K1184000 . Codon optimized...Supernova with WTLac promoter allows for induction of Supernova expression...']"},{"machine":"BBa_K1674004","videoId":"BBa_K1674004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2N - [ Coding ] ['G6PD is a key enzyme as it catalyzes the first step to the Pentose phosphate...One of the major NADPH resources in E.coli is pentose phosphate pathway....Glucose 6 Phosphate Dehydrogenase is the key enzyme to this pathway 4 . ...with the zwf gene under a T7 promoter to get over expression of G6PD. ...The over expression of Glucose 6 Phosphate Dehydrogenase is a great way to...The zwf gene was cloned into pSB1C3 as well as to pSB1C3 with T7 promoter...size of 55 kDa. The protein zwf under T7 promoter giving a strong band...right size of 55kDa. It is over produced in BL21 with zwf under T7 promoter. ...Consultations with academic staff led us to believe that NADPH is not excreted...after 12 hours is probably because of natural lysis of the cells in the...intracellular NADPH in the strains. This assumption is supported by the...with and without glucose in the medium. Glucose is a precursor of...commercial NADPH indicating that the NADPH in the supernatant is in adequate...Still further condition optimization is needed....']"},{"machine":"BBa_K1499200","videoId":"BBa_K1499200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2O - [ Coding,cds, chassis, prokaryote, ecoli ] ['This part encodes uvsE a putative UV damage endonuclease found in D.... Deinococcus radiodurans is a highly radiation resistant bacterium that can...to resistance against ionizing radiation this bacterium is also known to...resist UV radiation. One gene that contributes to this phenotype is a UV DNA...of this gene but it is not as effective as the gene from D. radiodurans ....expressed under a strong constitutive promoter and medium RBS. Although we...have not tried inducible or weaker promoters we expect the part to work under...constitutively under a strong promoter and medium strength RBS confers... Deinococcus radiodurans R1 is a UV damage endonuclease. J. Bacteriol. ...']"},{"machine":"BBa_K1639001","videoId":"BBa_K1639001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 2P - [ RNA,chassis, prokaryote, ecoli ] ['This part required for producing reporter flourescence protein GFP from...characterization of this part by expressing the trigger with different...']"},{"machine":"BBa_K1362101","videoId":"BBa_K1362101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3A - [ Composite ] ['This intein assembly construct is part of the iGEM team Heidelberg 2014 s...sequence into an N terminal and a C terminal split intein one is left with a...This part was improved upon by the UCL 2018 iGEM team by building...promoter in BL21 cells fig.1 ....']"},{"machine":"BBa_K1692003","videoId":"BBa_K1692003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3B - [ Coding,awards, part_Kit plate, 2015 ] ['PAL with T7 promoter...PAL with T7 Promoter...to trans cinnamic acid. This part is a modification of University of British...Specifically our part contains a T7 promoter allowing for inducible...']"},{"machine":"BBa_K1362102","videoId":"BBa_K1362102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3C - [ Composite ] []"},{"machine":"BBa_K1692004","videoId":"BBa_K1692004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3D - [ Coding,awards, part_Kit plate, 2015, chassis, prokaryote, ecoli, Kit plates, probiotics, production ] ['codon optimized PAL with T7 promoter and Flag Tag...PAL construct is codon optimized for expression in E. coli. The original...sequence is derived from Anabaena variabilis. We chose the A. variabilis...inducible promoter a ribosome binding site and a FLAG tag peptide sequence...has been discovered that a cofactor is required to activate FDC. This cofactor...flavin mononucleotide FMN which is catalyzed by the enzyme UbiX 2 ....in a plasmid with a promoter and RBS we transformed it into T7 expressing NEB...This is a SDS PAGE gel with purified PAL FDC and UbiX protein. We ran a...concentration is directly proportional to absorbance we could...we could determine the kinetic parameters of our enzyme. Shown here is a time...']"},{"machine":"BBa_K1362103","videoId":"BBa_K1362103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3E - [ Composite ] []"},{"machine":"BBa_K1692005","videoId":"BBa_K1692005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3F - [ Coding,awards, part_Kit plate, 2015 ] ['UbiX is a flavin prenyltransferase required in ubiquinone synthesis in...UbiX is a flavin prenyltransferase that normally plays a role in ubiquinone...cofactor that happens to be essential to the functionality of FDC. This part...']"},{"machine":"BBa_K1362110","videoId":"BBa_K1362110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3G - [ Composite ] []"},{"machine":"BBa_K1692006","videoId":"BBa_K1692006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3H - [ Coding,awards, part_Kit plate, 2015 ] ['UbiX with T7 Promoter...UbiX with T7 promoter...UbiX is a flavin prenyltransferase that normally plays a role in ubiquinone...cofactor that happens to be essential to the functionality of FDC. This part...part includes a T7 promoter allowing for inducible expression. See our...']"},{"machine":"BBa_K1362111","videoId":"BBa_K1362111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3I - [ Composite ] []"},{"machine":"BBa_K1699002","videoId":"BBa_K1699002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3J - [ Coding,awards, part_Kit plate, 2015 ] [' UBB gene which is essential for cancer cells 1 2 . It has a hammerhead...Guide RNA is a hundred base long molecule with a unique two dimensional...SaCas9 was used 5 . In order to utilize the cancer specific promoter...II promoters since these are the main promoters controlling gene activation ...promoters like U6 promoter which is generally used to synthesize gRNAs. UBB...This part was used in a following construct ...promoter Fig. 1 . The survivin promoter was used as a part of two cancer ...specific promoter based design for CRISPR mediated gene knock out the other...survivin promoter....The design of cancer specific CRISPR mediated gene knock out is summarized in... Fig. 2 . Summary of two cancer specific promoter driven CRISPR mediated...']"},{"machine":"BBa_K1362120","videoId":"BBa_K1362120","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3K - [ Composite ] []"},{"machine":"BBa_K1699003","videoId":"BBa_K1699003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3L - [ Coding,awards, part_Kit plate, 2015 ] ['gRNA for dCas9 VP64 targeting synthetic activation promoter pMLPm...complementary to 3 different loci in the synthetic promoter pMLPm 1 and...promoter. It has a hammerhead ribozyme on its 5 and an HDV ribozyme on its 3 ...Guide RNA is a hundred base long molecule with a unique two dimensional...to promoter dCas9 VP64 gRNA complex will promote transcription of genes... 4 . In order to utilize the cancer specific promoter hyperactivation we used...be transcribed and processed using RNA polymerase II promoters since these...are the main promoters controlling gene activation while eliminating the need...for use of constitutive RNA Polymerase III promoters like U6 promoter which...This part was used and validated by BGU 2015 team in a following construct ...targeting synthetic activation promoter pMLPm abbreviated as gMLP under the...control of human survivin promoter Fig. 1 . The survivin promoter was used as...a part of two cancer specific promoter based design for CRISPR mediated...transcriptional activation system the other being human TERT promoter...survivin promoter....of hTERT promoter gMLP targeting the synthetic activation promoter under...the control of human survivin promoter and eGFP under synthetic activation...promoter 1 eGFP expression was detected only in cancer cells compared to... Fig. 2 . eGFP expression from synthetic activation promoter exclusively in...driven by dCas9 VP64 under the control of hTERT promoter and gMLP... targeting the synthetic activation promoter under the control of human...survivin promoter. Bar 100 micron....promoters TERT and survivin drives the activation of the system only in...using two cancer specific promoter driven expression of dCas9 VP64 and gRNA....']"},{"machine":"BBa_K1362121","videoId":"BBa_K1362121","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3M - [ Composite ] []"},{"machine":"BBa_K1699004","videoId":"BBa_K1699004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3N - [ Coding ] ['gRNA for SaCas9 targeting human ubiquitin B gene under U6 promoter...human U6 RNA polymerase III promoter. gRNA sequence is complementary to 3...different loci in the second exon of human UBB gene which is essential for...Guide RNA is a hundred base long molecule with a unique two dimensional...knock out. UBB is essential for survival of multiple cancer cell types 1 2 ....This part was designed as a control construct for two cancer specific...promoter based design of CRISPR mediated gene knock out. In the design gRNA...is ribozyme flanked to enable synthesis under RNA polymerase II promoter and...is under control of human survivin promoter....Ubiquitin B gene abbreviated as gUBB under the control of human U6 promoter...U6 promoter....']"},{"machine":"BBa_K1362130","videoId":"BBa_K1362130","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3O - [ Composite ] []"},{"machine":"BBa_K1699005","videoId":"BBa_K1699005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 3P - [ Coding ] ['gRNA for dCas9 VP64 targeting synthetic activation promoter pMLPm under U6...promoter...gRNA for dCas9 VP64 targeting synthetic activation promoter pMLPm under the...control of U6 RNA polymerase III promoter. gRNA sequence is complementary to...3 different loci in the synthetic promoter pMLPm 1 and gRNA dCas9 VP64...complex can promote transcription downstream of a synthetic promoter....Guide RNA is a hundred base long molecule with a unique two dimensional...to promoter dCas9 VP64 gRNA complex will promote transcription of genes...This part was designed as a control construct for two cancer specific...promoter based design of CRISPR mediated transcriptional activation. In the...design gRNA is ribozyme flanked to enable synthesis under RNA polymerase II...promoter and is under control of human survivin promoter....synthetic activation promoter pMLPm abbreviated as gMLP under the control of...human U6 promoter Fig. 1 ....U6 promoter....']"},{"machine":"BBa_K1499201","videoId":"BBa_K1499201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4A - [ Coding,cds, chassis, prokaryote, ecoli ] ['This part encodes a uracil DNA glycosylase found in D. radiodurans which... Deinococcus radiodurans is a highly radiation resistant bacterium that can...radiodurans is known to survive both ionizing and UV radiation....One gene that contributes to this phenotype is a family 1 uracil DNA...part ligated to a constitutive promoter and medium RBS failed twice ...suggesting that it may be toxic if it is highly expressed....']"},{"machine":"BBa_K1639004","videoId":"BBa_K1639004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4B - [ Coding ] ['Many species of bacteria have flagellar motility that is achieved by rotating...surface exposed organelles The rotation of the flagella is controlled by a...motor region of E. Coli s flagella is composed of several parts. The stator...switching and rotation 9 10 . However FliG is predominately involved in...rotor direction 12 . The precise role of FliN is the least well defined but...HNS is a transcription factor that plays a role in the regulation of gene...it was shown that HNS is essential for the synthesis of proteins that make up...the rotor and stator. The flhCD operon is a positive regulator of HNS which is...proteins have different activities. FliM is a regulator protein that is...oriented. Although the role of FliN is not precisely known it is thought that...of flagella to the membrane. As for FliG this protein is responsible for the...this part of the project which are to increase the speed and power of the...were measured at each FliG concentration and averaged. Graph is representative...']"},{"machine":"BBa_K1499202","videoId":"BBa_K1499202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4C - [ Coding,cds, chassis, prokaryote, ecoli ] ['This part encodes a uracil DNA glycosylase found in D. radiodurans which... Deinococcus radiodurans is a highly radiation resistant bacterium that can...radiodurans is known to survive both ionizing and UV radiation....One gene that contributes to this phenotype is a family 4 uracil DNA...The enzyme can remove uracil from U G and U A pairs but it is more active in...radiodurans is not heat stable...part ligated to a constitutive promoter and medium RBS failed twice ...suggesting that it may be toxic if it is highly expressed....']"},{"machine":"BBa_K1639010","videoId":"BBa_K1639010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4D - [ Regulatory ] ['In our project second step of cancer module is based on production of LacI so...rate. In gastric epithelial cells level of this mirna is low but in gastric...cancer cells level is very high.... m in mLacI stands for mammalian this part is mammalian codon optimized of...Research published by Zhen Xie et al. in 2011 is central in cancer module of...inputs included the response function is well approximated by a Boolean...simplified expression is in diagram Figure 2 ...In the images DsRed protein production is seen. However since the cell line...we used is not a cancer cell line the amount of protein produced is small....']"},{"machine":"BBa_K1499500","videoId":"BBa_K1499500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4E - [ Composite ] ['part is under the control of a lac repressible promoter. The second part...promoter that controls expression of GFP see image below 1 ....Our goal in building this construct is to create a time delay. Since the...production of AHL is under the control of a lac repressible promoter the...cascade should not begin until the promoter is induced. Additionally once the...promoter is activated time is required for the AHL and luxR molecules to...in large enough quantities to interact and bind to the luxPR promoter will GFP...lac repressible promoter and thus the colonies should not have been...After doing further research we discovered that the luxPR promoter...present but the AHL molecule is not. In the lac deficient strain of E. coli ...AHL is not produced without IPTG induction but luxR expression is controlled...by the constitutive ptet promoter. We hypothesize that since luxR was present...Thus GFP may have been expressed because the ptet promoter which is...between the luxR gene and the luxPR promoter in hopes that this will stop the... Characterization of Promoter. Improvement by BIT China 2019...To see the leakage of the promoter we performed a 3 hour fluorescence...the promoter leakage degree of pLUX increased with the culture time....']"},{"machine":"BBa_K1639011","videoId":"BBa_K1639011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4F - [ Regulatory ] ['In our project second step of cancer module is based on production of LacI so...cells their level is very high.... m in mLacI stands for mammalian this part is mammalian codon optimized of...Research published by Zhen Xie et al. in 2011 is central in cancer module of...inputs included the response function is well approximated by a Boolean...simplified expression is in diagram Figure 2 ...In the images DsRed protein production is seen. However since the cell line...we used is not a cancer cell line the amount of protein produced is small....']"},{"machine":"BBa_K1499000","videoId":"BBa_K1499000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4G - [ Coding ] ['This part encodes wssF a gene found in the wss operon of Pseudomonas...wssF is one of the four genes isolated from Pseudomonas fluorescens ...This part has been successfully cloned into the BioBrick backbone but for...']"},{"machine":"BBa_K1639012","videoId":"BBa_K1639012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4H - [ Device ] ['contain expression machinery like promoters terminators. We inserted this...expression. System consist of T7 promoter rbs terminator and BamHI SalI...to protein expressed. Only you need is to ligate system into any vector and...']"},{"machine":"BBa_K1486022","videoId":"BBa_K1486022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4I - [ Generator,cds, reporter, chassis, prokaryote, ecoli, direction, forward, function, reporter, light, rbs, prokaryote, constitutive ] ['This part is a translational unit for the Renilla luciferase. It is under the...control of an Arabinose induced promoter pBAD . Coelenterazine or benzyl ...bigger for Firefly luciferase which is also preferable....']"},{"machine":"BBa_K1763423","videoId":"BBa_K1763423","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4J - [ DNA,awards, part_Kit plate, 2015, Kit plates, silk ] ['This part contains the core sequence of MaSp2 that has been assembled with a...the 3 end of the sequence. This part was designed for use with Iterative...together. Before using in ICA this part should be digested with BsaI a type...applications. Spider silk is a proteinaceous fiber whose proteins consist of...content is nearly impossible using traditional cloning methods due to the...ligated one at a time into a receiving plasmid. Concatemerization is another...cloned into plasmids. This particular technique is useful for creating a...not offer any control over the length or genetic composition as is the case...for concatemerization. As it currently stands there is no one technique that...Iterative Capped Assembly ICA is a cloning method that is used to...monomer is responsible for binding to a specific nucleotide in the target...chains. The full length sequence is flanked by unique primer annealing sites ...for attaining sufficient DNA is as follows ...The plasmid containing this part should be transformed into E. coli. Grow a...Gel purify the digestion on 1.5 agarose gel. The product is the digested 102...bp fragment which will be directly used for ICA. An example digestion is shown...performed in duplicate. The expected product is 102 bp. The 102 bp bands were...After gel purification typical yields were 30 ng uL in 12 uL. This is 75 ...Only one of this particular sequencing core may be incorporated into the final...']"},{"machine":"BBa_K1434000","videoId":"BBa_K1434000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4K - [ Coding ] ['Escherichia coli CRP protein is a cAMP activated global transcription factor....than one hundred promoters. This protein enhances the possibility of RNA...']"},{"machine":"BBa_K1763424","videoId":"BBa_K1763424","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4L - [ Coding ] ['This is a 3 mer construct of MaSp2 constructed using Iterative Capped Assembly...This part is a coding sequence with no regulatory elements present. This...In order to express this construct as a protein it is necessary to subclone...it after a promoter and RBS. The 2015 UCLA iGEM team has made a composite...The expected size of the desired product is 406 bp. In addition to the...']"},{"machine":"BBa_K1434001","videoId":"BBa_K1434001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4M - [ Coding ] []"},{"machine":"BBa_K1763425","videoId":"BBa_K1763425","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4N - [ Composite ] ['RNA polymerase promoter and a strong RBS...protein expression because the T7 RNA polymerase promoter is not found in E....A common laboratory strain for protein expression is BL21 DE3 which is what...']"},{"machine":"BBa_K1445000","videoId":"BBa_K1445000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4O - [ Other ] ['The M13 origin of replication is a non coding sequence that facilitates the...This part does not code for phage coat proteins therefore cannot produce...pSB1C3 backbone therefore the nucleotide sequence is the only distinguishing...this sample packaged pSB1C3 amilCP. The M13ori is necessary and sufficient for...']"},{"machine":"BBa_K1763426","videoId":"BBa_K1763426","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 4P - [ Coding ] ['This is a 6 mer construct of MaSp2 constructed using Iterative Capped Assembly...This part is a coding sequence with no regulatory elements present. This...In order to express this construct as a protein it is necessary to subclone...it after a promoter and RBS. The 2015 UCLA iGEM team has made a composite...at different temperatures. The expected product size for MaSp2 6 is 712 bp....']"},{"machine":"BBa_K1362131","videoId":"BBa_K1362131","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5A - [ Composite ] []"},{"machine":"BBa_K1800002","videoId":"BBa_K1800002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5B - [ Coding,chassis, eukaryote, ntabacum ] ['et al. 1986 . Horseradish peroxidases is a peroxidase that has been used...IPTG. As shown in the following Figure the Escherichia coli growth is not...induction in minutes. The protein band is marked with an arrow...As it can be seen in the SDS PAGE the protein of interest is increasing over...time from the point of induction onwards. HRP is marked with a black arrow...']"},{"machine":"BBa_K1362172","videoId":"BBa_K1362172","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5C - [ Translational_Unit ] ['This part is the C terminal non splicing control half in a split sfGFP intein...']"},{"machine":"BBa_K1653006","videoId":"BBa_K1653006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5D - [ Coding ] ['intracellular concentration. This information is very beneficial for other... Here http 2015.igem.org Team Nagahama Medal Parts Gold is our result... g ml. This figure is suggesting that internalized geraniol could be more... marA product is more survived on 1.0 geraniol solution overlay plates than...']"},{"machine":"BBa_K1362173","videoId":"BBa_K1362173","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5E - [ Translational_Unit ] ['This part is the N terminal splicing half in a split sfGFP intein splicing...florescence is observed....']"},{"machine":"BBa_K1585211","videoId":"BBa_K1585211","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5F - [ Composite ] ['This is the translational unit of 3 hexulose 6 phosphate synthase Hps from...Bacillus methanolicus MGA3. It is codon optimized for E. coli ....']"},{"machine":"BBa_K1362174","videoId":"BBa_K1362174","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5G - [ Translational_Unit ] ['This part is the N terminal non splicing control half in a split sfGFP intein...']"},{"machine":"BBa_K1585212","videoId":"BBa_K1585212","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5H - [ Composite ] ['This is the translational unit of the 6 phospho 3 hexuloisomerase Phi from... Bacillus methanolicus MGA3. It is codon optimized for E. coli ....']"},{"machine":"BBa_K1362204","videoId":"BBa_K1362204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5I - [ Composite ] []"},{"machine":"BBa_K1585213","videoId":"BBa_K1585213","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5J - [ Composite ] ['This is the translational unit for the D Xylulose 5 phosphate phosphoketolase... Xpk . It derives from Bifidobacterium adolescentis and is codon optimized...']"},{"machine":"BBa_K1362205","videoId":"BBa_K1362205","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5K - [ Composite ] []"},{"machine":"BBa_K1585310","videoId":"BBa_K1585310","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5L - [ Composite ] ['This is the translational unit of GlgA Glycogen synthase codon optimized...bands for GlgA. mRFP in pSB1K30 T7 promoter was used as the negative...iodine staining is performed with Lugol s iodine which dyes glycogen resulting...in a brown color. If more glycogen is present the color of stainend cultures...glycogen is present. Therefore the functionality of the glycogen synthase is...']"},{"machine":"BBa_K1362060","videoId":"BBa_K1362060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5M - [ Protein_Domain ] []"},{"machine":"BBa_K1585312","videoId":"BBa_K1585312","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5N - [ Composite ] ['This is the translational unit of GlgC the ADP glucose pyrophophorylase. It... glgC was expressed in pSB1A30 and compared to mRFP in pSB1A30 T7 promoter ...iodine staining is performed with Lugol s iodine which dyes glycogen resulting...in a brown color. If more glycogen is present the color of stainend cultures...']"},{"machine":"BBa_K1362160","videoId":"BBa_K1362160","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5O - [ Composite ] ['Promoter T7 promoter ...']"},{"machine":"BBa_K1829001","videoId":"BBa_K1829001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 5P - [ Regulatory ] ['pBar1 Mating factor alpha responsive promoter...The pBar1 promoter is a mating factor alpha responsive promoter found...endogenously in MATa S. Cerevisiae. This promoter drives expression of Bar1 a...']"},{"machine":"BBa_K1478000","videoId":"BBa_K1478000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6A - [ Protein_Domain,chassis, eukaryote, athaliana, chassis, eukaryote, ntabacum, proteindomain, localization ] ['A GFP control without protein fusion is shown in lane A D. The signal is...specific for a cytosolic protein which is indicated by chloroplast surrounded...shows that it is located at the cell cover. Because it s a marker it s...location is already known. The analyzed construct is shown in I K. It contrast...']"},{"machine":"BBa_K1763427","videoId":"BBa_K1763427","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6B - [ Generator ] ['RNA polymerase promoter and a strong RBS...protein expression because the T7 RNA polymerase promoter is not found in E....A common laboratory strain for protein expression is BL21 DE3 which is what...']"},{"machine":"BBa_K1478001","videoId":"BBa_K1478001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6C - [ Protein_Domain,binding, cellulose, chassis, eukaryote, athaliana, chassis, eukaryote, ntabacum, proteindomain, binding ] ['A GFP control without protein fusion is shown in lane A D. The signal is...specific for a cytosolic protein which is indicated by chloroplast surrounded...shows that it is located at the cell cover. Because it s a marker it s...location is already known. The analyzed construct is shown in I K. It contrast...']"},{"machine":"BBa_K1763434","videoId":"BBa_K1763434","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6D - [ Coding ] ['This is a 9 mer construct of MaSp1 constructed using Iterative Capped Assembly...This part is a coding sequence with no regulatory elements present. This...In order to express this construct as a protein it is necessary to subclone...it after a promoter and RBS. The 2015 UCLA iGEM team has made a composite...expected product size is 1018 bp....']"},{"machine":"BBa_K1467201","videoId":"BBa_K1467201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6E - [ Reporter,cds, reporter, chromoprotein, function, reporter, pigment ] ['GoldenGate MoClo Assembly Standard as it is free from BsaI and BpiI...iGEM14 NRP UEA Norwich chose to use this part as one of their reporters as the...synthase MAS as the promoter and octopine synthase ocs as the terminator....The next stage of The Green Canary Project would be to use this part alongside...promoter Xa27 induced by the rice pathogen TALE AvrXa27. Similarly the...Yellow chomoprotein would be expressed on activation of the BS3 promoter by...']"},{"machine":"BBa_K1763435","videoId":"BBa_K1763435","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6F - [ Generator ] ['RNA polymerase promoter and a strong RBS...protein expression because the T7 RNA polymerase promoter is not found in E....A common laboratory strain for protein expression is BL21 DE3 which is what...']"},{"machine":"BBa_K1467204","videoId":"BBa_K1467204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6G - [ Reporter,cds, reporter, gfp, chassis, eukaryote, nbenthamiana, function, reporter, fluorescence ] ['This part originally isolated from Aequorea victoria fluoresces under UV...light when the gene is expressed. GFP absorbs light at a wavelength of 395nm...easily detectable under UV light expression is easily tracked making the...different promoters with the aim of determining which would be the most useful...PDF1.2 GFP ocs. In each case GFP protein has be transcribed and is shown as...florescence under UV light following activation of the promoter 35s is...']"},{"machine":"BBa_K1763438","videoId":"BBa_K1763438","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6H - [ Coding ] ['This is a 12 mer construct of MaSp1 and 2 constructed using Iterative Capped...This part is a coding sequence with no regulatory elements present. This...In order to express this construct as a protein it is necessary to subclone...it after a promoter and RBS. The 2015 UCLA iGEM team has made a composite...expected product size is 1324 bp....']"},{"machine":"BBa_K1423006","videoId":"BBa_K1423006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6I - [ Reporter ] [' WPI ATF1MetalPromoter.png http 2014.igem.org wiki images d df WPI ATF1MetalPromoter.png ...promoter J33201 and the composite part J45199 which is made up of a...metals such as arsenic and cadmium. Because isoamyl acetate is produced in...inducible promoter in comparison with constitutive expression we grew a 50 mL...']"},{"machine":"BBa_K1763439","videoId":"BBa_K1763439","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6J - [ Generator ] ['RNA polymerase promoter and a strong RBS...protein expression because the T7 RNA polymerase promoter is not found in E....A common laboratory strain for protein expression is BL21 DE3 which is what...']"},{"machine":"BBa_K1365000","videoId":"BBa_K1365000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6K - [ Coding ] ['NisP NisR and NisK of the nisin operon it is responsible for producing the...protein is first modified and then transported out of the cell. The serines...cyclized by NisC. After this process the precursor is transported out of the...cell 2 . Here the lead peptide is cut off by NisP 3 and the mature nisin...Nisin is a lantibiotic an bacteriocidal peptide. Nisin inhibits the growth of...or pathogens. Nisin is therefore extensively used in the food industry as a...This is a gene fragment that is responsible for the expression of protein...Thus we had characterized this part by first purifying the gene fragment and...']"},{"machine":"BBa_K1763440","videoId":"BBa_K1763440","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6L - [ Coding ] ['This is a 12 mer construct of MaSp1 and MaSp2 constructed using Iterative...This part is a coding sequence with no regulatory elements present. This...In order to express this construct as a protein it is necessary to subclone...it after a promoter and RBS. The 2015 UCLA iGEM team has made a composite...expected product size is 1324 bp....']"},{"machine":"BBa_K1365020","videoId":"BBa_K1365020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6M - [ Reporter ] []"},{"machine":"BBa_K1763441","videoId":"BBa_K1763441","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6N - [ Generator ] ['MaSp1 and MaSp2 12 mer block co polymer under control of T7 promoter and RBS....with a T7 RNA polymerase promoter and a strong RBS...protein expression because the T7 RNA polymerase promoter is not found in E....A common laboratory strain for protein expression is BL21 DE3 which is what...']"},{"machine":"BBa_K1399000","videoId":"BBa_K1399000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6O - [ Coding,cds, reporter, chromoprotein, chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['lower as newly formed protein is degraded as soon as it is formed....The tag encodes peptide sequence AANDENYAAAV and is recognized by ClpA and...proteosome like complex with ClpP protease and the protein is degraded Figure... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...']"},{"machine":"BBa_K1763442","videoId":"BBa_K1763442","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 6P - [ Coding ] ['This is a 3 mer construct of MaSp2 constructed using Iterative Capped Assembly...This part is a coding sequence with no regulatory elements present. This...In order to express this construct as a protein it is necessary to subclone...it after a promoter and RBS. The 2015 UCLA iGEM team has made a composite...this particular amplification has been lost. The following image represents...M1 2 1 2 12 is at the very right. The expected product size is 1324 bp....']"},{"machine":"BBa_K1362170","videoId":"BBa_K1362170","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7A - [ Translational_Unit ] ['This part serves as positive control in a split sfGFP intein splicing assay....']"},{"machine":"BBa_K1829002","videoId":"BBa_K1829002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7B - [ Regulatory ] ['pFig2c Mating factor alpha responsive promoter...pFig2c is a mating factor alpha responsive promoter meaning that it is...activated by the presence of mating factor alpha. It is endogenous in S....Cerevisiae cells and is followed by the Fig2c gene. The Fig2c gene is a part...the promoter. We induced the activation of pFig2c by the factor we...details http 2018.igem.org Team NEFU China Suicide So this part is...']"},{"machine":"BBa_K1362142","videoId":"BBa_K1362142","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7C - [ Composite ] []"},{"machine":"BBa_K1829003","videoId":"BBa_K1829003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7D - [ Terminator ] [' tENO2 is a terminator endogenous to S. cerevisiae....tENO2 is a terminator to the ENO2 gene. ...']"},{"machine":"BBa_K1362141","videoId":"BBa_K1362141","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7E - [ Composite ] []"},{"machine":"BBa_K1829004","videoId":"BBa_K1829004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7F - [ Terminator ] [' tFba1 is a terminator endogenous to S.cerevisiae....tFba1 is a terminator for the Fba1 gene....']"},{"machine":"BBa_K1362003","videoId":"BBa_K1362003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7G - [ Composite ] []"},{"machine":"BBa_K1724000","videoId":"BBa_K1724000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7H - [ Regulatory,function, sensor, metal ] ['CadA promoter is a cadmium sensitive promoter. Its repressor is MerR. In high...inhibition of CadA promoter. The reverse is the opposition.... 1.Promoter CadA quantification...promoter CadA. Promoter CadA is Cd activated promoter with the presence of...construct MerR CadA operon and place the RFP behind the CadA promoter. As the...ion is between 10 8 and 3 10 8. So we set up the gradient concentration 0 ...pattern of our promoter....This is the visible test on how different concentration of cadmium ion...promoter we detected the fluorescence intensity per OD once every 5 hour. We...can easily conclude that when the concentration is lower than 10 8 the...promoter wasn t activated. Followour gradient of concentration we have set the...Figure 2. The brief introduction of plasmid of the CadA promoter... 2.Detection limit of promoter CadA...In order to test the detection limit of the promoter CadA we first set up...estimate the probably range. As the result mentioned above the promoter CadA...promoter CadA....concentration is 3 10 9mol L or 1 10 8 mol L the medium didn t change into...red but thing goes different when the concentration is 3 10 8mol L and...Figure 4. The actual data of activation limit of promoter CadA after having...more than 10 7mol L the expression of RFP stays steady the maximum is near...cadmium to activate promoter CadA is between 10 8 and 3 10 8 mol L.... 3 . The specificity of the CadA promoter...Figure 6. The specificity of the MerR CadA promoter. As seen in the picture ...']"},{"machine":"BBa_K1362004","videoId":"BBa_K1362004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7I - [ Composite ] []"},{"machine":"BBa_K1582029","videoId":"BBa_K1582029","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7J - [ Composite ] ['RFC23 method which is specific for fusion protein. Thus if other teams want...']"},{"machine":"BBa_K1362005","videoId":"BBa_K1362005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7K - [ Composite ] []"},{"machine":"BBa_K1758105","videoId":"BBa_K1758105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7L - [ Generator ] ['mRFP generator under control of T7 promoter...mRFP is synthesized when T7 polymerase is present. This part is a mRFP...This part was used to charactize the effect of our designed translation...right This part. Both cultures were cultivated for the same time span. You...']"},{"machine":"BBa_K1362140","videoId":"BBa_K1362140","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7M - [ Composite ] []"},{"machine":"BBa_K1758106","videoId":"BBa_K1758106","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7N - [ Generator ] ['Translation enhancing 5 UTR mRFP under control of T7 promoter...mRFP is synthesized when T7 polymerase is present. This part is a mRFP...This part was used to charactize the effect of our designed translation...translation in general. We constructed PT7 UTR mRFP this part after...coli cultures. Left This part right ...']"},{"machine":"BBa_K1362202","videoId":"BBa_K1362202","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7O - [ Composite ] []"},{"machine":"BBa_K1758107","videoId":"BBa_K1758107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 7P - [ Composite ] ['SYFP2 under T7 promoter RBS...SYFP2 is synthesized when T7 polymerase is induced....When T7 polymerase is present SYFP2...Yellow fluorescence can be observed when the culture is excited with UV light...']"},{"machine":"BBa_K1399001","videoId":"BBa_K1399001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8A - [ Coding,cds, reporter, chromoprotein, chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['formed protein is degraded as soon as it is formed. LVA tag is commonly found...encodes peptide sequence AANDENYALVA and is recognized by ClpA and ClpX...like complex with ClpP protease and the protein is degraded Figure 1 . 1 ... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...Golden Gate assembly method. Thus it is a basic part compatible with both...']"},{"machine":"BBa_K1763443","videoId":"BBa_K1763443","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8B - [ Generator ] ['MaSp1 and MaSp 12 mer block co polymer under control of T7 promoter and RBS....RNA polymerase promoter and a strong RBS...protein expression because the T7 RNA polymerase promoter is not found in E....A common laboratory strain for protein expression is BL21 DE3 which is what...']"},{"machine":"BBa_K1399002","videoId":"BBa_K1399002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8C - [ Coding,cds, reporter, chromoprotein, chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['formed protein is degraded as soon as it is formed. The tag encodes peptide...sequence AANDENYALAA and is recognized by ClpA and ClpX unfoldases and ClpX...protease and the protein is degraded Figure 1 . 1 ... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...with ClpX and thus the final protein degradation rate. 2 The LAA tag is E....coli wild type ssrA tag and is reported to lead to very fast protein...']"},{"machine":"BBa_K1763007","videoId":"BBa_K1763007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8D - [ Composite ] ['Honeybee silk protein driven by T7 promoter...This part is the Apis Mellifera Honeybee silk protein coding region with a...composite t7 promoter element and ribosome binding site upstream part...spiders or silkworms. Although it is not quite as strong as these other types...importantly the gene sequence is non repetitive which allows us to...using one of these proteins Amelf3 is sufficient to reproduce the physical... Here is the SDS gel of our expression of the honeybee silk protein. It was purified using this inclusion body protocol http wolfson.huji.ac.il purification PDF Protein Expression Extraction NOVAGEN BugBuster protein extraction.pdf ... Here http 2015.igem.org Team UCLA Notebook Honeybee Silk 28 July 2015 is the link to the protocol that we used for expressing the protein starting from a colony. We were using Kanamycin as our antibiotic but chloramphenicol should be used if using this biobrick. ... Fig. 1 Expected size of product is 40.0 kDA... There are contaminating bands present on the SDS PAGE gel indicating that the purification is not completely effective. ...']"},{"machine":"BBa_K1399003","videoId":"BBa_K1399003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8E - [ Coding,cds, reporter, chromoprotein, chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['protein is degraded as soon as it is formed. The tag encodes peptide sequence...AANDENYADAS and is recognized by ClpA and ClpX unfoldases and ClpX mediator...and the protein is degraded Figure 1 . 1 ... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...that exact protein degradation rate is influenced by multiple other factors ...']"},{"machine":"BBa_K1763015","videoId":"BBa_K1763015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8F - [ Composite,Kit plates, silk ] ['T7 Promoter Silk sfGFP...This part is a fusion of the Apis mellifera Western Honey Bee silk protein...coding region and the superfolder GFP coding region. A T7 promoter regulatory...T7 promoter. This part produces Apis mellifera silk protein that can fluoresce...spiders or silkworms. Although it is not quite as strong as these other types...importantly the gene sequence is non repetitive which allows us to...using one of these proteins Amelf3 is sufficient to reproduce the physical...A goal of our project is to add new functionality to these fibers. As a proof...properties could be maintained after fusion to a foreign protein. sfGFP is a...']"},{"machine":"BBa_K1399005","videoId":"BBa_K1399005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8G - [ Coding,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['fluorescence amplitudes will be lower as newly formed protein is degraded as...soon as it is formed. The tag encodes peptide sequence AANDENYAAAV and is... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...']"},{"machine":"BBa_K1763421","videoId":"BBa_K1763421","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8H - [ Composite ] ['response to thrombin protease. What is a protein cage A protein cage is a...cage that we are working with is a previously designed synthetic protein cage ...to form a 109.5 degree angle. This angle is crucial in that it allows 12...symmetry. The goal of our project is to modify this protein cage such that...']"},{"machine":"BBa_K1399004","videoId":"BBa_K1399004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8I - [ Coding,cds, reporter, gfp, chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, fluorescence ] ['fluorescence amplitudes will be lower as newly formed protein is degraded as...soon as it is formed. The tag encodes peptide sequence AANDENYALVA and is... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...']"},{"machine":"BBa_K1763444","videoId":"BBa_K1763444","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8J - [ Generator,Kit plates, silk ] ['by an IPTG inducible LacI promoter Elowitz RBS and a 6x polyhistidine tag...While silk as a biomaterial is widely known for its remarkable mechanical...other chains while the NTD is responsible for protein trafficking and...biomaterial use is the relative difficulty and length of time in rearing...results indicate high expression levels driven by an IPTG inducible promoter...a co spinning module. This module is a genetic construct consisting of our...thereby functionalizing the fiber. Our goal is to develop optimize and...structure. Fibroin is the main protein of interest that we aim to attach...fibers. Preserving secondary structure is critical to preserve functionality....functional capacities. As a result there is much need to develop a new method...appropriate Bsa1 restriction sites. Also not shown is a 6X histidine tag used...The theory behind the co spinning methodology is to attach a functional domain...will flatten and stack up into Beta sheets and Beta sheet formation is the...co spinning methodology Bombyx mori silk dope is spiked with a small volume... 1. Successful development and experimental validation of our co spinning module as a tool to incorporate functional domains into wild type Bombyx mori silk dope with is then processed into a functional synthetic fiber. ...construct. NC is an abbreviation for N and C terminal domains of Bombyx...produced. This part is ligated in the standard registry pSB1C3 vector...cultures. Expression of the fusion protein is induced using IPTG and extracts...protein expression creating an IPTG inducible LacI promoter region... 7 the construct is appended with a Biobrick suffix for standard assembly...the extension temperature. Below is the reaction conditions setup ...indicating non specific expression from the LacI promoter. Starter cultures...that a higher concentration is needed to elute the tagged protein of interest ...promoter under ultraviolet illumination. This suggests that while the NC sfGFP...construct is inducible under the LacI promoter minimal protein expression is...potential is suggested by the insertion of the Protein G Albumin Binding...elution buffer is sufficient for high recovery of silk proteins of interest....']"},{"machine":"BBa_K1399006","videoId":"BBa_K1399006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8K - [ Coding,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['amplitudes will be lower as newly formed protein is degraded as soon as it is... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...']"},{"machine":"BBa_K1850010","videoId":"BBa_K1850010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8L - [ Coding ] ['This part contains the fimH adhesin with a HisTag fusion under control of...the titratable rhamnose promoter...infections in humans. The FimH adhesin is found at the tip of the pilus and...binds naturally to the sugar mannose. This part can be cotransformed with...to the mannose sugar which is displayed on their cell surface. This behaviour...Kit plate http cgsc.biology.yale.edu KeioList.php . If it is then induced...recover the ability to agglutinate yeast that is missing from the chassis...information. In this part fimH contains a 6xHistidine Tag inserted at the 225...A HisTag is string of repeated charged residues that has the ability to bind...measurement platform for future teams using this part....experimental setup is almost identical to how we imagine our nickel binding...mannose mediated agglutination of yeast cells. We then created this part by...colon cancer cells. We conducted a dot blot assay and found that this part...']"},{"machine":"BBa_K1399007","videoId":"BBa_K1399007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8M - [ Coding,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['fluorescence amplitudes will be lower as newly formed protein is degraded as...soon as it is formed. SsrA tags encode peptide sequence that is recognized by... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...protein is degraded. 1 The final three residues of the tag determines the...rate. 2 The NYADAS tag encodes peptide sequence AANDENYNYDAS is reported to...degradation rate is influenced by multiple other factors ClpXP and ClpAP...This part was GFP mut3b followed by a variation of the WT SsrA tag sequence ...protease which is highly variable with each substrate. Be aware of ClpX ...We constructed aTc inducible measurement pathway for this part to...']"},{"machine":"BBa_K1850011","videoId":"BBa_K1850011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8N - [ Coding ] ['This part contains the fimH adhesin with a HisTag fusion under control of...the titratable rhamnose promoter...infections in humans. The FimH adhesin is found at the tip of the pilus and...binds naturally to the sugar mannose. This part can be cotransformed with...to the mannose sugar which is displayed on their cell surface. This behaviour...Kit plate http cgsc.biology.yale.edu KeioList.php . If it is then induced...recover the ability to agglutinate yeast that is missing from the chassis...information. In this part fimH contains a 6xHistidine Tag inserted at the 225...A HisTag is string of repeated charged residues that has the ability to bind...measurement platform for future teams using this part....experimental setup is almost identical to how we imagine our nickel binding...']"},{"machine":"BBa_K1399008","videoId":"BBa_K1399008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8O - [ Coding,chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, function, reporter, fluorescence ] ['amplitudes will be lower as newly formed protein is degraded as soon as it is...formed. SsrA tags encode peptide sequence that is recognized by ClpA and ClpX... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...protein is degraded. 1 The final three residues of the tag determines the...rate. 2 The DAS tag encodes peptide sequence AANDENYADAS is reported to have...degradation rate is influenced by multiple other factors ClpXP and ClpAP...']"},{"machine":"BBa_K1850013","videoId":"BBa_K1850013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 8P - [ Coding ] ['of the pBad arabinose promoter...To express the fim operon this part must be switched into the low copy...control Delta B . Delta E is an overproducing strain which also shows a fim...A band. The inducer of interest is arabinose disregard the rhamnose induction...repressor protein as it is not plasmid encoded....']"},{"machine":"BBa_K1362500","videoId":"BBa_K1362500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9A - [ Coding ] []"},{"machine":"BBa_K1758120","videoId":"BBa_K1758120","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9B - [ Coding,awards, basic_part, 2015 ] ['protein is added to a cell free protein synthesis reaction the productivity...reaction is lowered due to the interaction with RraA protein therefore mRNA ...levels are stabilized. RNase E is brought to the in vitro reaction by E....RNase E is coded by the rne gene and is essential for E. coli . The protein...Airen showed that if RraA protein is added to a cell free protein synthesis...postulated that activity of RNase E in the reaction is lowered due to the...T7 promoter PT7 rne plasmid whereas a second strain carried an...We could verify Airens observation that RraA is a positive effector in cell ...when compared to a reaction were RraA is not present Airen ...The reason for this effect is investigated in detail in Airen ...shape of the fluorescence signal curve when RraA is present green dots ...indicates that the protein acts as stabilisator in our reaction. It is likely...If one is interested in obtaining high amounts of protein via CFPS the...addition of RraA or similar positive effectors is definitely recommended....']"},{"machine":"BBa_K1315001","videoId":"BBa_K1315001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9C - [ Regulatory,chassis, prokaryote, ecoli, promoter, regulation, positive ] ['The pqsA promoter from Pseudomonas ...This is a promoter from Pseudomonas aeruginosa that is positively regulated...The Pseudomonas quinolone signal PQS is imperative in modulating... P. aeruginosa is the main pathogen responsible for severe deterioration in... promoter ...']"},{"machine":"BBa_K1758203","videoId":"BBa_K1758203","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9D - [ Generator ] ['promoter...conformation and is released from the operator. Thus the transcription can...the bond to the DNA is broken. This disruption will be detected via a loss of...analyte the repressor is released The signal measured is generated by the...shift between protein DNA complexes and free DNA. It is visible that the...electrophoretic mobility shift assay EMSA . This is the verification of the...']"},{"machine":"BBa_K1315003","videoId":"BBa_K1315003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9E - [ Coding,cds, chassis, prokaryote, ecoli, function, cellsignalling, regulator ] ['This is the coding sequence for the RpfG regulation of pathogenicity factor G ...protein. It is the regulator in the two component signal transduction system...of Xanthomonas campestris pv. campestris that is activated by the sensor...activation of the manA promoter...been also suggested that this system is involved in linking environmental...component system is the most well understood one and is present in all...']"},{"machine":"BBa_K1758204","videoId":"BBa_K1758204","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9F - [ Generator ] ['promoter... gamma Hydroxybutyric acid is a component of date rape drugs. GBL is the...precursor molecul of GHB which is in chemical balance with GHB. As we wanted...GBL the repressor changes its conformation and is released from the operator....the bond to the DNA is broken. This disruption will be detected via a loss of...analyte the repressor is released The signal measured is generated by the...complexes and free DNA. It is visible that the labeled operator sites without...electrophoretic mobility shift assay EMSA . This is the verification of the...']"},{"machine":"BBa_K1315005","videoId":"BBa_K1315005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9G - [ Coding,cds, transcriptionalregulator, activator, chassis, prokaryote, ecoli, direction, forward, function, regulation, transcriptional, regulation, positive ] ['This is the coding sequence for the cAMP receptor like protein Clp . This is...a transcriptional activator that is normally inhibited by cyclic di GMP....Inhibition is alleviated by the RpfG...been also suggested that this system is involved in linking environmental...stimuli including DSF with pathogenicity in Xanthomonas campestris. DSF is a...system is the most well understood one and is present in all Xanthomonads....']"},{"machine":"BBa_K1758300","videoId":"BBa_K1758300","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9H - [ Reporter ] ['sfGFP controlled by T7 promoter and arsenic operator...This part consists of the sfGFP gene with a translation enhancing 5 UTR under...the control of the T7 promoter and arsenic operator. In combination with the... E. coli arsenic repressor arsR this part can be used as an arsenic...below no clear induction is observable when adding arsenic to the reaction....small and we measured a high background signal. We assume that this is due to...for our CFPS by exchanging the natural promoter for the T7 promoter and...induction. The reason is most likely that the distance between the T7 promoter...cloning strategy and would likely be suitable for E. coli promoters....However the T7 promoter requires the operator to be very close for an...']"},{"machine":"BBa_K1315006","videoId":"BBa_K1315006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9I - [ Regulatory,chassis, prokaryote, ecoli, promoter, regulation, positive ] ['The manA promoter from Xanthomonas campestris ...This is the manA gene promoter taken from Xanthomonas campestris pv.... campestris . It is activated by the transcriptional activator...binds to the promoter of manA and turns on its synthesis. Clp is usually... promoter ...']"},{"machine":"BBa_K1758301","videoId":"BBa_K1758301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9J - [ Coding ] ['His tagged arsenic repressor ArsR under control of the T7 promoter...This part consists of the arsenic repressor arsR of the chromosomal...arsenic operon of E. coli under control of the T7 promoter. The gene...them on an SDS PAGE to check if the purification was successful. ArsR is a...dimer with 26.6 kDa. In all three elution fractions there is a band which...which is an sfGFP gene under control of the T7 promoter and the arsenic...']"},{"machine":"BBa_K1315007","videoId":"BBa_K1315007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9K - [ Coding,cds, chassis, prokaryote, ecoli, function, cellsignalling, regulator ] ['This is the coding sequence of the BCAM0228 two component regulator of the...BDSF sensory BCAM0227 BCAM0228 system. This system is found in Burkholderia ...spp. It is suggested that it activates the cblD ...protein. The BCAM0228 regulator though is more similar to the OmpR two ...BCAM0228 is the hypothetical regulator of the BCAM0227 BCAM0228 system....BCAM0228 is designed to be used with...is the cblD promoter region and the sensor kinase BCAM2207 made by iGEM...possible an endogenous kinase or chemical is phosphorlylating BCAM0228 in E....coli . Troubleshooting is required....']"},{"machine":"BBa_K1758311","videoId":"BBa_K1758311","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9L - [ Generator ] ['mRFP under control of the chromium responsive promoter...chromium responsive Promoter with mRFP for detecition...This is the chromium responsive promoter including operator site which we used...']"},{"machine":"BBa_K1315008","videoId":"BBa_K1315008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9M - [ Regulatory ] ['The cblD promoter from Burkholderia ...This is a promoter that is activated by the OmpR like two component response... BDSF is picked up by the BCAM0227 sensor kinase that is hypothesised to...then activates transcription from the cblD promoter....']"},{"machine":"BBa_K1758312","videoId":"BBa_K1758312","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9N - [ Generator,function, sensor, metal ] ['chromate specific promoter chrP . The promoter is regulated by the chrP ...promoter is a sfGFP for detection of a fluorescence signal....this part cerates our chromium sensor....Our data lead to the conclusion that in a cell based system it is possible to...contains the gene chrB under the control of a constitutive promoter so that...the cell extract is enriched with repressor molecules. In addition to that we...added plasmid DNA of the chromium specific promoter chrP with 5 UTR sfGFP...under the control of T7 promoter...The T7 promoter is needed to get a better fluorescence expression....chromium repressor under the control of a constitutive promoter and strong RBS...Chromium s influence on the cell extract is minimal for low concentrations....the cell extract which is visible at concentrations of 120 g L and obvious...']"},{"machine":"BBa_K1315009","videoId":"BBa_K1315009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9O - [ Composite ] ['This is a composite part that consists of four previously submitted biobricks....This is a PAI 1 activated biosensor from that uses the lasB promoter...and it can then activate the lasB promoter...']"},{"machine":"BBa_K1758314","videoId":"BBa_K1758314","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 9P - [ Composite,function, sensor, metal ] ['Chromium responsive promoter under T7 promoter with UTR sfGFP...Chromium induceble promoter under the control of a T7 promoter with...This part is essential for our in vitro characterization of our chromium...sensor. The edition of T7 promoter to...CeBiTec Project CFPS target blank . We used this promoter for our chromium...sensor. Originaly its from Ochrobactrum triti ci5bvl1. this part cerates our...contains the gene chrB under the control of a constitutive promoter so that...the cell extract is enriched with repressor molecules. In addition to that we...added plasmid DNA of the chromium specific promoter chrP with 5 UTR sfGFP...under the control of T7 promoter...cell extract. The T7 promoter is needed to get a better fluorescence...repressor under the control of a constitutive promoter and strong RBS...Chromium s influence on the cell extract as shown in figure 7 is minimal for...the viability of the cell extract which is visible at concentrations of 120...specific cell extract is shown in figure 8. An increase of fluorescence at...induction of the chromium sensor. A factor which should be considered is the...showed that the influence of chromium at low concentrations is not...chromium inducible promoter with the repressor of team Dundee figure 10 11 ...']"},{"machine":"BBa_K1399010","videoId":"BBa_K1399010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10A - [ Reporter,cds, reporter, rfp, classic, generator, prct, classic, reporter, pret, function, reporter, fluorescence ] ['Lactose IPTG inducible promoter with RFP reporter tagged with AAV ssrA...degradation tag followed by terminator. The tagged RFP is actively degraded...fluorescence and promoter activity.... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...contributed to the characterization of this part by showing decreased...']"},{"machine":"BBa_K1692032","videoId":"BBa_K1692032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10B - [ Reporter ] ['amilCP blue chromoprotein with RBS and promoter...The chromoprotein amilCP is part of a family of GFP like fluorescent proteins...chromoproteins amilCP is non fluorescent and forms a tetramer resulting in a...2008 and is characterized by a strong color due to its very high molar...wavelength is 588nm Alieva et al. 2008 . Interestingly amilCP s max...absorption is shifted into the red spectrum by 10nm 592nm hence appearing...biological functions and interactions. Because this protein is not tagged with...coli cells. On this SDS PAGE gel electrophoresis the protein is visualized... 7. Supernatant should be colored if chromoprotein is present . Transfer this supernatant to new 1.5ml centrifuge tube to separate protein from cell debris.Likewise if the culture broth appears to be sufficiently colored due to the presence of protein in solution this can be used instead of lysed cells.... 4. Once the gel is degassed and ready it should be slightly viscous.... 1. Pour the column. Care should be taken to pour the entire column in one session as adding more gel afterwards will disrupt the matrix. Pour more gel than is necessary into the column as the mobile phase added afterwards will compress the gel be by a significant amount .... 1. The column is over packed. Remove the gel from the column and combine it with the remaining unused gel previously prepared. This homogenized the gel and reproduces a uniform matrix.... 2. The column is poisoned. When working with excessively contaminated samples they may bind permanently to the gel and prevent further elution. To fix remove the upper portion of the gel and dispose of it. Combine the remaining gel to the stock and repack the column.... 3. If the sample is highly contaminated perform a run on a smaller column to clean out most of the impurities and then run it on the true column....secondary structure is predominantly composed of sheets....secondary structures produce different spectra that is unique to the...minimum at 222nm and 208nm Van Holde et al. 2006 . This is followed by a...structure is predominantly composed of sheets as indicated by the single...expression is highest in E. coli ....37oC with shaking. Shaking is important as lack thereof will result in protein...accumulation at the bottom of the well and skew absorbance reading. It is also... 10th hour where a clear plateau is reached. The grey zones surrounding the...expression increase of amilCP is shown in figure 5 where absorbance of control...']"},{"machine":"BBa_K1399011","videoId":"BBa_K1399011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10C - [ Reporter,cds, reporter, rfp, classic, generator, prct, classic, reporter, pret, function, reporter, fluorescence ] ['Lactose IPTG inducible promoter with RBS RFP reporter tagged with LVA ssrA...degradation tag and terminator. The tagged RFP is actively degraded within...and promoter activity. This part can be considered as improved version of... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...contributed to the characterization of this part by showing decreased...']"},{"machine":"BBa_K1696001","videoId":"BBa_K1696001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10D - [ Coding ] ['In homofermentative lactic acid bacteria lactic acid is one of the major end...products of carbohydrate fermentation. The glucose is converted to pyruvate...Particularly L Lactic acid is one of the most important chiral molecules and...']"},{"machine":"BBa_K1399012","videoId":"BBa_K1399012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10E - [ Reporter,cds, reporter, rfp, classic, generator, prct, classic, reporter, pret, function, reporter, fluorescence ] ['Lactose IPTG inducible promoter with RBS RFP reporter tagged with LAA ssrA...degradation tag and terminator. The tagged RFP is actively degraded within...and promoter activity.... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...contributed to the characterization of this part by showing decreased...']"},{"machine":"BBa_K1696003","videoId":"BBa_K1696003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10F - [ Composite ] ['catalyzed by an NAD dependent L lactate dehydrogenase ldhA . 1 LDH is an...We choose a strong promoter strong RBS to construct L Lactate part. The...NAD dependent L lactate dehydrogenase gene is from Lactobacillus casei ....PFL is a crucial enzyme in the glucose metabolism under anaerobic condition ...pyruvate is consumed both in the PFL and LDH reactions. In the wild type E....coli LDH reaction is not as competitive as the reaction through PFL and...the metabolic flux. When the PFL pathway is blocked E. coli will conceivably...which the cell is rst transformed with a helper plasmid harboring genes...fragment is excised by I SceI and incorporated into the landing pad via...']"},{"machine":"BBa_K1399013","videoId":"BBa_K1399013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10G - [ Reporter,cds, reporter, rfp, classic, generator, prct, classic, reporter, pret, function, reporter, fluorescence ] ['Lactose IPTG inducible promoter with RFP reporter tagged with DAS ssrA...degradation tag followed by terminator. The tagged RFP is degraded within cell...promoter activity. Presence of SspB is crucial for effective protein... B The tag is recognized by ClpX unfoldase forming a complex with ClpP...contributed to the characterization of this part by showing decreased...']"},{"machine":"BBa_K1696005","videoId":"BBa_K1696005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10H - [ Reporter ] ['P170 Promoter...P170 is upregulated at low pH 6.0 6.5 during the transition to stationary...phase. The minimal DNA region required for both promoter activity and pH...transcriptional start site. This fragment lacked the consensus 35 promoter...region but it contained an extended 10 promoter region 1 . Besides a...inducible and growth phase dependent promoter P170 of Lactococcus...inducible promoters from Lactococcus lactis require the cis acting ACiD box...microplate reader. The result is showed in Fig.3.The result showed that the...is 123.693. while in pH7 the fluorescence intensity using P170 is 101.407....']"},{"machine":"BBa_K1445001","videoId":"BBa_K1445001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10I - [ Composite ] ['The M13 origin of replication is a non coding sequence that facilitates the...trcrRNA and promoter region upstream of the type II cas9 endonuclease....Downstream of the Cas9 protein is a minimal CRISPR array that includes two...CRISPR repeats flanking a spacer region. It is this spacer region that...determines what DNA sequence is targeted by the Cas9 endonuclease. The spacer...']"},{"machine":"BBa_K1696009","videoId":"BBa_K1696009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10J - [ Composite ] ['In the system promoter P170 has been creatively constructed into E.coli to...pretreatment. The characterization of this part was done using a P170 promoter...']"},{"machine":"BBa_K1331001","videoId":"BBa_K1331001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10K - [ Coding,cds, biosynthesis, cds, enzyme, chassis, prokaryote, ecoli ] ['This is an improvement of...biosynthesis in Pseudomonas aeruginosa . This part encodes...The noncoding sequence included in this part is for composition with rhlB. See...']"},{"machine":"BBa_K1696013","videoId":"BBa_K1696013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10L - [ Tag ] ['Mf ssrA tag1 is an identified pdt protein degradation tag variant that...residues 13 15 further for mutagenesis because this region is essential for...']"},{"machine":"BBa_K1331004","videoId":"BBa_K1331004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10M - [ Coding,cds, biosynthesis, cds, enzyme, chassis, prokaryote, ecoli ] ['This is an improvement of...biosynthesis in Pseudomonas aeruginosa . This part encodes...The noncoding sequence included in this part is for composition with rhlA and...']"},{"machine":"BBa_K1696015","videoId":"BBa_K1696015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10N - [ Composite ] []"},{"machine":"BBa_K1331002","videoId":"BBa_K1331002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10O - [ Coding,cds, biosynthesis, cds, transcriptionalregulator, chassis, prokaryote, ecoli ] ['This part encodes a transcription regulatory protein rhlR....The purpose of remaining the noncoding sequence is for composition with our...RhlR is necessary for transcriptional activation of the rhlAB genes encoding...RhlR binds to autoinducer molecules C4 HSL which is synthesized by rhlI and...the complex positively regulates the promoter of rhlAB consequently while... rhlR alone negtively regulates the rhlAB promoter ....']"},{"machine":"BBa_K1640018","videoId":"BBa_K1640018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 10P - [ Coding,awards, basic_part, 2015 ] ['The autotrophic gene ChlM is involved in the chlorophyll biosynthetic pathway...This part allows E. coli to express the Chlamydomonas reinhardtii derived...To demonstrate functionality of ChlM we added a lac promoter creating a lac ...converted 12 of the precursor molecule it is apparent that our expression of...']"},{"machine":"BBa_K1315010","videoId":"BBa_K1315010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11A - [ Composite ] ['This is a composite part that consists of four pre existing biobricks. It uses...the luxR promoter from Pseudomonas aeruginosa in conjunction with LasR to...consists of the tet promoter...PAI 1 does LasR form an active complex and then activate the luxR promoter...']"},{"machine":"BBa_K1758321","videoId":"BBa_K1758321","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11B - [ Generator,function, sensor, metal ] ['mRFP under control of copper responsive promoter...A copper iduceble promoter with RFP for detection...']"},{"machine":"BBa_K1315011","videoId":"BBa_K1315011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11C - [ Composite ] [' Pseudomonas AutoInducer 1 response unit lasB promoter ...This is a composite part that consists of three previously submitted...biobricks. This is the business end of a PAI 1 activated biosensor from that...It consists of a tet promoter from...and it can then activate the lasB promoter...']"},{"machine":"BBa_K1758323","videoId":"BBa_K1758323","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11D - [ Generator,function, sensor, metal ] ['UTR sfGFP under control of Copper responsive promoter...Copper induceble promoter with an untranslated region and sfGFP for detection...CopAP is the central component in obtaining copper homeostasis which exports...free copper from cytoplasm to the periplasm. This is enabled by copper induced...activation of the operon transcription via CueR. The CueR Cu is the DNA ... Yamamoto Ishihama 2005 . In our project this part is essential for the in...level using a T7 promoter which was realized in...copper specific promoter copAP . The promoter is regulated by CueR which...binds Cu 2 ions. We also used a sfGFP downstream the promoter for detection...a constitutive promoter with sfGFP under the control of the corresponding...promoter copAP ...consists of the activator under the control of a constitutive promoter...promoter sequence of the copper inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression...concentrations is shown in figure 4. The first ten hours show a strong...increase in fluorescence. After that the increase in fluorescence is slower....The shown data suggest that sensing copper with our device is possible even if...the resulting extract is enriched with the activator CueR. To this extract we...added plasmid DNA of the copper specific promoter copAP with 5 UTR sfGFP ...under the control of T7 promoter...The T7 promoter is needed to get a better fluorescence expression....activator under the control of a constitutive promoter and strong RBS...promoter without T7 upstream of the operator site with different copper...inducible promoter without T7 in front of the operator site with different...In addition we measured the operator device under the control of T7 promoter...inducible promoter with different copper concentrations. Error bars represent...higher levels. Therefore a reporter device under the control of T7 promoter...']"},{"machine":"BBa_K1315012","videoId":"BBa_K1315012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11E - [ Composite ] [' Pseudomonas AutoInducer 1 response unit luxR promoter ...This is a composite part that consists of three previously submitted...biobricks. This is the business end of a PAI 1 activated biosensor from that...It consists of a tet promoter from...and it can then activate the luxR promoter...This particular composite part has no reporter gene included so that it can be...']"},{"machine":"BBa_K1758325","videoId":"BBa_K1758325","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11F - [ Composite,function, sensor, metal ] ['Copper responsive promoter with T7 promoter and UTR sfGFP...Copper induceble promoter under the control of a T7 with 5 untranslated region...infront of a sfGFP wich is used for detection via fluorescence...E.coli K12. This includes the promoter copAP and its regulator CueR. CueR is a...ATPase pump Outten et al. 2000 . CopA is the central component in obtaining...This is enable by Copper induced activation of the operon transcription via...CueR. The CueR Cu is the DNA binding transcriptional dual regulator which...increased. This part is essential for our in vitro characterization of our...copper sensor. The edition of T7 promoter to...copper specific promoter copAP . The promoter is regulated by CueR which...binds Cu 2 ions. We also used a sfGFP downstream the promoter for detection...a constitutive promoter with sfGFP under the control of the corresponding...promoter copAP ...consists of the activator under the control of a constitutive promoter...promoter sequence of the copper inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression...concentrations is shown in figure 2. The first 10 hours show a strong increase...in fluorescence. After that the increase in fluorescence is slower. For better...fluorescence level difference for 60 min 150 min and 650 min is represented....The shown data suggest that sensing copper with our device is possible even if...the resulting extract is enriched with the activator CueR. To this extract we...added plasmid DNA of the copper specific promoter copAP with 5 UTR sfGFP ...under the control of T7 promoter...The T7 promoter is needed to get a better fluorescence expression....activator under the control of a constitutive promoter and strong RBS...promoter without T7 upstream of the operator site with different copper...inducible promoter without T7 in front of the operator site with different...In addition we measured the operator device under the control of T7 promoter...inducible promoter with different copper concentrations. Error bars represent...higher levels. Therefore a reporter device under the control of T7 promoter...']"},{"machine":"BBa_K1497008","videoId":"BBa_K1497008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11G - [ Coding ] ['functions. The hok D gene is located in the E. coli chromosome as part of...which can be controlled tightly if glucose is added to the medium....Additional experiments with different sets of promoters should be performed to...']"},{"machine":"BBa_K1758330","videoId":"BBa_K1758330","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11H - [ Composite ] ['Lead repressor under control of constitutive promoter and strong RBS...Lead promoter repressor under the control of konstitutive promoter K608002 ...the operon is regulated by the repressor pbrR. As a MerR like regulator its...constitutive promoter and the pbrA promoter for the lead depending expression...downstream of the pbrAP promoter. The binding of the repressor is reversible...and hence all genes downstream of the pbrAP promoter can be expressed. Like...So if no lead is present in the media the repressor binds to the operator box...and the pbrAP promoter is blocked meaning that the transcription of sfGFP ...is prevented. No fluorescence signal is the results. By supplementation of...lead the repressor is separated from the operator box and the genes...downstream of the promoter can be expressed....The pbrAP promoter the operator box and the PbrR repressor are parts of the...which is regulated by the repressor PbrR. The PbrR belongs to the MerR family ...of metal sensing regulatory proteins and is Pb2 inducible. Our sensor system...protein is the measured output signal figure 2 and figure 3 ....repressor under the control of a constitutive promoter ...promoter sequence of the lead inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression ...The kinetic of our sensors response to different lead concentrations is shown...level difference for 60 min 150 min and 650 min is represented....promoter strength in E. coli. Further reasons are most likely in the weak...']"},{"machine":"BBa_K1497009","videoId":"BBa_K1497009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11I - [ Coding,cds, biosynthesis, cds, biosynthesis, anthocyanins ] ['This part encodes the sequence for the enzyme Flavanone 3 hydroxylase F3H ...']"},{"machine":"BBa_K1758331","videoId":"BBa_K1758331","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11J - [ Generator,function, sensor, metal ] ['Lead responsive promoter with mRFP...lead responsive promoter with mRFP for detection...To check for the activity of the promoter in this construct fluorescence...To check if lead had some effect on the activity of the promoter DH5 alpha...the promoter still remained in a inactive state....Conclusion This part does not constitutively express RFP. Neither does it...']"},{"machine":"BBa_K1497010","videoId":"BBa_K1497010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11K - [ Coding,cds, biosynthesis, cds, biosynthesis, anthocyanins ] ['caryophyllus is an enzyme catalyzing the reversible conversion of...corresponding leucoanthocyanidin. This reaction is NADPH dependent Liew et...dihydroflavonol reductase gene and analysis of its promoter region 1....']"},{"machine":"BBa_K1758333","videoId":"BBa_K1758333","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11L - [ Composite,function, sensor, metal ] ['Lead repressor under control of constitutive promoter and strong RBS Lead...repressor under the control of a constitutive promoter with lead induceble...promoter and 5 untranslated region in front of a sfGFP for detection....metallidurans Ralstonia metallidurans . The promoter that we use is...PbrA. This part of the operon is regulated by the repressor pbrR. The PbrR...2001 . Our sensor system is comprised of PbrR which is under the control of a...constitutive promoter and PbrA as well as a 5 untranslated region which...controls the transcription of a sfGFP. The sfGFP protein is the measuring...downstream of the pbrAP promoter. The binding of the repressor is reversible...and hence all genes downstream of the pbrAP promoter can be expressed. Like...So if no lead is present in the media the repressor binds to the operator box...and the pbrAP promoter is blocked meaning that the transcription of sfGFP ...is prevented. No fluorescence signal is the results. By supplementation of...lead the repressor is separated from the operator box and the genes...downstream of the promoter can be expressed....The pbrAP promoter the operator box and the PbrR repressor are parts of the...which is regulated by the repressor PbrR. The PbrR belongs to the MerR family ...of metal sensing regulatory proteins and is Pb2 inducible. Our sensor system...protein is the measured output signal figure 2 and figure 3 ....repressor under the control of a constitutive promoter ...promoter sequence of the lead inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression ...The kinetic of our sensors response to different lead concentrations is shown...level difference for 60 min 150 min and 650 min is represented....promoter strength in E. coli. Further reasons are most likely in the weak...reporter gene is sfGFP a fluorescent protein....For characterization of this part we noted the endpoint fluorescence readouts...and then fluorescence is measured at saturation....graph the range is 0uM to 40uM in a linear scale of lead concentration. The...concentration graph the range is 0uM to 40uM in a logarithmic scale of lead...In the biosensor and in the bioremediation system the GFP used is superfolder...GFP sf GFP . This is the case for all instances of GFP mentioned in the...through time mins . This is when the cell is placed in an environment with...and then a decrease in GFP is observed. This is the behaviour of the system in...The constant value of GFP is observed because of a balance in the derepression...concentrations with different rates of transcription. GFP readout is taken at...60 minutes so that it is maximum for all systems....the range of detection of the biosensor. This is because the range linear GFP...increase is different for different transcription rates. Transcription rate is...biosensor. However this sensitivity is only at low Lead concentrations because...gives us more contrast in the range of 0 M to 10 M. This is the range of...We took several metal promoter parts from the distribution kit given to us by...the corresponding metal promoters....Some cells with other metal promoters were emitting fluorescence even before...we induced the cells with the toxins. As a result the metal promoters are...that the Lead promoter did not work. Team Bielefeld also concluded that there...promoter....']"},{"machine":"BBa_K1497011","videoId":"BBa_K1497011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11M - [ Translational_Unit,cds, biosynthesis, cds, biosynthesis, anthocyanins ] ['C terminus is very flexible and the rest of the ANS is highly rigid. ...proof that the C Terminal region is highly flexible and thus a obstacle to the...']"},{"machine":"BBa_K1758335","videoId":"BBa_K1758335","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11N - [ Composite,function, sensor, metal ] ['UTR sfGFP controlled by T7 promoter and lead responsive promoter...lead induceble promoter under the control of T7 Promoter with mRFP for...Characterization was conducted on this part to determine the plausibility of...suggests that this part does not function as described....']"},{"machine":"BBa_K1497013","videoId":"BBa_K1497013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11O - [ Translational_Unit,cds, biosynthesis, cds, biosynthesis, anthocyanins ] ['The biobrick B0034 DFR is a composite consisting of the biobrick DFR...caryophyllus is an enzyme catalyzing the reversible conversion of...corresponding leucoanthocyanidin. This reaction is NADPH dependent Liew et...dihydroflavonol reductase gene and analysis of its promoter region 1....']"},{"machine":"BBa_K1758342","videoId":"BBa_K1758342","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 11P - [ Generator,function, sensor, metal ] ['Mercury responsive promoter with UTR sfGFP This part is essential for our in...One of the already existing sensors we used for our system is the mercury...sensor consisting of MerR the activator and the mercury specific promoter... pmerT . The promoter is regulated by the MerR which binds Hg2 ions. Similar...the mer operon depends on the regulation by MerR its activator and promoter...promoter PmerT ...sensor we added a 5 UTR downstreamd of this promoter which increased the...consists of the activator under the control of a constitutive promoter ...promoter sequence of the mercury inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression ...kinetic of our sensors response to different mercury concentrations is shown...in figure 3. A strong increase in fluorescence levels is notecible after...for 120 min and 190 min is represented.... merR under the control of a constitutive promoter and the specific promoter...2 ions. The specific promoter is located upstream of the sfGFP CDS....Therefore the mercury in the medium is detected via formation of sfGFP. In...consisted of the mercury specific promoter pmerT with 5 UTR sfGFP. The...entire sequence was placed under the control of of T7 promoter ...T7 promoter is needed to get a better fluorescence expression....repressor under the control of a constitutive promoter and strong RBS... promoter construct used for in vivo characterisation ...promoter without T7 in front of the operator site with different mercury...inducible promoter without T7 in front of the operator site with different...the same expression level at different concentrations it is not possible to...There is a clearly noticeable increase in fluorescence after induction with...mercury. Even the threshold concentration which is given in the WHO...as well. The presented data suggested that maximal output is reached at...']"},{"machine":"BBa_K1331003","videoId":"BBa_K1331003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12A - [ Coding,cds, biosynthesis, cds, enzyme, chassis, prokaryote, ecoli ] ['This part encodes rhlI an acyl homoserine lactone synthase in Pseudomonas...RhlI is an acyl homoserine lactone synthase required for the synthesis of...promoter of rhlAB....The noncoding sequence included in this part is for composition with our part...']"},{"machine":"BBa_K1640008","videoId":"BBa_K1640008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12B - [ Coding ] ['gene and lac promoter driving expression.... PsbM is a Photosystem II core complex subunit. ... PsbZ is a stabilising protein for the Photosystem II Light Harvesting... PsbH is another Photosystem II core complex subunit. ...This part was designed in conjunction with...PsbZ also referred to as ycf9 is a highly conserved gene amongst... Ferreira et al. 2004 . PsbZ is found at the interface between PSII and light...suggesting this protein is involved in anchoring the two complexes Swiatek et...Visualisation of psbMZH showing expected banding is shown in the following...right lane showing EcoRI PstI double digest. This part has been sequenced to...']"},{"machine":"BBa_K1509000","videoId":"BBa_K1509000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12C - [ Coding,binding, metal, cds, transcriptionalregulator, repressor ] ['by binding to the smt operator promoter smtO P and dissociating in the...device the pigment gene was under control of metal induced promoter smtB ...system a responsive Cd2 inducible promoter and the viewable pigment gene...degree. Finally our system is easier to utilize and exhibits improved...']"},{"machine":"BBa_K1640006","videoId":"BBa_K1640006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12D - [ Coding ] [' Chlamydomonas reinhardtii psbE psbL and psbJ driven by Plac promoter ...This part forms operon 2 in our set of photosystem II operons ...The PsbL gene is a component of the photosystem II reaction centre. It...it encodes is not significantly involved in photochemical processes it has...Visualisation of psbELJ showing expected banding is shown in the following...digest right lane showing EcoRI PstI double digest. This part has been...']"},{"machine":"BBa_K1343014","videoId":"BBa_K1343014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12E - [ Reporter ] ['E.coli optimized green renilla luciferase under LuxR AHL regulated promoter...']"},{"machine":"BBa_K1640012","videoId":"BBa_K1640012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12F - [ Coding ] [' psbQ is Oxygen evolving enhancer protein 3 ... psbR is a 10 kDa photosystem II polypeptide...This part was designed in conjunction with...The psbQ gene encodes a 17 kDa protein that is located on the inner side of...ability to generate oxygen is impaired and psbV is destabilised Kashino Y. ...The psbR gene encodes a 10 kDA protein that is essential to the stable...assembly of psbP which is a component of the oxygen evolving complex of...photosystem II. The assembly of psbR is mediated by psbJ Suorsa M. et al. ...Visualisation of psbQR showing expected banding is shown in the following...EcoRI digest right lane showing EcoRI PstI double digest. This part has...protein is required in Arabidopsis for photosystem II assembly stability and...']"},{"machine":"BBa_K1416000","videoId":"BBa_K1416000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12G - [ Coding ] ['proper promoters and terminator. This part encodes for the incorporation of...This part was used by the UT Austin 2014 iGEM team in their ncAA kit...work they demonstrated that while ONBY itself is slightly toxic to the cells ...Additionally this part was also used in the UT Austin 2014 iGEM Photocage...ONBY pFRYC the level of GFP expression relative to RFP expression is set as a...absence of ncAA there is virtually no GFP expression relative to RFP...']"},{"machine":"BBa_K1640020","videoId":"BBa_K1640020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12H - [ Coding ] ['This part was designed in conjunction with...of the D1 D2 reaction centre complex is to transfer electrons from the...Iwata 2004 . In addition this protein is vital to the assembly of both the...Visualisation of psbA showing expected banding is shown in the following...digest right lane showing EcoRI PstI double digest. This part has been...reaction center polypeptide D1 is involved in the assembly of the oxygen ...']"},{"machine":"BBa_K1334002","videoId":"BBa_K1334002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12I - [ Regulatory ] ['A right promoter which can sense formaldehyde.There is a left promoter which... Figure3 A GFP is added downstream of the formaldehyde...promoter.jpg wiki images 1 1f Figure3 A GFP is added downstream of the formaldehyde promoter.jpg File Figure3 A GFP is added downstream of the formaldehyde promoter.jpg ...Figure 1 A GFP reporter is added downstream of the formaldehyde promoter....fluorescence absorbance is not generated by the absorbance difference.... Figure 4 The function test of the formaldehyde promoter which shows our...Figure 2 The function test of the formaldehyde promoter which shows our part...Formaldehyde is toxic to the cells as we know inhibiting cells growth if it... 2.The sensitivity of the promoter to formaldehyde...this promoter we measured the sensitivity of the promoter to formaldehyde...result showed that 0.8 mM formaldehyde is the best concentration for inducing...The formaldehyde promoter is one of the parts in our kill switch system....formaldehyde promoter is not good enough. Therefore we are trying to find a...way to improve the promoter....The formaldehyde promoter...contains hxlR coding sequence a weak promoter the formaldehyde promoter and...Firstly we changed the weak promoter to J23100 which is considered as a...strong promoter in the Anderson family and built...promoter has been changed and the binding sites are added....After designing different improvement of Formaldehyde promoters we were...verified together with the original formaldehyde promoter.... Fig 2. Different improvement of Formaldehyde promoters...Three types of promoter improvements were designed as above. Firstly we ve...characterized the strength of J23100 and weak promoter by measuring the...fluorescence OD600 of J23100 B0034 eCFP and weak promoter B0034 eCFP promoter...J23100 is far more stronger than weak promoter....China 2020 weak promoter.png ... Fig 3. Comparison of the strength of J23100 promoter and weak promoter by measuring the fluorescence OD600...As the figure shown above J23100 promoter can be used to enhance the strength...of formaldehyde promoter as a strong promoter. However the result of J23100...Then the three version of promoters were jointed with fluorescence protein...ECFP and we detected the fluorescence of ECFP as an indication of promoter...strength after formaldehyde induction which activated the promoters and...group increased but the improved promoters modified 1 3 are more obvious...than the registry formaldehyde promoter...Among the three modified promoters the third modified version appeared to be...the strongest one showed the highest ECFP fluorescence intensity. That is to...say the improved Formaldehyde promoters has a higher responsiveness to HCHO ...']"},{"machine":"BBa_K1614002","videoId":"BBa_K1614002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12J - [ Composite ] ['This part is the core of the RFC we propose RFC110 File BBF RFC...fragments or modules called parts. Its key advantage is that the assembly of...fusions and even has to be sequence specific base by base. This is the case...if the RNA transcript of the sequence is responsible for the function of the...bases that allow the easy substitution of a base. This part has been tested...be transcribed into RNA is considered being the RNA of Interest....']"},{"machine":"BBa_K1334000","videoId":"BBa_K1334000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12K - [ Regulatory ] ['A promoter activitated by formaldehyde....This promoter can sense the whether there is formaldehyde or not.It can be...activitated by formaldehyde with the help of the protein hxlR.This promoter...']"},{"machine":"BBa_K1614016","videoId":"BBa_K1614016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12L - [ RNA ] ['This BioBrick contains a T7 promoter a Hammerhead Ribozyme HHR a Malachite...each other. This construct is designed so that any RNA insert of interest... ROI can be cloned in front of the HHR. The HHR is needed to cleave the RNA...Aptamer is expressed and cleaved by the HDV ribozyme. The two RNA products can...was measured in a 384 well plate format.This Aptamer is fluorescent in...applied ROI. Thus the fluorescence is induced by the Malachite Green Aptamer...transcription efficiency is not hampered by the malachite green dye all in...']"},{"machine":"BBa_K1332001","videoId":"BBa_K1332001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12M - [ Coding ] ['A histidine tag is attached to a RFP that is coded by this part. So the RFP...']"},{"machine":"BBa_K1602000","videoId":"BBa_K1602000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12N - [ Translational_Unit ] ['This part is a composite of one coding gene and a strong RBS...We used this part for our D xylonic acid producing operon...']"},{"machine":"BBa_K1350005","videoId":"BBa_K1350005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12O - [ Coding ] ['Mdfa is an antiporter which can make E coli have a ability to tolerate high...']"},{"machine":"BBa_K1602001","videoId":"BBa_K1602001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 12P - [ Translational_Unit ] ['This part is a composite of one coding gene and a strong RBS...We used this part for our D xylonic acid producing operon...']"},{"machine":"BBa_K1497024","videoId":"BBa_K1497024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13A - [ Coding ] ['carbazol 9 yl 3 dimethylamino propan 2 ol . The GBD domain is locked by... Attention This part is not a twin. We had problems with the...The here presented BioBrick is improved for the construction of scaffold...backbone is ligated with an insert to create the desired sequence. For example...ligation creates a new scaffold BioBrick immediately which is again flanked...']"},{"machine":"BBa_K1758343","videoId":"BBa_K1758343","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13B - [ Composite,function, sensor, metal ] ['MerR activator under constitutive promoter and induceble merT promoter with 5...Mercury sensor activator under the control of the constitutive promoter...promoter and 5 untranslated region which increses the output of the sfGFP...which is used for detection....dependent operon. The expression of the Mer operon is regulated by the...activator MerR. The MeR transcription however is regulated by itself. Mercury...contains MerR which is under control of a constitutive promoter and specific...promoter MerT. sfGFP protein is used as measuring output signal and it s...transcription is controlled by the 5 untranslated region which enhances the...One of the already existing sensors we used for our system is the mercury...sensor consisting of MerR the activator and the mercury specific promoter... pmerT . The promoter is regulated by the MerR which binds Hg2 ions. Similar...the mer operon depends on the regulation by MerR its activator and promoter...promoter PmerT ...sensor we added a 5 UTR downstreamd of this promoter which increased the...control of a constitutive promoter ...promoter sequence of the mercury inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression ...consists of the activator under the control of a constitutive promoter ...promoter sequence of the mercury inducible promoter. An untranslated region in...front of the sfGFP which is used for detection enhances its expression ...kinetic of our sensors response to different mercury concentrations is shown...in figure 2. A strong increase in fluorescence levels is notecible after...for 120 min and 190 min is represented.... merR under the control of a constitutive promoter and the specific promoter...2 ions. The specific promoter is located upstream of the sfGFP CDS....Therefore the mercury in the medium is detected via formation of sfGFP. In...promoter J23101 in our basic mercury sensor design... The Hill constant EC50 is the inducer concentration that provokes half maximal activation of a sensor EC50 is negatively correlated with sensitivity.... KTop is the sensor s maximum output expression level KTop is positively correlated with output amplitude....We took several metal promoter parts from the distribution kit given to us by...the corresponding metal promoters....Some cells with other metal promoters were emitting fluorescence even before...we induced the cells with the toxins. As a result the metal promoters are...that is shown on the Bielefeld 2015 website. Therefore we can conclude that...the mercury promoter did not work....']"},{"machine":"BBa_K1497026","videoId":"BBa_K1497026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13C - [ Coding ] ['the syntrophin syn protein in Mus musculus . The PDZ domain is used as a... Attention This part is not a twin. We had problems with the...The here presented BioBrick is improved for the construction of scaffold...backbone is ligated with an insert to create the desired sequence. For example...ligation creates a new scaffold BioBrick immediately which is again flanked...']"},{"machine":"BBa_K1758360","videoId":"BBa_K1758360","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13D - [ Generator ] ['gabR gene and gabT promoter from Bacillus subtilis...This is a part of the gab operon of Bacillus subtilis. It includes the gene...promoter as well as the gabT promoter which is regulated by GabR. GabR is...inserted downstream of this part can therefore be induced by GABA....This part consists of the gabR gene from Bacillus subtilis and the intergenic...region between gabR and gabT which includes the promoters of both genes. gabR... Belitsky Boris R. 2004 Bacillus subtilis GabR a protein with DNA binding and aminotransferase domains is a PLP dependent transcriptional regulator. In Journal of molecular biology 340 4 pp. 655 664. DOI 10.1016 j.jmb.2004.05.020....We worked with this part because GABA is structurally related to GHB a...would be possible to detect this drug using this part in combination with a...reporter gene. We characterized this part after inserting mRFP1 downstream of...In addition we tested whether it is possible to directly induce our biosensor...']"},{"machine":"BBa_K1497028","videoId":"BBa_K1497028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13E - [ Coding ] ['proper ligand. The educt is channeled through the enzymes and converted to the...The protein scaffold is an assembly platform for ligand coupled target...']"},{"machine":"BBa_K1758361","videoId":"BBa_K1758361","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13F - [ Generator ] ['mRFP1 in the presence of aminobutyrate GABA . This device is consequently a...This part consists of the gabR gene from Bacillus subtilis with its natural...promoter and mRFP1 under control of the gabT promoter. gabR encodes a... Belitsky Boris R. 2004 Bacillus subtilis GabR a protein with DNA binding and aminotransferase domains is a PLP dependent transcriptional regulator. In Journal of molecular biology 340 4 pp. 655 664. DOI 10.1016 j.jmb.2004.05.020....We worked with this part because GABA is structurally related to GHB a...In addition we tested whether it is possible to directly induce our biosensor...']"},{"machine":"BBa_K1497029","videoId":"BBa_K1497029","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13G - [ Coding ] ['proper ligand. The educt is channeled through the enzymes and converted to the...The protein scaffold is an assembly platform for ligand coupled target...']"},{"machine":"BBa_K1758375","videoId":"BBa_K1758375","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13H - [ Other ] ['Pblc is the promoter of the blcABC operon from Agrobacterium tumefaciens ....This part was used to test the blc promoter. You can find detailed...information about the function of this promoter at...This part was used to build a GBL GHB responsive element. In presence of these...conformation and is therefore unable to bind the operator site within this...']"},{"machine":"BBa_K1497030","videoId":"BBa_K1497030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13I - [ Coding ] ['proper ligand. The educt is channeled through the enzymes and converted to the...The protein scaffold is an assembly platform for ligand coupled target...']"},{"machine":"BBa_K1758376","videoId":"BBa_K1758376","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13J - [ Generator ] ['This part contains all features from...synthesis CFPS assay. Upon induction of T7 polymerase sfGFP is produced....The following operator site from Agrobacterium tumefaciens is the binding...gene translation is weakened. BlcR weakens expression as long as no GHB or GBL...Sequences of this part was used in in vivo as well as in in vitro ...experiments. This part in particular was used as a control for our in vivo ...this part in pSB1C3....']"},{"machine":"BBa_K1497031","videoId":"BBa_K1497031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13K - [ Coding ] [' Usage and Biology The protein scaffold is an assembly platform for ligand...binds efficiently to the Ni NTA column. Therefore the scaffold band is not...values is similar to the expectation. The pI of the molecule lies between 5.8...and 6.2 at these pH values the protein is exprected to show the minimal...solubility. Accordingly there is less solved protein to interact with the dye...the energy that is necessary for denaturation. The experiments showed that the...scaffold protein is heat labile which explains the suggested expression...proper ligand. The educt is channeled through the enzymes and converted to the...the progression over 4 h is depicted. A band of increasing intensity at...']"},{"machine":"BBa_K1758377","videoId":"BBa_K1758377","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13L - [ Composite,awards, composite_part, 2015 ] [' tumor inducing plasmid . A. tumefaciens is able to utilize the uncommon...CeBiTec Project DateRapeDrugs Chai2007 . This operon is localized on the...is controlled by the repressor protein BlcR . When GBL is not present two...GBL in a first step. If GBL is taken up by an organism containing the operon ...it is processed to GHB that even stronger induces the operon. Further GHB is...Therefore our sensor is based on the repressor BlcR under the control of a...constitutive promoter and the binding sequence of the promoter Pblc. This...binding sequence is following an inducable T7 promoter. The promoter is...which is the output signal. The device can detect both GBL and GHB....For in vivo characterization of the biosensor device this part was...described in Pan et al. 2013 even when it is N terminal fused to sfGFP see...a certain limit. We observed that for GHB the tolerable dose is under 1 ...An E. coli strain carrying this part in pSB1C3 as described previously was...genetic approach was used. This plasmid is analog to our CFPS positive...CeBiTec Results CFPS except that T7 promoter is followed by the blc ...binds to GHB GHB is removed from the reaction and cannot act detrimentally on...the molecular machinery. ii The polymerase is no longer blocked by BlcR...GHB is stronger than on GBL....GHB when the observed fluorescence signal is normalized to signal generated in...system is very robust http 2015.igem.org Team Bielefeld ...']"},{"machine":"BBa_K1497032","videoId":"BBa_K1497032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13M - [ Coding ] ['The protein scaffold is an assembly platform for ligand coupled target...promoter is not entirely locked. A clear overproduction of the scaffold...protein is only reached after an incubation time of four hours. The...construction of the scaffold GSP His Cys is nearly identical to the scaffold...proper ligand. The educt is channeled through the enzymes and converted to the...the protein is present at 4h after induction. The scaffold protein has a size...']"},{"machine":"BBa_K1583100","videoId":"BBa_K1583100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13N - [ Coding,awards, part_Kit plate, 2015 ] ['This part is meant to express the csgA gene under control of L rhamnose ...inducible promoter. CsgA is a protein monomer which can aggregate to form...amyloid nanowires in natural biofilms of E.coli . This protein is transported...is ensured by the proteins CsgEFG. This part was designed to be able to...This part was characterized in three different experiments ...To be able to ensure that CsgA is expressed we added a gene encoding for...of the same rhamnose promoter...promoter works. In this experiment the fluorescence signal of our csgA...fluorescence. Finally as the fluorescence signal is normalized by the cell...density one can make statements about the activity of the rhamnose promoter....The promoter seems to not be active right after induction but more after 3 or...4 hours. This is in accordance with data from literature Wegerer et. al in...which a low amount of fluorescence with a rhamnose promoter was observed after...With this kinetic experiment we have proven that the rhamnose promoter does...surface. In the experiment our CsgA producing strain of E. coli is induced...rhamnose is not leading to a higher expression. The cells induced with a 0.2 ...To confirm that there is a real change between the analysed samples and the...']"},{"machine":"BBa_K1321090","videoId":"BBa_K1321090","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13O - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....solution and the metal concentration in solution is quantified by mass...the each elution is shown below with the final graph comparing between the...']"},{"machine":"BBa_K1659501","videoId":"BBa_K1659501","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 13P - [ Composite ] ['This composite part consists of the AI 2 quorum sensor inducible promoter...The Lsr quorum sensing pathway is a non species specific cell to cell...and is found in at least 55 strains of them most notably strains of E. coli ...messenger AI 2 is mediated by the enzymes Pfs and LuxS which metabolizes the...LsrR represses the pLsr promoter which endogeneously is upstream of the...this pLsr promoter which is also an existing part in the Registry to test the...promoter s function and gather some preliminary data to help us explore the... 4 Li J. et al. 2007. Quorum sensing in Escherichia coli is signaled by...']"},{"machine":"BBa_K1325001","videoId":"BBa_K1325001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14A - [ Coding ] ['There is currently no text in this page. You can search for this page...']"},{"machine":"BBa_K1602003","videoId":"BBa_K1602003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14B - [ Coding ] [' cadA is a gene coding for a cis aconitate decarboxylase in Aspergillus...']"},{"machine":"BBa_K1325002","videoId":"BBa_K1325002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14C - [ Coding ] ['There is currently no text in this page. You can search for this page...']"},{"machine":"BBa_K1602004","videoId":"BBa_K1602004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14D - [ Coding ] [' GRE3 is a gene coding for an aldose reductase. The reductase catalyzes...']"},{"machine":"BBa_K1325005","videoId":"BBa_K1325005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14E - [ Coding ] []"},{"machine":"BBa_K1602008","videoId":"BBa_K1602008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14F - [ Translational_Unit ] ['This part is a composite of one coding gene and a strong RBS...']"},{"machine":"BBa_K1325007","videoId":"BBa_K1325007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14G - [ Coding ] []"},{"machine":"BBa_K1602009","videoId":"BBa_K1602009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14H - [ Coding,awards, part_Kit plate, 2015 ] ['sequence is codon optimized for the usage in E. coli . ...']"},{"machine":"BBa_K1402008","videoId":"BBa_K1402008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14I - [ Regulatory ] ['FadD Promoter...This part is sensitive to long chain acyl CoA with a FadR binding site. In...that the transcription begins. E.coli uses this promoter to regulate fatty...']"},{"machine":"BBa_K1602010","videoId":"BBa_K1602010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14J - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1402010","videoId":"BBa_K1402010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14K - [ Regulatory,Kit plates, biofab, promoter, direction, forward, dna, nucleotide ] ['Lac Promoter...etc. The T7 lac promoter is a hybrid regulatory region consisting of the T7...promoter of T7 phage next to LacO. The hybrid design allows for strong...expression. It is a strong promoter. You can only use this part in E.Coli...it is leaky. But the leaky expression is unstable and it is slower than the...From Fig 3 we can conclude that the optimum IPTG concentration is 2.5mM ...which is corresponding to the result in Fig 2 C . However the expression...to see if the EGFP is expressed ... Kit plates biofab promoter ...']"},{"machine":"BBa_K1602011","videoId":"BBa_K1602011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14L - [ Coding ] []"},{"machine":"BBa_K1424000","videoId":"BBa_K1424000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14M - [ Other ] [' slr0168 with no known function. This open reading frame is used as a...used to evaluate mRNA expression of promoter probes using the lux and GFP...This is a prefix region of DNA for homologous recombination into a neutral...ADVANTAGES IN GENOME ENGINEERING APPLICATIONS This part can be used to...']"},{"machine":"BBa_K1602012","videoId":"BBa_K1602012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14N - [ Coding ] []"},{"machine":"BBa_K1424003","videoId":"BBa_K1424003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14O - [ Regulatory ] ['ADVANTAGES IN GENOME ENGINEERING APPLICATIONS This part can be used to select...']"},{"machine":"BBa_K1602013","videoId":"BBa_K1602013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 14P - [ Coding ] ['enzyme is able to reduce a broad range of small aldehyde substrates like...']"},{"machine":"BBa_K1321092","videoId":"BBa_K1321092","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15A - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....solution and the metal concentration in solution is quantified by mass...']"},{"machine":"BBa_K1659301","videoId":"BBa_K1659301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15B - [ Composite ] ['This part contains the sequence for the Staphylococcus aureus derived...Micrococcal DNase is an endo exonuclease that non specifically catalyzes the...the presence of Ca2 ions and is known to be able to speed up DNA hydrolysis...It is a well established fact that extracellular DNA is a vital structural...DsbA is a thioredoxin fold containing disulfide oxidoreductase protein found...factor 12 13 . The 2 19 peptide sequence of DsbA is a signal sequence that...the DsbA signal sequence is capable of mediating passenger protein secretion...via the SRP pathway. A hexahistidine tag is also attached onto the C terminus...As far as enzyme function is concerned we are interested in the antibiofilm...To characterize this part we moved the DsbA DNase coding sequence into the...This DsbA DNase pBAD plasmid is then cloned into E. coli MG1655....Lane C is where the stained eluate was loaded DsbA DNase is a 21kDa protein ...']"},{"machine":"BBa_K1321094","videoId":"BBa_K1321094","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15C - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1659200","videoId":"BBa_K1659200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15D - [ Coding ] ['This part contains the sequence for the biofilm degrading enzyme Dispersin B....Dispersin B is an enzyme produced by Aggregatibacter actinomycetemcomitans ...acetylglucosamine PGA which is a polysaccharide structural element found in...polymers over 1 4 NAG is because of the anchimeric assisted mechanism...Dispersin B is currently patented and licensed to Kane Biotech which is...']"},{"machine":"BBa_K1321200","videoId":"BBa_K1321200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15E - [ Generator ] ['This part is a hemoglobin isolated from Vitreoscilla VHb expressed behind a...strong Anderson promoter and a strong RBS. VHb is a monomeric heme containing...scarce resulting in increased cell metabolism. This part contains a...constitute promoter and RBS ready for expression....of Vitreoscilla hemoglobin is superior to horse heart myoglobin or yeast...production of cephalosporin C by Aecremonium chrysogenum is improved by the...the OD600 data is reliable....In iGEM14 Imperial project VHb is used in Gluconacetobacter xylinus strain to...colony is bigger and contains more mRFP.... Figure 1. Left is E. coli BL21 strain only containing mRFP. Right is E. coli...BL21 strain containing mRFP plus VHb. The colony right is bigger and contains...of VHb cost energy. But if the volume of energy cost is lower than what VHb...concentration is an important factor. And we raise a theory called VHb energy...cost theory in our modeling part. The result is shown in the part information...when oxygen supply is efficient. For more details and analysis please visit...condition the tendency is similar. It may be due to the high volume liquid... mRFP fluorescence is higher in later stage. ...fluorescence is higher in 5ml system. ...the division is negative number. As the oxygen concentration raises up the...strain without VHb. Division is positive number. When oxygen supply is totally...content the energy cost on synthesis VHb is less than what VHb can bring. The...division is negative number. The result fits our experiment data and...usage of the engineering bacteria so we considered this part to get the VHb...promoters as shown in figure 2....improved this part by creating a composite part CD63 Vhb Fusion Protein...thus proving the function of Vhb is not disturbed. Also color difference can...its function of growth promotion. The new part is ...and it automatically transported into the exosomes. The new part is ...']"},{"machine":"BBa_K1659210","videoId":"BBa_K1659210","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15F - [ Coding,Kit plates, biofilm ] ['This part contains the sequence for the biofilm degrading enzyme Dispersin B...Dispersin B is an enzyme produced by Aggregatibacter actinomycetemcomitans ...acetylglucosamine PGA which is a polysaccharide structural element found in...polymers over 1 4 NAG is because of the anchimeric assisted mechanism...Dispersin B is currently patented and licensed to Kane Biotech which is...']"},{"machine":"BBa_K1321005","videoId":"BBa_K1321005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15G - [ Coding ] ['The main metal PCs confer tolerance to is Cadmium...We used this part to create a library of different cellulose binding domains...solution and the metal concentration in solution is quantified by mass...']"},{"machine":"BBa_K1659100","videoId":"BBa_K1659100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15H - [ Coding,Kit plates, antimicrobial ] ['This part contains the sequence for the antimicrobial protein microcin S...against closely related species and microcin S is produced by Escherichia...coli G3 10 which is present in the probiotic drug Symbioflor 2 that has been...MccS. They fused the protein YebF which is able to facilitate the export of...To characterize this part we moved the MccS coding sequence into the...MccS pBAD plasmid is then cloned into E. coli MG1655 and RP437 FliC....From the data we can clearly draw 2 conclusions 1 . MccS is more toxic to...']"},{"machine":"BBa_K1321009","videoId":"BBa_K1321009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15I - [ Coding ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...of the sequence are included the RFC25 prefix and suffix which is not shown....It is a histidine rich metal binding protein which binds up to 5 Ni2 ions...']"},{"machine":"BBa_K1659211","videoId":"BBa_K1659211","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15J - [ Composite ] ['This part contains the sequence for the biofilm degrading enzyme Dispersin B...Dispersin B is an enzyme produced by Aggregatibacter actinomycetemcomitans ...acetylglucosamine PGA which is a polysaccharide structural element found in...polymers over 1 4 NAG is because of the anchimeric assisted mechanism...Dispersin B is currently patented and licensed to Kane Biotech which is...DsbA is a thioredoxin fold containing disulfide oxidoreductase protein found...factor 8 9 . The 2 19 peptide sequence of DsbA is a signal sequence that can...the DsbA signal sequence is capable of mediating passenger protein secretion...pathway. A hexahistidine tag is also attached onto the C terminus of the...As far as enzyme function is concerned we are interested in the antibiofilm...To characterize this part we moved the DsbA DspB coding sequence into the...This DsbA DspB pBAD plasmid is then cloned into E. coli MG1655....Lane D is where the stained eluate was loaded DsbA DspB is a 45kDa protein ...We conclude that this part works as we have conclusively proven ...']"},{"machine":"BBa_K1321337","videoId":"BBa_K1321337","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15K - [ Coding,cds, reporter, gfp, function, reporter, fluorescence ] ['Superfolder Green Fluorescent Protein sfGFP is a mutant of mut3b GFP E0040 ...']"},{"machine":"BBa_K1659002","videoId":"BBa_K1659002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15L - [ Composite,Kit plates, antimicrobial ] ['This part contains the sequence for the antimicrobial protein Art 175 with...however is unsuitable for clinical applications because it is also hemolytic...Art 175 the product of their linkage is able to use its SMAP 29 moiety to...the chemotype selectivity of KZ144 is hence ineffective against bacteria of...DsbA is a thioredoxin fold containing disulfide oxidoreductase protein found...factor 5 6 . The 2 19 peptide sequence of DsbA is a signal sequence that can...DsbA signal sequence is capable of mediating passenger protein secretion under...A hexahistidine tag is also attached onto the C terminus of the composite to...In view of the fact that the N terminus of the SMAP 29 is essential for its...Since our project is on the topic of antimicrobial resistance or more...specifically biofilm related ones our aim is to use this part to create host...organism strains that are capable of secreting Art 175 which is able to kill...To characterize this part we moved the DsbA Art175 coding sequence into the...This DsbA Art175 pBAD plasmid is then cloned into E. coli RP437 FliC....rpm shaking. RP437 FliC pBAD HisB is E. coli RP437 FliC having a blank...rpm shaking. RP437 FliC pBAD HisB is E. coli RP437 FliC having a blank...suggesting that at this temperature DsbA Art175 is successfully produced and...induction of gene expression at 27 C is shown to result in death of host cells...We conclude that this part works as expected with the 27 C induction data...without secretion tag in that when Art 175 is not secreted there is no cell...lysis whereas when Art 175 is secretion tagged such as in this part there is...that the supernatant of the host cell for this part is able to kill P....putida suggests that DsbA Art175 is indeed exported successfully into the...moiety is not affected by the process as well as the addition of an extra...Defraine V. Lavigne R. 2014. Art 175 is a highly efficient antibacterial...']"},{"machine":"BBa_K1321338","videoId":"BBa_K1321338","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15M - [ Coding ] ['This part enables easy addition of a promoter and RBS to any coding part which...does not already have these parts. We used this part as an expression vector...allow us to actually express the protein. This part can be used to clone in... This backbone part is cut with SpeI and PstI... The desired insert part is cut with XbaI and PstI... The resulting SpeI XbaI scar is TACTAGA where the last A is the first A of the subsequent ATG start codon....different combinations of promoter or RBS. For example we also used part...']"},{"machine":"BBa_K1659003","videoId":"BBa_K1659003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15N - [ Composite,awards, basic_part, 2015, Kit plates, antimicrobial ] ['This part contains the sequence for the antimicrobial protein Art 175 with...however is unsuitable for clinical applications because it is also hemolytic...Art 175 the product of their linkage is able to use its SMAP 29 moiety to...the chemotype selectivity of KZ144 is hence ineffective against bacteria of...YebF is a 13kDa protein of unknown function that is perhaps the only protein...inner membrane via the Sec pathway and is cleaved upon translocation into the...fusion protein s export from the host cell. A hexahistidine tag is also...In view of the fact that the N terminus of the SMAP 29 is essential for its...Since our project is on the topic of antimicrobial resistance or more...specifically biofilm related ones our aim is to use this part to create host...organism strains that are capable of secreting Art 175 which is able to kill...To characterize this part we moved the YebF Art175 coding sequence into the...This YebF Art175 pBAD plasmid is then cloned into E. coli MG1655....rpm shaking. MG1655 pBAD HisB is E. coli MG1655 having a blank pBAD HisB...very significant extent of host cell killing is still observed. This implies...that YebF is a more effective secretion tag than DsbA or Fla giving rise to a...enterocolitica that is known to have a stronger peptidoglycan layer than lab...hours induction. Based on this data it is shown that IML421asd is a more...of growth confer to bacteria is their entering of metabolically inactive...We conclude that this part works as expected with host cell lysis occuring to...Defraine V. Lavigne R. 2014. Art 175 is a highly efficient antibacterial...']"},{"machine":"BBa_K1321339","videoId":"BBa_K1321339","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15O - [ Coding,binding, cellulose ] ['fimi with an endogenous C terminal linker. The part is in Freiburg format... UniProt P07984 http www.uniprot.org uniprot P07984 and is from the CBM...The linker sequence PTTSPTPTPTPTTPTPTPTPTPTPTPTVTP is Pro Thr box which has...binding regions is reversed...']"},{"machine":"BBa_K1659001","videoId":"BBa_K1659001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 15P - [ Composite,Kit plates, antimicrobial ] ['This part contains the sequence for the antimicrobial protein Art 175 with...however is unsuitable for clinical applications because it is also hemolytic...Art 175 the product of their linkage is able to use its SMAP 29 moiety to...the chemotype selectivity of KZ144 is hence ineffective against bacteria of... Salmonella flagellin is its 26 47 amino acid residue segment 5 ....SRP pathway. A hexahistidine tag is also attached onto the C terminus of the...In view of the fact that the N terminus of the SMAP 29 is essential for its...Since our project is on the topic of antimicrobial resistance or more...specifically biofilm related ones our aim is to use this part to create host...organism strains that are capable of secreting Art 175 which is able to kill...To characterize this part we moved the Fla Art175 coding sequence into the...This Fla Art175 pBAD plasmid is then cloned into E. coli MG1655....rpm shaking. MG1655 pBAD HisB is E. coli MG1655 having a blank pBAD HisB...rpm shaking. MG1655 pBAD HisB is E. coli MG1655 having a blank pBAD HisB...suggesting that at this temperature Fla Art175 is successfully produced and...We conclude that this part works as expected with the 27 C induction data...without secretion tag in that when Art 175 is not secreted there is no cell...lysis whereas when Art 175 is secretion tagged such as in this part there is...Defraine V. Lavigne R. 2014. Art 175 is a highly efficient antibacterial...']"},{"machine":"BBa_K1373000","videoId":"BBa_K1373000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16A - [ Coding ] ['This part encodes NAD synthetase...Intracellular redox state of electricity active cells EAC is one of the most...biosynthesis Fig. 1 the NAD level is increased thereby up regulating genes...']"},{"machine":"BBa_K1602014","videoId":"BBa_K1602014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16B - [ Translational_Unit ] ['This part is a composite of one coding gene and a strong RBS...This part makes it possible to establish an ethyleneglycol producing pathway...']"},{"machine":"BBa_K1365169","videoId":"BBa_K1365169","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16C - [ Coding ] []"},{"machine":"BBa_K1602016","videoId":"BBa_K1602016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16D - [ Composite ] ['This part is a composite of two coding genes and one strong RBS per gene...']"},{"machine":"BBa_K1393001","videoId":"BBa_K1393001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16E - [ Coding,binding, metal ] ['The OprF is a major outer membrane protein of Pseudomonas aeruginosa. This...outer membrane integrity and is required for growth under low osmolality. The...potential fusion sites for displaying CBP. CBP is the abbreviation of copper...ion is indeed harmful to the growth of bacteria....possible reason is that fusion expressed CBP and oprF are so close to affect...oprF GS CBP is significantly and consistently better than that of E. coli ...carrying oprF CBP or pET28a vector. It proves that 1 a GS linker is necessary...']"},{"machine":"BBa_K1602020","videoId":"BBa_K1602020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16F - [ Generator,awards, part_Kit plate, 2015 ] ['as degradation of a varaiety of substrates. HiC is a monomeric enzyme with its...active site at its surface. Due to this unique feature HiC is capable to...the pH indicator. The occurance of the change in color for BTB is at a pH of...minute rpm at 37 C until an OD of 0.6 is reached you can start induction...assay is perfect for studying enzyme kinetics of HiC in real time and high...was measured at the absorption maximum of BTB which in this case is 620nm....temperature. The HiC is capable of degrading the prepolymer and in this...']"},{"machine":"BBa_K1460004","videoId":"BBa_K1460004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16G - [ Composite,binding, metal ] ['Anderson Promoter MerT MerP ter...This is a functional coding sequence for the mercury transport proteins...merT merP from P. aeruginosa . This part will result in mercury intolerance...']"},{"machine":"BBa_K1602025","videoId":"BBa_K1602025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16H - [ Composite ] ['This part is encodes for the green fluorescent protein GFP . It also...Histag is fused to the gene sequence improving the purification yield. Fusing...']"},{"machine":"BBa_K1460003","videoId":"BBa_K1460003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16I - [ Composite,binding, metal ] ['Anderson Promoter NixA Ter...This is a functional coding sequence for the protein NixA which is a nickel...transporter from H. pylori. This part will result in nickel intolerance from...']"},{"machine":"BBa_K1602027","videoId":"BBa_K1602027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16J - [ Coding ] ['Protein scaffold with N terminal HisTag This part is capable of generating the...immobilized enzyme system. Also the sequence of a Histag is fused to the gene...']"},{"machine":"BBa_K1460002","videoId":"BBa_K1460002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16K - [ Composite,binding, metal ] ['This part serves as a functional metallothionein for heavy metal binding and...promoter. CRS5 gene is the metallothionein that binds to heavy metals and it...The expected size of Met GS mRFP is approximately 35 kDa but we observed a...was not present in the empty vector sample. This discrepancy in size is likely...that was used as a control. This discrepancy in size is likely due to post ...By the Beer lambert law concentration is directly proportional to absorbance....supernatant was measured using a spectrophotometer. It is expected that the...protein as compared to the RFP only negative control. There is a percent...as a negative control. Error bars represent standard error. There is a 31.7 ...compared the absorbance at 607nm which is the emission peak of mRFP Basic...the four groups. It is expected that the cells expressing the Met GS mRFP...protein will have a higher absorbance value at OD607 as it is the peak...protein is much darker than the cells expressing the Met protein only...']"},{"machine":"BBa_K1602028","videoId":"BBa_K1602028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16L - [ Composite ] ['His tag is fused to the gene sequence improving the purification yield. Also...the production is codon optimized for growth in E. coli using part...']"},{"machine":"BBa_K1364007","videoId":"BBa_K1364007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16M - [ Composite,chassis, prokaryote, bsubtilis ] ['The Gastrodia anti fungal protein GAFP 1 also known as gastrodianin is a...thousands of years. GAFP 1 is composed of 15 amino acids LDSLSFSYNNFEEDD and...This part is composed of a strong RBS and the coding sequence of the Gastrodia...']"},{"machine":"BBa_K1602031","videoId":"BBa_K1602031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16N - [ Composite ] ['His tag is fused to the C terminus improving the purification yield. Fusing...']"},{"machine":"BBa_K1312005","videoId":"BBa_K1312005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16O - [ Coding ] ['This part is S adenosyl methionine dependent methyltransferase gene of...']"},{"machine":"BBa_K1602034","videoId":"BBa_K1602034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 16P - [ Coding ] []"},{"machine":"BBa_K1321340","videoId":"BBa_K1321340","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17A - [ Coding,binding, cellulose ] ['internal linker sequence between the two domains which is derived from the...This part is based on the double cellulose binding domain construct...own. The main difference is that our part contains an additional linker...sequence is PGANPPGTTTTSRPATTTGSSPGP which is the same as used by Linder et...acids are from the cbh2 endogenous linker and the rest is from the cbh1...endogenous linker. CBDcbh1 is placed C terminal to CBDcbh2 because naturally...CBDcbh1 is a C terminal domain and CBDcbh2 is an N terminal domain. Both CBDs...solution and the metal concentration in solution is quantified by mass...extremely sharp the dCBD is definitely bound to the cellulose substrate and...the hydrophobic protein is certainly performing its function. On the smaller...channels which is indicative of its functionality on lower resolution ranges....The effectiveness of the hydrophobic domain is only made possible by the...']"},{"machine":"BBa_K1659000","videoId":"BBa_K1659000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17B - [ Coding,Kit plates, antimicrobial ] ['This part contains the sequence for the antimicrobial protein Art 175....however is unsuitable for clinical applications because it is also hemolytic...Art 175 the product of their linkage is able to use its SMAP 29 moiety to...the chemotype selectivity of KZ144 is hence ineffective against bacteria of...We aim to test this part for antibacterial activity by means of protein...antibacterial potency of this part will serve as a standard which we will...To characterize this part we moved the Art 175 coding sequence into the...This Art175 pBAD plasmid is then cloned into E. coli MG1655....When Art 175 is produced and retained intracellularly it should not be able...rpm shaking. MG1655 pBAD HisB is E. coli MG1655 having a blank pBAD HisB...The results above show that when E. coli MG1655 is not killed even under...pBAD HisB. We can infer from these results that either Art 175 is not being...produced at all or Art 175 is indeed being produced and that our hypothesis...that it cannot kill our cells from intracellularly is correct. Given how the...in this part Art 175 is indeed being produced and is not lysing its expression...expression is induced by L ara....As such we can conclude that this part works as expected in that its gene...Defraine V. Lavigne R. 2014. Art 175 is a highly efficient antibacterial...']"},{"machine":"BBa_K1321341","videoId":"BBa_K1321341","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17C - [ Coding,binding, cellulose, cds, reporter, gfp ] ['This construct is part of a library of sfGFP fusions with cellulose binding...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1659201","videoId":"BBa_K1659201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17D - [ Composite ] ['This part contains the sequence for the biofilm degrading enzyme Dispersin B...Dispersin B is an enzyme produced by Aggregatibacter actinomycetemcomitans ...acetylglucosamine PGA which is a polysaccharide structural element found in...polymers over 1 4 NAG is because of the anchimeric assisted mechanism...Dispersin B is currently patented and licensed to Kane Biotech which is...DsbA is a thioredoxin fold containing disulfide oxidoreductase protein found...factor 8 9 . The 2 19 peptide sequence of DsbA is a signal sequence that can...the DsbA signal sequence is capable of mediating passenger protein secretion...pathway. A hexahistidine tag is also attached onto the C terminus of the...As far as enzyme function is concerned we are interested in the antibiofilm...']"},{"machine":"BBa_K1321342","videoId":"BBa_K1321342","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17E - [ Coding,binding, cellulose, cds, reporter, gfp ] ['This construct is part of a library of Super folder GFP fusions with cellulose...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1598001","videoId":"BBa_K1598001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17F - [ Coding,cds, biosynthesis, cds, enzyme ] ['for 5 HTP production. This is the intermediate construct consisting of the...Serotonin is an essential metabolite key neurotransmitter in mood regulation...serotonin in the body is produced by enterochromaffin cells located in the gut...The rate limiting step of synthesis of serotonin is catalyzed by Tryptophan...You can access the characterization data for this part cloned into Lac...']"},{"machine":"BBa_K1321343","videoId":"BBa_K1321343","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17G - [ Coding,binding, cellulose ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1598003","videoId":"BBa_K1598003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17H - [ Generator ] ['choline and acetyl CoA. Acetylcholine is a versatile neurotransmitter that has...learning functions 1 . Acetylcholine is also a principal neurotransmitter in...']"},{"machine":"BBa_K1321344","videoId":"BBa_K1321344","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17I - [ Coding,binding, cellulose ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1604021","videoId":"BBa_K1604021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17J - [ Composite ] [' carotene 15 15 dioxygenase is involved in retinal biosynthesis and...into two molecules of retinal. Blh is the gene that encodes for this enzyme ...and was first isolated in the uncultured bacteria SAR86 1 . Blh is present...This device is composed of a constitutive promoter of the Anderson family a...Our data show that there is a loss of carotene when the cells express blh....']"},{"machine":"BBa_K1321345","videoId":"BBa_K1321345","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17K - [ Coding,binding, cellulose ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1604022","videoId":"BBa_K1604022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17L - [ Composite ] ['the control of araC pBAD promoter. blh is under a costitutive promoter of the...bacteria. 2 carotene is produced by pharnesyl di phospahate a colorless...molecule naturally produced in E. coli . Once carotene is synthetized it is...Our data show that there is a loss of carotene when the cells express blh....carotene is being cleaved to form retinal as shown by the evident loss of...']"},{"machine":"BBa_K1321346","videoId":"BBa_K1321346","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17M - [ Coding,binding, cellulose, cds, reporter, gfp ] ['This construct is part of a library of Super folder GFP fusions with cellulose...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1632003","videoId":"BBa_K1632003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17N - [ Composite,awards, part_Kit plate, 2015 ] ['The fim switch is the promoter containing repeated DNA sequence which is...We designed this fim switch which has a J23119 promoter...between the promoter and the inverting site there are two restriction enzyme...cut sites are added in each side of the promoter Fig. 1. . So the promoter...replaced J23119 promoter with Lac...of fim switch Tokyo Tech is similar with fim switch wild type ....']"},{"machine":"BBa_K1321347","videoId":"BBa_K1321347","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17O - [ Coding ] ['N.B. deleting this part as is duplicate entry of K1321340...']"},{"machine":"BBa_K1632008","videoId":"BBa_K1632008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 17P - [ Composite,awards, part_Kit plate, 2015 ] [' Fim switch wild type is derived from wild type sequence. Fim switch wild ...type have sigma 70 promoter which is constitutive promoter. The promoter in...transcription the state is defined as ON state. On the other hand fim... Fim switch is inverted by two recombinase FimB and FimE. The FimB protein...characterize the function of this part by inserting fim switch default...We tried to confirm that fim switch is bidirectically inverted in the... araC promoter. Fig. 2 shows the histograms of the samples measured by the...From this fact we confirmed that the fim switch is inverted from ON state...the fim switch is inverted from OFF state to ON state by FimB wild ...colonies is evaluated from fluorescence. In brief colonies which contain...We tried to confirm that fim switch wild type is predominantly inverted in...promoter. Fig. 5 shows the histograms of the samples measured by the flow...From this fact we confirmed that the fim switch wild type is inverted from...fact we confirmed that the fim switch wild type is inverted only from ON ...']"},{"machine":"BBa_K1312006","videoId":"BBa_K1312006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18A - [ Coding ] ['This part is NADPH dependent flavinoid reductase gene of Fragilariopsis...']"},{"machine":"BBa_K1602035","videoId":"BBa_K1602035","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18B - [ Generator ] ['This part is capable to generate the protein Xylanase...this part binds to the PDZ domain of the scaffold. The construct also contains...']"},{"machine":"BBa_K1438001","videoId":"BBa_K1438001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18C - [ Coding,binding, metal, cds ] ['Bacterioferritin is an haem containing bacterial ferritin. Each heme is bound...We isolated this particular bacterioferritin from the probiotic strain E. coli...BacFerr GS mRFP lysate sample suggesting that BacFerr GS mRFP is being...law concentration is directly proportional to absorbance. Thus for the...supernatant was measured using a spectrophotometer. It is expected that the...protein as compared to the RFP only negative control. There is a percent...error. There is a 70.7 percent difference between the mean absorbance values...More iron can be stored inside of a cell that is overexpressing...binding in acidic media than in Basic media We added GST to this part and...']"},{"machine":"BBa_K1602043","videoId":"BBa_K1602043","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18D - [ Generator ] ['Composite part consisting of an araC regulated pBAD promoter...the hokD is induced by the addition of arabniose which leads to cell death of...into the cells. It is possible that this results in an unfavorable situation...']"},{"machine":"BBa_K1438002","videoId":"BBa_K1438002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18E - [ Coding,binding, metal, cds ] []"},{"machine":"BBa_K1602044","videoId":"BBa_K1602044","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18F - [ Composite ] ['Composite part consisting of a constitutive promoter...into the cells. It is possible that this results in an unfavorable situation...']"},{"machine":"BBa_K1344000","videoId":"BBa_K1344000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18G - [ Coding ] ['Peptide 1018 is a synthetic cationic peptides derived from natural peptides...Peptide 1018 is small cationic peptide under T5 promoter inducible promoter ....Isopropyl thiogalactoside IPTG is analogue of lactose that is able to induce...activation of T5 promoter to start transcription. ...peptide 1018 trancription which is able to inhibit the growth of E.coli and...']"},{"machine":"BBa_K1602046","videoId":"BBa_K1602046","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18H - [ Composite ] ['Composite part consisting of an araC regulated pBAD promoter...the Lock3 sequence is induced by the addition of arabniose. In the presence of...medium is sufficient to repress GFP expression through the araC regulated...pBAD promoter. Surprisingly we were not able to detect the same difference in...into the cells. It is possible that this results in an unfavorable situation...']"},{"machine":"BBa_K1472601","videoId":"BBa_K1472601","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18I - [ Coding ] ['peptide sequence and is named here as leaderless TesA or TesA. The TesA...protein is expected to be expressed exclusively in the cytosol of E. coli to...acyl CoA to free fatty acids Figure 1 . TesA is predicted to enhance free...downstream of the PBAD promoter in the pSB1C3 vector. E. coli TOP10 cells...']"},{"machine":"BBa_K1602049","videoId":"BBa_K1602049","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18J - [ Regulatory ] ['This part is half of a two part riboregulator system for E.coli for...The sequence of the taRNA is based on an existing riboregulator sequence pair...']"},{"machine":"BBa_K1472610","videoId":"BBa_K1472610","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18K - [ Coding ] []"},{"machine":"BBa_K1602050","videoId":"BBa_K1602050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18L - [ Regulatory ] ['RRlocked is part of a two part killswitch system for E.coli utillizing a...The sequence of the crRNA is based on an existing riboregulator sequence pair...indicate that the repression of hokD via the cis repressing sequence is not as...']"},{"machine":"BBa_I0500","videoId":"BBa_I0500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18M - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, other ] ['Inducible pBad araC promoter...pBad is an E. coli promoter that is tightly controlled by ... When grown with 0.2 arabinose promoter is weak medium. jb 5 24 04 Part may not be compatible with MC4100 as cell line is araD 139....pBAD promoter. Check results on...catabolite repression of expression from the promoter by glucose. Check... Team Glasgow 2017 http 2017.igem.org Team Glasgow improved this part by...under regulation of LacI regulated promoter. This allows for greater control...characterized this part again and added new documentation to it. See more... From an OWW article on pBAD and lac promoters http openwetware.org wiki Titratable control of pBAD and lac promoters in individual E. coli cells pBAD promotersOpenWetWare ... Import of arabinose into cells is mediated by the araE gene. Induction of the arabinose transporter encoded by araE can be uncoupled from the endogenous PBAD promoter by deleting the chromosomal araE gene and replacing it with a plasmid borne copy of araE under control of a constitutive promoter 1 . However this does not seem to be enough to allow for homogenous expression from PBAD promoters in a population of cells 2 .... At low concentrations of arabinose degradation of the sugar within cells also effects the homogeneity of expression from PBAD promoters 2 . Arabinose degradation is mediated by the araBAD genes. Strains lacking functional araE araFGH another transporter and araBAD can be made to be responsive to arabinose for PBAD promoter induction 2 . This is achieved by introduction of a mutant lacY gene. LacY A177C allows for downhill transport of arabinose as well as maltose palatinose sucrose and cellobiose 3 but does not actively transport these sugars 4 . Lactose import is not affected in this mutant. So PBAD promoters in cells lacking endogeneous arabinose importers and containing LacY A177C are linearly responsible to arabinose at the individual cell level.... By the way AraC is the repressor of the PBAD promoter. It is encoded on the pBAD vector series and is still present in the above described strains.... At least one registry stock contains a deletion of the C at base 1194. This is after the transcriptional start but before the translation start so it may not be significant. Parts with this mutation have been qualitatively observed to function normally.... Induction and Subsequent Inhibition of the pBAD Promoter... Expression by the pBAD promoter can be regulated tightly by induction and...The pBAD promoter holds great potential to control the expression of genes...that require tight regulation as it is capable of both an induction and...from 2015 found that the pBAD promoter exhibits an almost all or none...was evident that this promoter on a high copy vector would be inappropriate...promoter.png http 2017.igem.org wiki images archive f f5 20171102025131 21T... SDU Denmark pBAD promoter.png ...promoter is both inducible and repressible as required when cloned into the... Induction of the pBAD Promoter...Promoter pBAD is induced with inexpensive and non toxic monosaccharide...promoter is tightly regulated and can reach moderately high levels of...characterize the pBAD araC promoter on respectively medium copy number pSB3C5...and low copy number pSB4A5 in TOP10 and found the fluorescense is increased as...that the expression of dCas9 from pBAD promoter can be modulated over a wide... The performance of two inducible promoters AraC pBAD compared to Xyls Pm ...The pBAD promoter holds great potential to control the expression of genes...that require tight regulation as it is capable of both an induction and...repression. The pBAD promoter exhibits an almost all or none behavior upon...The inducer with their respective promoters AraC pBAD are coupled with...sfGFP to see if there is actually expression leakage when inducer is present... AraC are present the promoter pBAD is initiated therefore sfGFP is...expressed while sfGFP shouldn t be expressed if inducer is absent. When...fluorescence of pBAD have increased exponentially. This is another sign that...value suddenly increased to 7641 a.u. which is 7590 a.u. higher than the...verified the presence of expression leakage of the system when inducer is not... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...Inducible pBad araC promoter...We also used this part in our project. ...on bacteria. However related studies are all used by the T7 promoter and E....coli BL21 DE3 strain. This year we used the Inducible pBad araC promoter...First we measured the function of the promoter by GFP. We got the gene part...The gene circuit we used is as below ...The protocol is as below ...of D arabinose. To study whether glucose and trehalose affect the promoter we...and trehalose afected the promoter....The result is quite clear. First L arabinose efficiently induced the...have any effect. Secondly glucose and trehalose suppressed the promoter even...trehalose was even worse than that of glucose. The effect of glucose is well ...known. However that of trehalose is not. We give a hypothesis here. One...glucose. Thus at a low concentration trehalose is more insufferable to the...promoter than glucose....storage. We used the promoter to express CAHS 106094 in E. coli DH5 strain to...The gene circuit we used is as below ...The protocol is as below ... 1 If fluorescence induced by the iPTG is detectable in the control group... 1 equals to 109 cells. If the OD600 value is between 0.1 and 1 There is a... 3 If the density above is not suitable take 100 L of the solution and...106094 exhibited a higher survival rate which indicated that the promoter and...This part contains an arabinose operon which constitutes the arabinose...This part contains an arabinose operon which constitutes the arabinose...reproduction of bacteria will be inhibited when arabinose is present. ...be inhibited when there is arabinose in the medium. ... promoter ...pBad araC promoter negative regulators o h o l positive regulators ...']"},{"machine":"BBa_K1602051","videoId":"BBa_K1602051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18N - [ Composite ] ['Composite part consisting of an araC regulated pBAD promoter...the taRNA is induced by the addition of arabniose. In the presence of glucose...glucose but is inducable through the addition of arabinose....medium is sufficient to repress GFP expression through the araC regulated...pBAD promoter. Surprisingly we were not able to detect the same difference in...into the cells. It is possible that this results in an unfavorable situation...able to characterize this part yet....']"},{"machine":"BBa_K1523022","videoId":"BBa_K1523022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18O - [ Coding ] ['Naphthalene is a kind of pollution source. nahE is a member of the naphthalene...salicylaldehyde and pyruvate. The reaction is reversible. Can also use...The F step is ctalyzed by this part K1523022 ...']"},{"machine":"BBa_K1602055","videoId":"BBa_K1602055","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 18P - [ Generator,awards, part_Kit plate, 2015 ] ['Composite part consisting of an araC regulated pBAD promoter...The 2018 UAlberta iGEM team assembled an improved version of this part ...medium is sufficient to repress GFP expression through the araC regulated...pBAD promoter. Surprisingly we were not able to detect the same difference in...into the cells. It is possible that this results in an unfavorable situation...']"},{"machine":"BBa_K1321348","videoId":"BBa_K1321348","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19A - [ Coding,binding, cellulose, cds, reporter, gfp ] ['This construct is part of a library of Super folder GFP fusions with cellulose...included in the RFC25 prefix and suffix which is not shown....As shown in the graph the functionality of the fusion protein is retained...even after lyophilization and is significantly greater than the fluorescence...Qualitatively the cellulose binding activity is shown to be retained. The...The experimental group we set is the mixture of dCBD sample with bacteria...']"},{"machine":"BBa_K1632012","videoId":"BBa_K1632012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19B - [ Composite,awards, part_Kit plate, 2015 ] ['inverting a promoter in a fim switch....The fim switch is inverted by FimB. The FimB protein inverts the fim ...We tried to confirm that fim switch is bidirectically inverted in the... araC promoter. Fig. 3 shows the histograms of the samples measured by the...From this fact we confirmed that the fim switch is inverted from ON state...the fim switch is inverted from OFF state to ON state by FimB wild ...colonies is evaluated from fluorescence. In brief colonies which contain...']"},{"machine":"BBa_K1321349","videoId":"BBa_K1321349","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19C - [ Coding,binding, cellulose, cds, reporter, gfp ] ['This construct is part of a library of Super folder GFP fusions with cellulose...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1632013","videoId":"BBa_K1632013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19D - [ Composite,awards, part_Kit plate, 2015 ] ['The fim switch is inverted by FimE.The FimE protein inverts the fim switch...We tried to confirm that fim switch wild type is predominantly inverted in...promoter. Fig. 2 shows the histograms of the samples measured by the flow...From this fact we confirmed that the fim switch wild type is inverted from...fact we confirmed that the fim switch wild type is inverted only from ON ...']"},{"machine":"BBa_K1321351","videoId":"BBa_K1321351","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19E - [ Coding,binding, cellulose ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1632018","videoId":"BBa_K1632018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19F - [ Composite ] ['FimE is Fim recombinase. ...']"},{"machine":"BBa_K1321352","videoId":"BBa_K1321352","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19G - [ Coding,binding, cellulose ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...']"},{"machine":"BBa_K1789000","videoId":"BBa_K1789000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19H - [ Coding ] ['This part is the coding sequence of tryptophan 2 mono oxygenase....Indole 3 acetic acid IAA also known as auxin is a plant hormone which can...IaaM is the tryptophan 2 mono oxygenase. This enzyme catalyzes the oxidative...carboxylation of L tryptophan to indole 3 acetamide. IaaH is the...indoleacetamide to indoleacetate and ammonia. This pathway is relevantly easy...This part is validated through four ways Enzyme cutting PCR Sequence and...The PCR is performed with Premix EX Taq by Takara....The PCR protocol is selected based on the Users Manuel. The Electrophoresis... The result shows that this part can work as expected to generate IAA...']"},{"machine":"BBa_K1321353","videoId":"BBa_K1321353","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19I - [ Coding,binding, cellulose ] [' Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...']"},{"machine":"BBa_K1789001","videoId":"BBa_K1789001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19J - [ Coding ] ['This part is the coding sequence of the enzyme Indoleacetimide hydrolase IaaH....ammonia. This part is gathered from the 2 step pathway in Pseudomonas...Indole 3 acetic acid IAA also known as auxin is a plant hormone which can...IaaM is the tryptophan 2 mono oxygenase. This enzyme catalyzes the oxidative...carboxylation of L tryptophan to indole 3 acetamide. IaaH is the...indoleacetamide to indoleacetate and ammonia. This pathway is relevantly easy...This part is validated through four ways enzyme cutting PCR Sequence and...The PCR is performed with Premix EX Taq by Takara....The PCR protocol is selected based on the Users Manuel. The Electrophoresis... The result shows that this part can work as expected to generate IAA...']"},{"machine":"BBa_K1321356","videoId":"BBa_K1321356","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19K - [ Composite,binding, cellulose, function, reporter, fluorescence ] ['A LacI promoter expression construct of super folder GFP fused N terminally to...This construct is part of a library of Super folder GFP fusions with cellulose...RFC25 suffix which is not shown. The prefix to this part is RFC10 format....']"},{"machine":"BBa_K1789002","videoId":"BBa_K1789002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19L - [ RBS ] []"},{"machine":"BBa_K1321357","videoId":"BBa_K1321357","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19M - [ Composite,binding, cellulose, function, reporter, fluorescence ] ['A LacI promoter expression construct of super folder GFP fused N terminally to...This construct is part of a library of Super folder GFP fusions with cellulose...RFC25 suffix which is not shown. The prefix to this part is RFC10 format....']"},{"machine":"BBa_K1789003","videoId":"BBa_K1789003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19N - [ Coding,cds, reporter, gfp, function, reporter, fluorescence ] ['This part is the Amino Half of GFP with termination codon...This part is validated through four ways enzyme cutting PCR Sequence and...The PCR is performed with Premix EX Taq by Takara....The PCR protocol is selected based on the Users Manuel. The Electrophoresis... The result shows that this part can shine with GFP2. ...']"},{"machine":"BBa_K1321358","videoId":"BBa_K1321358","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19O - [ Coding ] []"},{"machine":"BBa_K1789004","videoId":"BBa_K1789004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 19P - [ Coding,cds, reporter, gfp, function, reporter, fluorescence ] ['into two parts called N fragment and C fragment. This is the latter. This...challenge and make this part easier to use we designed a pair of prime to...remove that additional base and make this part easier to be used....This part is validated through four ways enzyme cutting PCR Sequence and...The PCR is performed with Premix EX Taq by Takara....The PCR protocol is selected based on the Users Manuel. The Electrophoresis... The result shows that this part can shine with GFP1. ...control of a lac operon controlled T7 promoter. The complete zinc finger...']"},{"machine":"BBa_K1349007","videoId":"BBa_K1349007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20A - [ Coding ] []"},{"machine":"BBa_K1602056","videoId":"BBa_K1602056","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20B - [ Composite ] ['This part is a composite of two coding genes and one strong RBS per gene...']"},{"machine":"BBa_K1349008","videoId":"BBa_K1349008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20C - [ Coding ] ['SH3pep LZA is a link wich mediates proteins interactions....']"},{"machine":"BBa_K1602058","videoId":"BBa_K1602058","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20D - [ Composite ] ['This part is a composite of three coding genes and one strong RBS per gene...']"},{"machine":"BBa_K1349004","videoId":"BBa_K1349004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20E - [ Coding ] ['Mesh1 is a SpoT orthologs in metazoa. It catalyzes hydrolysis of ppGpp...']"},{"machine":"BBa_K1602037","videoId":"BBa_K1602037","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20F - [ Translational_Unit ] ['This part encodes for the enhanced yellow fluorescent protein eYFP codon...']"},{"machine":"BBa_K1349000","videoId":"BBa_K1349000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20G - [ Coding ] ['sequence and without stop codon. SerA is requiered for serine biosynthesis....enzyme is expected to be no longer inhibited by Serine and to allow the...']"},{"machine":"BBa_K1602038","videoId":"BBa_K1602038","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20H - [ Translational_Unit,awards, part_Kit plate, 2015 ] ['This part encodes for the enhanced yellow fluorescent protein eYFP codon...']"},{"machine":"BBa_K1483000","videoId":"BBa_K1483000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20I - [ Coding ] ['This part is patented http appft1.uspto.gov netacgi nph ...Encodes for an enzyme that is capable of cleaving off N acetlygalactosamine...Following reaction is catalysed by this part...']"},{"machine":"BBa_K1602041","videoId":"BBa_K1602041","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20J - [ Generator ] ['Inducible generator of eYFP with C terminal SH3 ligand This part is capable to...']"},{"machine":"BBa_K1483001","videoId":"BBa_K1483001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20K - [ Coding ] ['Encodes for an enzyme that is capable of cleaving A and B antigens in the...Antigen which is characteristic of the Bombay blood type. Part in RFC25....']"},{"machine":"BBa_K1825000","videoId":"BBa_K1825000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20L - [ Coding,chassis, eukaryote, ppatens, Kit plates, antifreeze ] ['This is the coding region of a small antifreeze protein. The antifreeze...protein used in this project is normally produced by an insect the Spruce...mays ubiquitin promoter driving the antifreeze protein AFP linked to yellow...']"},{"machine":"BBa_K1483002","videoId":"BBa_K1483002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20M - [ Coding ] ['This part is patented http appft1.uspto.gov netacgi nph ...Encodes for an enzyme that is capable of cleaving off galactose from B group...erythrocytes from blood type A to O. The part is designed in the RFC25...']"},{"machine":"BBa_K1825005","videoId":"BBa_K1825005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20N - [ Coding,chassis, eukaryote, ppatens ] ['This sequence codes for neomycin Phosphotransferase and it is almost a twin of...Nevertheless here is the description of our experiments with the nptII gene...promoter driving the antifreeze protein AFP linked to yellow fluorescent...nptII gene is expressed with the 35s Cauliflower Mosaic virus promoter...little or not at all and is seen under the microscope as withering fig. 3...B2 . This is a stark contrast to our transformed moss that was able to grow...']"},{"machine":"BBa_K1483003","videoId":"BBa_K1483003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20O - [ Coding ] ['N intein. The C terminus of the C Intein is fused the matrix. The split intein...peptide synthesis and is thus not part of the registry ...This part can also be used in order to create fusion proteins by attaching...the C Intein to a protein instead of the matrix. The part is therefore... Expression This part can be expressed by growing a culture transformed...To establish that the split intein interacts and is active in comination with...We have slightly improved the graphic on the peptide. It is important to know...from the first amino acids following what is coded by the RFC suffix is...']"},{"machine":"BBa_K1689000","videoId":"BBa_K1689000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 20P - [ Composite ] [' Cas system is originally from prokaryotic immune system 1 in which CRISPR...the pre crRNA to form a dual RNA that is cleaved by the housekeeping RNase III...lacZ coding sequence we can also identify whether the cloning is successful...product is about 2500 ng l using HiScirbe T7 Quick High Yield RNA Synthesis...']"},{"machine":"BBa_K1321333","videoId":"BBa_K1321333","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21A - [ Regulatory,regulation ] ['This regulatory part is made up of the Arabinose Inducible promoter pBAD and...the AraC and pBAD promoter sequences and producing a DNA loop that prevents...Arabinose is supplied this binds to the AraC dimer and releases it from the...operator site found in the pBAD promoter at the same time it enhances...a PBS CR control it is possible to qualitatively assay the shift in spectral...We add target sequence downstream of this part and create a new part. See our...']"},{"machine":"BBa_K1789006","videoId":"BBa_K1789006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21B - [ DNA,awards, part_Kit plate, 2015 ] ['This part is a highly repetitive DNA sequence which can bind TALE protein...As is mentioned in our project description different TALEs share a similar...This scaffold is designed to put enzymes in the same direction. A 6 bp...intervening sequence is added between two BMs....This part is sequenced as correct after construction....']"},{"machine":"BBa_K1321120","videoId":"BBa_K1321120","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21C - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1789008","videoId":"BBa_K1789008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21D - [ Coding,awards, part_Kit plate, 2015 ] ['This is a engineered TAL effector that can bind with the DNA sequence...The transcription activator like TAL effectors is a family III effector in...This part is designed to recognize the DNA binding motif 1 BM1 in our...BM1 is sequenced as 5 GGAGGCACCGGTGG 3 ....This part is sequenced as correct after construction....']"},{"machine":"BBa_K1321121","videoId":"BBa_K1321121","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21E - [ Generator,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1789009","videoId":"BBa_K1789009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21F - [ Coding,awards, part_Kit plate, 2015 ] ['This is a engineered TAL effector that can bind with the DNA sequence...The transcription activator like TAL effectors is a family III effector in...This part is designed to recognize the DNA binding motif 1 BM2 in our...BM2 is sequenced as 5 GATAAACACCTTTC 3 ....This part is sequenced as correct after construction....']"},{"machine":"BBa_K1321122","videoId":"BBa_K1321122","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21G - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1789010","videoId":"BBa_K1789010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21H - [ Coding,awards, part_Kit plate, 2015 ] ['This is a engineered TAL effector that can bind with the DNA sequence...The transcription activator like TAL effectors is a family III effector in...This part is designed to recognize the REVERSED sequence of DNA binding motif...REVERSED BM2 is sequenced as 5 CTTTCCACAAATAG 3 ....This part is sequenced as correct after construction....']"},{"machine":"BBa_K1321125","videoId":"BBa_K1321125","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21I - [ Coding ] []"},{"machine":"BBa_K1789011","videoId":"BBa_K1789011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21J - [ Intermediate ] ['It is the combination of IAAH and terminatior....This part is constructed with IaaH expression gene and a terminatior....IaaH is the tryptophan 2 mono oxygenase. This enzyme catalyzes the oxidative...carboxylation of L tryptophan to indole 3 acetamide. IaaH is the...indoleacetamide to indoleacetate and ammonia. This pathway is relevantly easy...This part is validated through four ways Enzyme digestion PCR and...The PCR is performed with Premix EX Taq by Takara....The PCR protocol is selected based on the Users Manuel. The Electrophoresis...']"},{"machine":"BBa_K1321138","videoId":"BBa_K1321138","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21K - [ Coding ] ['Metallothionein SmtA with T7 promoter...SmtA is a metallotionein metal binding peptide from the cyanobacteria...fusion format at codon optimised for E. coli and is driven by the T7...promoter....RFC25 suffix which is not shown. The prefix to this part is RFC10 format....']"},{"machine":"BBa_K1789012","videoId":"BBa_K1789012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21L - [ Composite ] ['This part is a promoter. It has a strong RBS restriction site following it...This part is a promoter which is associated with a RBS Ribosome binding site ....It s used to be a part which both has the function of the promoter and...Ribosome binding site. The Plac promoter starts the whole work and the rbs30...with it ensure the high efficiency of ribosome binding.This part can improve...the efficiency of our construction work we can use this part instead of...effect of mutations in the lac promoter and catabolite repression of the lac...This part is sequenced as correct after construction....A double enzyme digestion test was implemented to verify this part....The function of this part was examined by the GFP assay. The...']"},{"machine":"BBa_K1321151","videoId":"BBa_K1321151","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21M - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1632000","videoId":"BBa_K1632000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21N - [ Regulatory,awards, part_Kit plate, 2015, function, recombination, fim ] ['The fim switch is the promoter containing repeated DNA sequence which is...We designed this fim switch which has a J23119 promoter...between the promoter and the inverting site there are two restriction enzyme...cut sites are added in each side of the promoter Fig. 1. . So the promoter...we replaced J23119 promoter with Lac...of fim switch Tokyo Tech is similar with fim switch wild type ....']"},{"machine":"BBa_K1321152","videoId":"BBa_K1321152","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21O - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1632001","videoId":"BBa_K1632001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 21P - [ Regulatory,awards, part_Kit plate, 2015 ] ['The fim switch is the promoter containing repeated DNA sequence which is...We designed this fim switch which has a J23119 promoter...between the promoter and the inverting site there are two restriction enzyme...cut sites are added in each side of the promoter Fig. 1. . So the promoter...we replaced J23119 promoter with Lac...design of fim switch Tokyo Tech is similar with fim switch wild type ....']"},{"machine":"BBa_K1446002","videoId":"BBa_K1446002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22A - [ Composite ] ['containing this part and one containing the microcompartment submitted by the...be seen for some of the cells in the image below there is no perfect and...For experimental details see the experience page for this part....']"},{"machine":"BBa_K1689001","videoId":"BBa_K1689001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22B - [ Coding,function, reporter, light ] ['linker. Biotin STV interaction is one of the strongest noncovalent...interactions in nature and is frequently applied as a simple approach to...This part was constructed on pET28a backbone placed under T7 promotor and lac...experiment groups were detected when each protein concentration is 2000 nM....MB is appreciated when detecting RNA target. The signal to background ratios...The highest signals were detected when target concentration is 200 nM at each...cases the ratio is 7.07 for DNA target 4.52 for RNA target. Even when the...target concentration is only 10 nM there was still significant difference...compared to the control group the ratio is 4.42 for DNA target 3.12 for RNA...']"},{"machine":"BBa_K1343019","videoId":"BBa_K1343019","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22C - [ Signalling ] ['The promoter Plux is induced by the binding of an AHL luxR dimer. This bio ...catalyses a luminescent reaction. TetR can be used to repress the promoter...']"},{"machine":"BBa_K1689002","videoId":"BBa_K1689002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22D - [ Coding ] ['Biotin STV interaction is one of the strongest noncovalent interactions in the...nature and is frequently applied as a simple approach to generate...semisynthetic DNA protein conjugates. 1 Split luciferase is particularly...This part was constructed on pET28a backbone placed under T7 promotor and lac...experiment groups were detected when each protein concentration is 2000 nM....MB is appreciated when detecting RNA target. The signal to background ratios...The highest signals were detected when target concentration is 200 nM at each...cases the ratio is 7.07 for DNA target 4.52 for RNA target. Even when the...target concentration is only 10 nM there was still significant difference...compared to the control group the ratio is 4.42 for DNA target 3.12 for RNA...']"},{"machine":"BBa_K1343020","videoId":"BBa_K1343020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22E - [ Signalling ] ['The promoter Plux is induced by the binding of an AHL luxR dimer. This bio ...catalyses a luminescent reaction. lacI can be used to repress the promoter...']"},{"machine":"BBa_K1689005","videoId":"BBa_K1689005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22F - [ Coding ] ['and C terminal C luc fragments and each of them is inactive. When they two...the recovered luciferase is able to oxidize luciferin and produce detectable...FKBP is a monomeric and highly abundant cytosolic protein that serves as the...Target of Rapamycin binds with high affinity to FKBP. Rapamycin is able to...below Figure 1b confirmed that the luciferase activity is able to be...partners FRB FKBP get closer and dimerize soon after rapamycin is added...']"},{"machine":"BBa_K1343021","videoId":"BBa_K1343021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22G - [ Signalling ] ['The promoter Plux in induced by the dimer AHL luxR. As a result amilCP a...blue chromophoire protein is synthesized. Lambda phage CI is a repressor of...the promoter PCI....']"},{"machine":"BBa_K1689006","videoId":"BBa_K1689006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22H - [ Coding,function, reporter, light ] ['and C terminal C luc fragments and each of them is inactive. When they two...the recovered luciferase is able to oxidize luciferin and produce detectable...FKBP is a monomeric and highly abundant cytosolic protein that serves as the...Target of Rapamycin binds with high affinity to FKBP. Rapamycin is able to...partners FRB FKBP get closer and dimerize soon after rapamycin is added...']"},{"machine":"BBa_K1343022","videoId":"BBa_K1343022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22I - [ Signalling ] ['The promoter Plux in induced by the dimer AHL luxR. As a result amilCP a...blue chromophoire protein is synthesized. TetR is a repressor of the promoter...K3189001 page does not exist upstream to act as its new promoter...variable intensity is visible at 100 ng mL tetracycline for all of the...K3189001 page does not exist . When the system is induced with 100 ng mL...of tetracycline a dark blue colour is produced Figure 2 and Figure 3 . This...']"},{"machine":"BBa_K1689007","videoId":"BBa_K1689007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22J - [ Composite,awards, part_Kit plate, 2015 ] ['widely used as a reporter is split into two fragments namely N luc and C luc... 2 . Each fragment by itself is inactive when two fragments are reassembled ...sequence is adjacent to and another distal from the spacer. b 4 different...']"},{"machine":"BBa_K1355004","videoId":"BBa_K1355004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22K - [ Device,function, degradation ] ['In absence of mercury MerR forms a MerR promoter operator complex preventing...RNA polymerase to recognize the promoter consequently mRNA for MerPT and...element and dissociates from the promoter operator complex allowing MerPT and...beautiful MerA is responsible for reduction from Hg2 in Hg0 which is...']"},{"machine":"BBa_K1689012","videoId":"BBa_K1689012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22L - [ Composite,awards, part_Kit plate, 2015 ] [' Lactamase AmpR is produced by some bacteria providing resistance against...In our project Lactamase is used to catalyze the hydrolysis of penicillin...']"},{"machine":"BBa_K1355002","videoId":"BBa_K1355002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22M - [ Device ] ['In absence of mercury MerR forms a MerR promoter operator complex preventing...RNA polymerase to recognize the promoter consequently messengers RNA for...to this element and dissociates from the promoter operator complex allowing...team to the left . The difference is vivid and it s clear that the mercury...']"},{"machine":"BBa_K1689013","videoId":"BBa_K1689013","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22N - [ Composite,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1355003","videoId":"BBa_K1355003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22O - [ Device ] ['We designed a biobrick device to bind and inactivate Hg. It is composed by two...In absence of mercury MerR forms a MerR promoter operator complex preventing...RNA polymerase to recognize the promoter consequently messengers RNA for...to this element and dissociates from the promoter operator complex allowing...']"},{"machine":"BBa_K1689014","videoId":"BBa_K1689014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 22P - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1321154","videoId":"BBa_K1321154","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23A - [ Coding,binding, cellulose ] ['This construct is part of a library of fusions with cellulose binding domains...included the RFC25 prefix and suffix which is not shown....']"},{"machine":"BBa_K1632005","videoId":"BBa_K1632005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23B - [ Regulatory,awards, part_Kit plate, 2015 ] [' Fim switch wild type is derived from wild type sequence. Fim switch wild ...type have sigma 70 promoter which is constitutive promoter. The promoter in...transcription the state is defined as ON state. On the other hand fim... Fim switch is inverted by two recombinase FimB and FimE. The FimB protein...characterize the function of this part by inserting fim switch default...We tried to confirm that fim switch is bidirectically inverted in the... araC promoter. Fig. 2 shows the histograms of the samples measured by the...From this fact we confirmed that the fim switch is inverted from ON state...the fim switch is inverted from OFF state to ON state by FimB wild ...colonies is evaluated from fluorescence. In brief colonies which contain...We tried to confirm that fim switch wild type is predominantly inverted in...promoter. Fig. 5 shows the histograms of the samples measured by the flow...From this fact we confirmed that the fim switch wild type is inverted from...fact we confirmed that the fim switch wild type is inverted only from ON ...']"},{"machine":"BBa_K1321159","videoId":"BBa_K1321159","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23C - [ Coding ] ['Fmt metallothionein with T7 promoter...Fmt is a metallotionein metal binding peptide from the seaweed Fucus...fusion format at codon optimised for E. coli and is driven by the T7...promoter....RFC25 suffix which is not shown. The prefix to this part is RFC10 format....']"},{"machine":"BBa_K1632006","videoId":"BBa_K1632006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23D - [ Regulatory,awards, part_Kit plate, 2015 ] ['The fim switch is the promoter containing repeated DNA sequence which is.... Basically the design of the fim switch Tokyo Tech is similar to the... fim switch wild type . The only difference is that we inserted restriction...switch Tokyo Tech the sigma 70 promoter is exchanged to the J23119 promoter... SalI and BamHI and in the back BglII and MluI of the promoter. Due to the...promoter which can we exchanged with an arbitrary promoter. We actually...changed J23119 promoter in the fim switch Tokyo Tech to Lac...']"},{"machine":"BBa_K1321162","videoId":"BBa_K1321162","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23E - [ Coding ] ['NiBP driven by LacI promoter... Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...']"},{"machine":"BBa_K1632010","videoId":"BBa_K1632010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23F - [ Coding,awards, part_Kit plate, 2015 ] ['inverting a promoter in a fim switch....The fim switch is inverted by FimB.The FimB protein inverts the fim switch...We tried to confirm that fim switch is bidirectically inverted in the... araC promoter. Fig. 3 shows the histograms of the samples measured by the...From this fact we confirmed that the fim switch wild type is inverted from...we confirmed that the fim switch wild type is inverted from OFF state to...colonies is evaluated from fluorescence. In brief colonies which contain...']"},{"machine":"BBa_K1321366","videoId":"BBa_K1321366","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23G - [ Composite,binding, cellulose, function, reporter, fluorescence ] ['CBDcex fused to sfGFP with T7 promoter...A T7 promoter expression construct of super folder GFP fused C terminally to...This construct is part of a library of Super folder GFP fusions with cellulose...RFC25 suffix which is not shown. The prefix to this part is RFC10 format....']"},{"machine":"BBa_K1632011","videoId":"BBa_K1632011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23H - [ Coding,awards, part_Kit plate, 2015 ] ['This part was improved by the Newcastle 2017 iGEM team...The fim switch is inverted by FimE.The FimE protein inverts the fim switch...']"},{"machine":"BBa_K1321163","videoId":"BBa_K1321163","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23I - [ Coding ] ['NiBP driven by T7 promoter... Important note Please be aware we discovered that this part is out...out of frame. This is because there is a deletion of a base compared to the...our part. We hope that this part will still be useful since the error could...This construct is part of a library of fusions with cellulose binding domains...']"},{"machine":"BBa_K1806001","videoId":"BBa_K1806001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23J - [ Coding ] ['This part is the coding sequence for the Helicobacter pylori catalase which...hydrogen peroxide which is an exothermic process will be utilized to provide...Catalase also named as peroxidase is the enzyme responsible for the...breakdown of hydrogen peroxide which is commonly found in nearly all living...breakdown. 3 Also the importance of this reaction is that it occurs in all...The Bombardier Beetle Brachinini is a group of species that utilizes a...focuses on occurs in the reaction chamber which is directly connected to the...bombardier beetle is hence a result of the mechanical excretion of a liquid...two different organisms. One is the common HPI Catalase of E. coli controlled...by the katG enzyme site. The second catalase to be used in the project is the...HPI catalase is expressed in E. coli as a result of oxidative stress. The...tetramic catalase of E. coli as previously mentioned is controlled by the...katG enzyme site. This enzyme site is regulated by the OxyR protein a member...naturally inactive in regulation but is activated under oxidative stress...synthesis of HPI catalase in E. coli is regulated by katG and oxyR. 8 ...translation in H. pylori is the katA enzyme site. Just like katG katA is...one wild type catalase whereas E. coli has another catalase which is HPII...peroxide degradation. The hydrogen peroxide degradation is usually at maximum...']"},{"machine":"BBa_K1321100","videoId":"BBa_K1321100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23K - [ Coding,binding, cellulose ] ['Phytochelatin PC EC20 fused to linker dCBD with T7 promoter...A T7 promoter expression construct of synthetic phytochelatin EC20 metal...This construct is part of a library of fusions with cellulose binding domains...RFC25 suffix which is not shown. The prefix to this part is RFC10 format....solution and the metal concentration in solution is quantified by mass...']"},{"machine":"BBa_K1806003","videoId":"BBa_K1806003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 23L - [ Composite ] ['Heat shock is a major process for the survival of all species. 1 In an...forces the organism to adapt to temperature shifts. This is where heat shock...organisms and is present in the most primitive bacteria species to the most...to be handled by the most common structures found in all that is living RNA....thermometers is that they function through conformational shifts in structure....sequence is common. Aside from that temperature is the factor responsible for...The Rna thermometer that will be utilized in our project is the ibpb RNA...organisms the ibpb thermometer is a standard cis acting heat shock regulated...rna thermometer. The heat shock process is stimulated by the medium of the...attached protein. This heat shock response is effectively stimulated at 37 C...']"},{"machine":"BBa_J04450","videoId":"BBa_J04450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24P - [ Reporter,cds, reporter, chromoprotein, classic, reporter, pret, function, reporter, color, function, reporter, pigment ] ['contain a degradation tag and the RBS is strong....LacI and induced by IPGT. Plac is one of the most common promoter in life...science research field. It is mainly composed of Lac operon containing LacO...the binding of RNA polymerase to the promoter. So the expression of downstream...genes is blocked. Serving as inducer IPTG can bind with LacI repressor ...making the latter s conformation changes so LacI is detached from LacO site ...generator driven by Plac promoter however there is no LacI gene in it....Although the E. coli could express some LacI it is not enough for inhibition...promoter. It contains LacI gene which can lower significantly the RFP leakage...expression so that no excessive LacI expression which is considered as waste...identification result is showed in Fig.1. ...fluorescent intensity is fluorescence per OD600 standardized with fluorescence...leakage expression is very low and it is sensitive to the IPTG induction. ...induction. Relative fluorescent intensity is fluorescence per OD600...IPTG induction. Relative fluorescent intensity is fluorescence per OD600...very sensitive to the IPTG induction and the RFP leakage expression is very... 4. Add 100 l bacteria culture medium into a sterile 96 well plate. IPTG is added to final concentrations of 1 2 5 10mM. M9 medium is the blank control. The colony without RFP expression is the negative control....This part is commonly used but can fail if the system contains LacI or CAP... Team TU Munich 2012 http 2012.igem.org Team TU Munich improved this part... Team Warwick 2015 http 2015.igem.org Team Warwick improved this part by...characterisation of this part by showing equal functionality in simulated...contributed to the characterisation of this part by testing the time of...apparition of fluorescence in presence of IPTG or not because the promoter...leaks as well as they contributed to the improvement of this part by using...contributed to the characterization of this part by showing decreased...contributed to the characterization of this part by analyzing the rate of...contributed to the characterisation of this part by testing the delay before...contributed to the characterisation of this part by testing the fluorescence...part by replacing the induced promoter lacI with the strong constitutive pf 5...promoter PampC. see ...Alpes Contribution contributed to the characterisation of this part by...testing the effect of cAMP on the promoter s leakages and protein expression...charazterization of this part by testing the effect of different media...the characterization of this part by introducing it in Trans10 to observe its...contributed to the charazterization of this part by testing the effects of...characterization of this part by testing the effect of glucose on the protein...contributed to characterization of this part by testing radiation tolerance of...replication that could explain this effect. This part is a reversion of this...successfully produce colonies. In these results is the negative control...plate streaked with pSB1C3 containing J04450 RFP . This is the most...origin which has expression in vibrio. However pGGA is not compatible with...plasmid per genome. These values indicate that K3445002 is effective in both...in a plasmid that is still capable of replication in E. coli but now also...Escherichia coli Nissle 1917 EcN is widely used as a probiotic since it s...contains a CAP sensitive promoter and glucose can inhibit its expression. ...We then investigate whether this phenomenon is influenced by the strain and...amount of IPTG added for respective treatment is 500 M. ... The red color absorbance under 588 nm wavelength is recorded around 2.5 3 OD units....the role of RBS and Promoter parts in giving rise to intrinsic noise in E....of this part as a cloning tool. When ligating any part or part assembly into...any standard backbone that contains this part the non restricted and single ...insert the size of the BioBrick insert and whether the insert is an assembly...we characterized its expression under lac promoter. We did the transformation...Violaceum competent cells with the protocol that is in our wiki we concluded...that the best O.D. for the heat shock transformation is 0.5 since it showed...expression. This part is useful for characterizing the expression of different...proteins using the lacI sensitive promoter. For better application of this...promoter in controlling protein expression the effects of different hosts...fluorescence intensity at different temperature is much higher than those of...leak appeared in 34 oC. This finding is different from our expectation where...medium containing flask is significantly higher than others indicating that...oxygen is an important factor which will affect the protein expressin and cell...by using different IPTG induction Fig 3 . However it is interesting that the...driven by PrplJ promoter and expressed in DH10B. In addition we also applied...weaker E.coli endogenous promoters PdapA and PcaiF Figure 1 ....PcaiF promoter....However it is difficult for us to perform additional experiments with... The goal was to characterize the effect of cAMP on the promoter s leakages...without production of cAMP. BTH101 strain is streptomycin resistant. ...inducible promoter lactose promoter to create an auto amplifier system. ...It is apparent that without IPTG there is a visible difference between strains...the leakage of the promoter. ...data suggest that the promoter does not leak in that condition. ...lactose promoter has almost no leakage suggesting that the leakage of the...lactose promoter is due to cAMP in absence of IPTG. When the cAMP production...is restored the promoter is activated and the protein is expressed. It is also...expression if no IPTG is added. ...SHuffle strains. In order to test this lacI regulated promoter in our chassis ...functionality of the promoter. Protein expression was analysed through an SDS ...leakiness in the promoter. IPTG concentrations were chosen based on conditions...worked previously when using a T7 promoter 0.2 mM and recommendations of the...show bands if the promoter lacked leakiness nevertheless a faint band can be...stronger bands compared to the uninduced control. Thus the promoter is...promoter....and have been excluded. In case of 532 605 the noise is disturbing the...EcN. The lag phase is shorter compared to the other two media while the...logarithmic phase is longer. In TB Media the lag phase is extended and the...growth is not as high as before but still exhibits a clear logarithmic phase....In sharp contrast to that the lag phase in LB Media is almost double and the...exponential phase is quite brief. These results are expected since the media...the RFP production in LB is significantly lower. For E. coli BL21 DE3 Figure...lowest RFP levels. The expression in LB media is only slightly higher than in...Enriched media. The protein expression in TB Media however is notably higher...the control of a lactose promoter is a good alternative to produce inducible...could divide 24h into three different growth phases 0 2h is lag phase 2 15h...is an exponential phase 15 24 is a stationary phase. ...spectra for mCherry ranges from 551 nm to 800 nm. There is an overlap of 77 nm...each fluorescent protein is accurate....showed the highest fluorescence readings. This is probably because cell...concentration of 87 5 which is 3 5 times higher than the recommended...We transformed the plasmid which RFP is inserted in psB1C3 into DH5 and...We transformed DH5 with the plasmid which RFP is inserted in psB1C3 and... At first the cells are cultured in liquid medium and the medium is replaced...with Butterfield s Phosphate Buffer BPB . This is because when the gamma ray...versus 10 Gy. From this result we concluded that E. coli is highly...sensitive to gamma irradiation when it is irradiated with 50 and more doses of...This graph shows that the number of cells is significantly reduced with...']"},{"machine":"BBa_K1442101","videoId":"BBa_K1442101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24A - [ Coding ] ['RNA dependent RNA polymerase RdRp is an enzyme which catalyses the...of RdRp is essential for replication of HCV subgenomic regions with the...']"},{"machine":"BBa_K1689015","videoId":"BBa_K1689015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24B - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1442107","videoId":"BBa_K1442107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24C - [ Coding ] ['This is a dedicated testing module containing the C2HP Terminator Part...designed to perform characterisation of the RNA Promoters and Terminators in...e coli. A diagram depicting the construct is shown below. The system is...RdRP is its ability to replicate a RNA strand starting from the 3 end a...is actually performing RNA replication. This is a common set up in experiments...the promoter and a reversed GFP sequence and a plasmid containing the RdRP...plasmid that contains a gene for GFP with an inducible T7 promoter....Promoter Testing Module and a plasmid containing a mutated version of the RdRP...plasmid has ampicillin resistance and the Promoters plasmid is resistant to...media which unlike LB is not fluorescent but is less rich in nutrients. Again...3 . Since the T7 promoter which governs the transcription of both plasmids is...different wavelengths. To determine a value for the promoter strength we...protein is produced....']"},{"machine":"BBa_K1689016","videoId":"BBa_K1689016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24D - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1336003","videoId":"BBa_K1336003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24E - [ Coding ] []"},{"machine":"BBa_K1689017","videoId":"BBa_K1689017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24F - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1351021","videoId":"BBa_K1351021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24G - [ Coding,cds, reporter, rfp, chassis, prokaryote, bsubtilis, function, reporter, fluorescence ] ['This part was created in order to enhance the Bacillus BioBrick...This vector is optimized for the use in B. subtilis and shows a rather weak...cloned into E. coli . The rather weak color is due to the vector which shows...This part was generated in a modified version of RFC25 where a strong Shine...Dalgarno Sequence SD is included and has the following prefix and suffix ...This part is used in the 2014 LMU Munich iGEM project...']"},{"machine":"BBa_K1689018","videoId":"BBa_K1689018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24H - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_K1351000","videoId":"BBa_K1351000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24I - [ Coding,cds, chassis, prokaryote, bsubtilis ] ['This part was generated in a modified version of RFC25 where a strong Shine...Dalgarno Sequence SD is included and has the following prefix and suffix ...This part is used in the 2014 LMU Munich iGEM project...']"},{"machine":"BBa_K1592000","videoId":"BBa_K1592000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24J - [ Coding,chassis, eukaryote, yeast ] ['substrates for diamino peptidase the dibasic KR cleavage site is substrate...plasmid . Mcfp3 protein is about 12kDa....What s more exciting is that we successfully published a paper A living...this structure is very important. For example in desert sand consolidation...finding is comparable to the results from the Si tag silica binding test in...']"},{"machine":"BBa_K1351001","videoId":"BBa_K1351001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24K - [ Coding,cds, chassis, prokaryote, bsubtilis ] ['This part was generated in a modified version of RFC25 where a strong Shine...Dalgarno Sequence SD is included and has the following prefix and suffix ...']"},{"machine":"BBa_K1592001","videoId":"BBa_K1592001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 5, 24L - [ Coding ] ['Mcfp 3 is foot protein secreted from Mytilus californianus. The protein is of...and stable products. Further it is noteworthy that the protein shows an...function. To verify the function of Mcfp3 we use the promoter hp4d to express...plasmid . Mcfp3 protein is about 12kDa....on object slides after wash The flocculating test material is 30x...sedimentation caused by released CO2. This is the final and vital step of the...utilization this structure is very important. For example in desert sands...What s more exciting is that we successfully published a paper A living...this structure is very important. For example in desert sand consolidation...finding is comparable to the results from the Si tag silica binding test in...']"},{"machine":"BBa_B0011","videoId":"BBa_B0011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1A - [ Terminator,direction, bidirectional, terminator, single ] [' Appears to be a bidirectional terminator since it contains a string of T s on the direct strand after the stem loop and on the reverse strand before the stem loop. It is also found between two coding regions that point toward each other.... Burden Imposed by this Part ...']"},{"machine":"BBa_K352002","videoId":"BBa_K352002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1B - [ Regulatory ] ['pCooF Promoter from Rhodospirillum rubrum...Rhodospirillum rubrum is able to use CO as an carbon source with its CO ...the P cooF promoter similar to the arrangement of class II CRP cAMP...protein dependent promoters when expressed in Escherichia coli....']"},{"machine":"BBa_B0024","videoId":"BBa_B0024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1C - [ Terminator,direction, bidirectional, terminator, double ] []"},{"machine":"BBa_K352003","videoId":"BBa_K352003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1D - [ Regulatory ] ['pCooM Promoter from Rhodospirillum rubrum...PcooF and PcooM the two CooA regulated R. rubrum promoters contain 2 fold...CooA regulated promoters are analogous to class II CRP dependent promoters. We...chose PcooF for this study because it is the stronger promoter based on the...']"},{"machine":"BBa_B0025","videoId":"BBa_B0025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1E - [ Terminator,direction, reverse, terminator, double ] ['This structure is from... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K387003","videoId":"BBa_K387003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1F - [ Regulatory ] ['PfdhF fdhF promoter a hypoxia inducible promoter...Hypoxia inducible promoter. Under hypoxia environment it has a much higher... Characterization of PfdhF the hypoxia inducible promoter...characterized the hypoxia inducible promoter fdhF promoter PfdfF Part ...']"},{"machine":"BBa_B0031","videoId":"BBa_B0031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1G - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['Registry and two consitutive Anderson Family Promoters... Galactosidase is an enzyme that is commonly used as a reporter marker to...monitor gene expression. It is encoded by the LacZ gene and its function in...the cell is to cleave lactose to glucose and galactose. Galactosidase assay...']"},{"machine":"BBa_K622006","videoId":"BBa_K622006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1H - [ Translational_Unit,cds, enzyme ] ['This part codes ChiA1 and its RBS. Its start codon is not AUG but GUG....ChiA gene we used is derived from Streptomyces avermitilis . S. avermitilis ...']"},{"machine":"BBa_B0032","videoId":"BBa_B0032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1I - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to...Global non modularity towards promoters protein coding parts and relative...Characterization of this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter coding...']"},{"machine":"BBa_K823015","videoId":"BBa_K823015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1J - [ Regulatory ] ['Pxyl a xylose inducible promoter its regulator XylR...P xyl is a promoter which is repressed by XylR. In presence of Xylose XylR...leaves the operator sequence and the P xyl is active. XylR is present in...keeps the promoter tight....XylR is provided with constitutive promoter RBS and terminator....']"},{"machine":"BBa_B0033","videoId":"BBa_B0033","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1K - [ RBS,rbs, prokaryote, constitutive, community, ribosome, prokaryote, ecoli, chassis, prokaryote, ecoli, direction, forward, regulation, constitutive ] ['is the weakest and whose RBS strength is 0.35 of...number of purines in the RBS sequence which is beneficial to the binding of... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K731500","videoId":"BBa_K731500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1L - [ Regulatory ] [' LacI LacIq promoter reverse tac promoter lac operator forward... tac promoter followed by a lac operator in the forward direction. It is a...with a strong E.coli promoter and under the control of IPTG. The lac ...This part is an improvement of...']"},{"machine":"BBa_B0034","videoId":"BBa_B0034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1M - [ RBS,chassis, prokaryote, ecoli, direction, forward, function, coliroid, rbs, prokaryote, constitutive, community, regulation, constitutive, ribosome, prokaryote, ecoli ] ['Global non modularity towards promoters protein coding parts and relative...Note The Elowitz RBS is the definition of efficiency 1.0....Characterization of the this part was performed with the transcriptional unit...assembled in a Golden Braid alpha1 plasmid using the same promoter CDS and...']"},{"machine":"BBa_K808027","videoId":"BBa_K808027","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1N - [ Coding,cds, membrane, cds, membrane, extracellular ] ['EstA is a membrane bound but inactive esterase from Pseudomonas aeruginosa ....']"},{"machine":"BBa_C0012","videoId":"BBa_C0012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1O - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['improve the switch time for High to Low performance of this part....This particular LacI protein was derived from E. coli and contributed by...more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...']"},{"machine":"BBa_K729002","videoId":"BBa_K729002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 1P - [ Coding ] ['by a number of different bacteria and fungi. This is due to conserved copper...By driving the laccase production using a strong constitutive promoter we...Plastic degradation is mediated via a laccase protein. As such we will be...enough quantities that it is released into the extracellular space. This...']"},{"machine":"BBa_J04450","videoId":"BBa_J04450","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 14A - [ Reporter,cds, reporter, chromoprotein, classic, reporter, pret, function, reporter, color, function, reporter, pigment ] ['contain a degradation tag and the RBS is strong....LacI and induced by IPGT. Plac is one of the most common promoter in life...science research field. It is mainly composed of Lac operon containing LacO...the binding of RNA polymerase to the promoter. So the expression of downstream...']"},{"machine":"BBa_K1114000","videoId":"BBa_K1114000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2B - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Summary of modifications from original part Backbone is a modified version of...']"},{"machine":"BBa_K1114002","videoId":"BBa_K1114002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2D - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114003","videoId":"BBa_K1114003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2F - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114005","videoId":"BBa_K1114005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2H - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114007","videoId":"BBa_K1114007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2J - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114009","videoId":"BBa_K1114009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2L - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114010","videoId":"BBa_K1114010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2N - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114011","videoId":"BBa_K1114011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 2P - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_C0040","videoId":"BBa_C0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3A - [ Coding,cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...the biobrick part is not of potential allergen status. In the 80 amino acid...initiation phase including ribosome binding of translation is the rate ...']"},{"machine":"BBa_K729004","videoId":"BBa_K729004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3B - [ Coding ] ['has pT7 promoter. DNase agar contains DNA which our extracellular nuclease...digests. This digestion is observed by adding hydrochloric acid to the agar...As seen in our DNase agar plate there is a clear halo surrounding our...digested the DNA in the agar. No such halo is present in our untransformed...']"},{"machine":"BBa_C0050","videoId":"BBa_C0050","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3C - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['Here is an alignment of the HK022 cI repressor the lambda cI repressor the...Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More... Burden Imposed by this Part ...']"},{"machine":"BBa_K797002","videoId":"BBa_K797002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3D - [ Signalling ] ['This part is coding N terminal torA signal region. Proteins conjugated torA...part with the enzym of TMAOreductase. This parts include RBS so that you don t...bother to insert new RBS between this signal and your promoter. Note ...because wild type Tat pathway is relatively saturated easily. ...']"},{"machine":"BBa_C0051","videoId":"BBa_C0051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3E - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['An alternate version of this part is available without a barcode ...site is on the 606 599 base number of the BioBrick and on the 4 11 base number...of the VF2 primer. The the second location of the internal priming site is on...primer. The third location of the internal priming site is on the 484 490 base...']"},{"machine":"BBa_K797004","videoId":"BBa_K797004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3F - [ Device ] ['Tat secretion cassette with constitutive promoter....protein secretion system is too week so that Kyoto 2012 construct Tat cassette...to reinforce the ability of transportation of Tat system. This parts include...protein is the main component of Tat complex where proteins with torA signal...']"},{"machine":"BBa_C0052","videoId":"BBa_C0052","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3G - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['The 434 cI repressor protein coding sequence is a 710 base pair sequence with...434 cI is a member of the lamboid cI protein family....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K801041","videoId":"BBa_K801041","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3H - [ Composite,chassis, prokaryote, ecoli, proteindomain, proteindomain, binding, proteindomain, dnabinding, proteindomain, localization ] ['SV40NLS PhyB linker LexA part for a LexA based light switchable promoter...switchable promoter system. The LexA of this part is responsible for binding...of LexA operator sequence upstream from a minimal promoter hence upstream from...The PhyB part is responsible for the direct recruitment of PIF3 phytochrome...']"},{"machine":"BBa_C0053","videoId":"BBa_C0053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3I - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['The P22 c2 repressor protein coding sequence is a 720 base pair sequence with...P22 c2 is a member of the lamboid cI protein family....Barcodes are discontinued but one was appended to the sequence of this part....Composite parts using this part will include the barcode. More...']"},{"machine":"BBa_K737016","videoId":"BBa_K737016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3J - [ Coding ] ['This part conteins gvpA protein s coding sequence....This part conteins gvpA protein s coding sequence. This gene from Planktothrix...ligated on cloning vector pSB4A5 we didn t register this part. The gvpA...cl02594 . This gene is quiet conserved in most gvp s polycistron. According to...']"},{"machine":"BBa_C0060","videoId":"BBa_C0060","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3K - [ Coding,cds, function, biosynthesis, ahl, function, cellsignalling, function, degradation, ahl ] ['it is believed that it is not secreted. This is supported by the observation...V1001 or Bacillus 240B1 cells no autoinducer inactivation is detected in...well conserved motifs it is believed that it is a metalloenzyme....One of the fundamental Biobricks of this project is the aiiA gene it...']"},{"machine":"BBa_K801011","videoId":"BBa_K801011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3L - [ Terminator,chassis, eukaryote, yeast, terminator, single ] []"},{"machine":"BBa_C0061","videoId":"BBa_C0061","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3M - [ Coding,function, biosynthesis, ahl, function, cellsignalling ] ['The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the Lux Lux Lux repressor ...site on the promoter increasing the rate of transcription....']"},{"machine":"BBa_K811005","videoId":"BBa_K811005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3N - [ Protein_Domain ] ['also ensure that your insert is in frame with the INPNC GSlinker so that it...Ice nucleation protein INP is a protein found in Xanthomonas campestris ...INP for its surface display properties. In nature the protein is anchored in...The INP protein is composed of a N terminal region that appears to interact...']"},{"machine":"BBa_C0062","videoId":"BBa_C0062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3O - [ Coding,cds, cds, transcriptionalregulator, activator, cds, transcriptionalregulator, repressor, function, cellsignalling, function, regulation, transcriptional ] ['In complex with HSL LuxR binds to the Lux promoter activating transcription...The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the Lux activator LuxR complexed...']"},{"machine":"BBa_K1122006","videoId":"BBa_K1122006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 3P - [ Coding,cds, reporter, rfp, function, reporter, fluorescence ] []"},{"machine":"BBa_K1114012","videoId":"BBa_K1114012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4B - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114014","videoId":"BBa_K1114014","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4D - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114016","videoId":"BBa_K1114016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4F - [ Regulatory ] ['This is a promoter from the Anderson Promoter library in MoClo format. This is...of modifications from original part Backbone is a modified version of pSB1C3...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114018","videoId":"BBa_K1114018","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4H - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114020","videoId":"BBa_K1114020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4J - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114021","videoId":"BBa_K1114021","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4L - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114023","videoId":"BBa_K1114023","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4N - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_K1114025","videoId":"BBa_K1114025","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 4P - [ Regulatory ] ['This is the MoClo http 2013.igem.org Team BostonU MoCloChara formatted...This is a Level 0 MoClo part with flanking sites A on the 5 side and site B...Backbone is a modified version of pSB1C3 with added SpeI site in front of...']"},{"machine":"BBa_E0020","videoId":"BBa_E0020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10H - [ Coding,function, reporter, function, reporter, fluorescence ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...the biobrick part is not of potential allergen status. In 80 amino acid...this biobrick. This also means that there is not of potential allergen status....']"},{"machine":"BBa_K1017726","videoId":"BBa_K1017726","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5B - [ Composite ] ['We design this part to change heme into phycocyanobilin PCB . The following is...phycocyanobilin is not naturally produced in E. coli. We therefore introduced...In this part Pcons is a constitutive promoter family member from J23100 to...what we choose is J23101. B0030 and B0032 are strong ribosome binding...']"},{"machine":"BBa_E0022","videoId":"BBa_E0022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5C - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1231000","videoId":"BBa_K1231000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5D - [ Regulatory ] ['The asr promoter is a pH responsive promoter....This part contains the asr promoter with its native RBS. The asr promoter is a...pH responsive promoter native to E. coli. It induces transcription in acidic...PhoB protein binds to the promoter region of asr. By analyzing the sequence of...']"},{"machine":"BBa_E0032","videoId":"BBa_E0032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5E - [ Reporter,function, reporter, function, reporter, fluorescence ] ['the same promoter and terminator connected GFP. Culture the E. coli in 5 mL...1 . We successfully connected the gene fragment between the promoter and...fluorescence but the fluorescence is very weak....in the same vector with the same promoter and terminator. The fluorescent...']"},{"machine":"BBa_K1033225","videoId":"BBa_K1033225","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5F - [ Regulatory,chassis, prokaryote, lactococcus, Kit plates, probiotics, control ] ['Promoter CP44...CP44 is the strongest promoter in the CP Kit plate with the strength of 4.05...compared to the promoter J23101 in standard parts J23101 was used as... Uppsala2013 Promoterdiagram.png http 2013.igem.org wiki images 6 64 Uppsala2013 Promoterdiagram.png ...']"},{"machine":"BBa_R0011","videoId":"BBa_R0011","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5G - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter lacI regulated lambda pL hybrid ...etc. The PLlac 0 1 promoter is a hybrid regulatory region consisting of the...promoter P L of phage lambda with the cI binding sites replaced with lacO1....Strong promoter. jb 5 24 04 ...which is commonly used to express protein. Then by measuring the EGFP...']"},{"machine":"BBa_K1185000","videoId":"BBa_K1185000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5H - [ DNA,cds, membrane, chassis, chassis, prokaryote, bsubtilis ] ['This is an ENGINEERED BioBrick that can be used as a switch to enable the...subtilis via homologous recombination. Within the BioBrick there is a xylose ...controlled promoter PxylR . This promoter is upstream of the murE coding...expression under the control of PxylR . The murE gene is responsible for...']"},{"machine":"BBa_R0040","videoId":"BBa_R0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21P - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, negative, rnap, prokaryote, ecoli, sigma70 ] ['TetR repressible promoter...Sequence for pTet inverting regulator. Promoter is constitutively ON and...repressed by TetR. TetR repression is inhibited by the addition of...Medium strength promoter. jb 5 24 04 ... In contrast to tetracycline anhydrotetracycline is a particularly useful...']"},{"machine":"BBa_K1104301","videoId":"BBa_K1104301","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5J - [ Coding ] ['Defensin is a grand group of antimicrobial peptides having numerous kinds of...Importantly the sequence here is the mature peptide sequence because there...genome DNA. That is to say it is better to synthesize the gene through...The cytoplasmic membrane is a frequent target but peptides may also interfere...']"},{"machine":"BBa_R0051","videoId":"BBa_R0051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5K - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, negative, rnap, prokaryote, ecoli, sigma70 ] ['promoter lambda cI regulated ...The cI regulated promoter is based on the pR promoter from bacteriophage...lambda. The promoter has two DNA binding sites for lambda cI repressor...here is based on the cI repressible promoter used in the Elowitz repressilator...']"},{"machine":"BBa_K1104300","videoId":"BBa_K1104300","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5L - [ Coding ] ['Abaecin is a kind of antimicrobial peptides of honey bees western eastern ....Importantly the sequence here is the mature peptide sequence because there...genome DNA. That is to say it is better to synthesize the gene through...The cytoplasmic membrane is a frequent target but peptides may also interfere...']"},{"machine":"BBa_R0053","videoId":"BBa_R0053","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5M - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter p22 cII regulated ...The p22 cII regulatory region sequence is a 97 base pair sequence with the...p22 cII is a member of the lamboid cI protein family. Weak medium promoter.... promoter ...']"},{"machine":"BBa_K1033900","videoId":"BBa_K1033900","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5N - [ Reporter,function, reporter, function, reporter, color ] ['the color development is slower. The color is readily observed in both LB or...This part is useful as a reporter....version is codon optimized for E coli by Genscript....']"},{"machine":"BBa_R0062","videoId":"BBa_R0062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5O - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, function, cellsignalling, LuxR, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter luxR HSL regulated lux pR ...Promoter activated by LuxR in concert with HSL...The lux cassette of V. fischeri contains a left and a right promoter. The...right promoter gives weak constitutive expression of downstream genes.This...expression is up regulated by the action of the LuxR activator protein...']"},{"machine":"BBa_K1033903","videoId":"BBa_K1033903","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 5P - [ Reporter,function, reporter, function, reporter, color ] ['This part is useful as a reporter....the high copy plasmid pSB1C3 from the promoters J23116 and J23110....']"},{"machine":"BBa_K1114100","videoId":"BBa_K1114100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6B - [ RBS ] ['This is a ribosomal binding site. ...This is a Level 0 MoClo part with flanking sites B on the 5 side and site C...']"},{"machine":"BBa_K1114101","videoId":"BBa_K1114101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6D - [ RBS ] ['This is a ribosomal binding site. ...This is a Level 0 MoClo part with flanking sites B on the 5 side and site C...']"},{"machine":"BBa_K1114102","videoId":"BBa_K1114102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6F - [ RBS ] ['This is a ribosomal binding site. ...This is a Level 0 MoClo part with flanking sites B on the 5 side and site C...']"},{"machine":"BBa_K1114103","videoId":"BBa_K1114103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6H - [ RBS ] ['This is a ribosomal binding site. ...This is a Level 0 MoClo part with flanking sites B on the 5 side and site C...']"},{"machine":"BBa_K1114104","videoId":"BBa_K1114104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6J - [ RBS ] ['This is a ribosomal binding site. ...This is a Level 0 MoClo part with flanking sites B on the 5 side and site C...']"},{"machine":"BBa_K1114107","videoId":"BBa_K1114107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6L - [ RBS ] ['This part is a MoClo href adapted bicistronic design BCD element which...the library of BCDs this is a MoClo version of BCD2 BioFAB apFAB682 and...we obtained the sequence data for this part from the...This BCD is flanked by two MoClo fusion sites B on the 5 end and C on the 3 ...']"},{"machine":"BBa_K1114108","videoId":"BBa_K1114108","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6N - [ RBS ] ['This part is a MoClo href adapted bicistronic design BCD element which...the library of BCDs this is a MoClo version of BCD8 BioFAB apFAB686 and...we obtained the sequence data for this part from the...This BCD is flanked by two MoClo fusion sites B on the 5 end and C on the 3 ...']"},{"machine":"BBa_K1114109","videoId":"BBa_K1114109","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 6P - [ RBS ] ['This part is a MoClo href adapted bicistronic design BCD element which...the library of BCDs this is a MoClo version of BCD12 BioFAB apFAB690 and...we obtained the sequence data for this part from the...This BCD is flanked by two MoClo fusion sites B on the 5 end and C on the 3 ...']"},{"machine":"BBa_R0063","videoId":"BBa_R0063","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7A - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized, function, cellsignalling, LuxR ] ['Promoter luxR HSL regulated lux pL ...The lux cassette of V. fischeri contains a left and a right promoter. The left...promoter gives weak constitutive expression of downstream genes.This...expression is down regulated by the action of the Lux repressor LuxR. Two...']"},{"machine":"BBa_K1033907","videoId":"BBa_K1033907","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7B - [ Reporter ] ['the color development is slower. The color is readily observed in both LB or...The absorption wavelength maximum of cjBlue is approximately 610 nm 1 . The...maximum absorption wavelength of fwYellow is 523 nm 2 . Given that the...each fluorescent protein is accurate....']"},{"machine":"BBa_R0065","videoId":"BBa_R0065","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7C - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, regulation, negative, regulation, multiple, classic, regulatory, uncategorized ] ['Promoter lambda cI and luxR regulated hybrid ...cI repressor negatively regulates this promoter and LuxR activates its...transcription.The effect of cI is dominant over LuxR. This part is based on...the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron...']"},{"machine":"BBa_K1033913","videoId":"BBa_K1033913","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7D - [ Reporter,Kit plates, chromoprotein, uppsala ] ['the color development is slower. The color is readily observed in both LB or...This part is useful as a reporter....']"},{"machine":"BBa_R1051","videoId":"BBa_R1051","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter Standard lambda cI regulated ... Note This is the same part as R0051 except that the 10 and 35 sites and...The cI regulated promoter is based on the pR promtoer from bacteriohage...lambda. The promoter has two two DNA binding sites for lambda cI repressor...']"},{"machine":"BBa_K1033914","videoId":"BBa_K1033914","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7F - [ Reporter,function, reporter, function, reporter, color, function, reporter, fluorescence ] ['the color development is slower. The color is readily observed in both LB or... Instability index The instability index II is computed to be 27.07....']"},{"machine":"BBa_R1062","videoId":"BBa_R1062","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7G - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, LuxR ] ['Promoter Standard luxR and HSL regulated lux pR ... Note This is the same part as R0062 except that the 10 and 35 sites and...Promoter activated by LuxR in concert with HSL...The lux cassette of V. fischeri contains a left and a right promoter. The...']"},{"machine":"BBa_K1033915","videoId":"BBa_K1033915","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7H - [ Reporter,Kit plates, chromoprotein, uppsala, function, reporter, function, reporter, color, function, reporter, fluorescence ] ['the color development is slower. The color is readily observed in both LB or...This part is useful as a reporter....GenBank AF168421.1 . This version is codon optimized for E coli by...']"},{"machine":"BBa_E0430","videoId":"BBa_E0430","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7I - [ Reporter,classic, reporter, ret ] ['Team USP Brazil in 2018 has improved this part...Another good point for using this is that dividing fluorescence measurements...responsive promoters activity we compared the variance of our controls which...constitutive. When plateauing it is clear that the normalization by CFP gives...']"},{"machine":"BBa_K1033922","videoId":"BBa_K1033922","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7J - [ Reporter,Kit plates, chromoprotein, uppsala ] ['the color development is slower. The color is readily observed in both LB or...This part is useful as a reporter....']"},{"machine":"BBa_E0420","videoId":"BBa_E0420","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7K - [ Reporter,classic, reporter, ret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1033923","videoId":"BBa_K1033923","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7L - [ Reporter ] ['naked eye. The strong color is readily observed in both LB or on agar plates...This part is useful as a reporter....the high copy plasmid pSB1C3 from the promoters J23110 left and J23106... Instability index The instability index II is computed to be 26.85....']"},{"machine":"BBa_E0422","videoId":"BBa_E0422","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7M - [ Reporter,classic, reporter, ret ] ['This part can be used to test promoter strength or the proper functioning of a...regulator device. The LVA tail is particularly useful when testing a...In this experiment the E0422 part was associated with a cI regulated promoter...fluorescence excitation curve by connecting it to the combined promoters...']"},{"machine":"BBa_K1033925","videoId":"BBa_K1033925","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7N - [ Reporter,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['naked eye. The strong color is readily observed in both LB or on agar plates...This part is useful as a reporter....the high copy plasmid pSB1C3 from the promoters J23110 left and J23106...']"},{"machine":"BBa_I0462","videoId":"BBa_I0462","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7O - [ Generator,classic, generator, rct, function, cellsignalling, function, regulation, transcriptional ] ['transcription from R0062 the right hand Lux promoter...']"},{"machine":"BBa_K1033927","videoId":"BBa_K1033927","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 7P - [ Reporter,Kit plates, chromoprotein, uppsala, function, reporter, color ] ['the naked eye. The strong color is readily observed in both LB or on agar...This part is useful as a reporter.... iGEM2013 Uppsala Expression of asPink in E. coli DH5alpha by promoter...under the name asFP595 GenBank AAG02385.1 . This version is codon optimized...']"},{"machine":"BBa_K1114110","videoId":"BBa_K1114110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8B - [ RBS ] ['This part is a MoClo href adapted bicistronic design BCD element which...the library of BCDs this is a MoClo version of BCD13 BioFAB apFAB691 and...we obtained the sequence data for this part from the...This BCD is flanked by two MoClo fusion sites B on the 5 end and C on the 3 ...']"},{"machine":"BBa_K1114111","videoId":"BBa_K1114111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8D - [ RBS ] ['This part is a MoClo href adapted bicistronic design BCD element which...the library of BCDs this is a MoClo version of BCD16 BioFAB apFAB694 and...we obtained the sequence data for this part from the...This BCD is flanked by two MoClo fusion sites B on the 5 end and C on the 3 ...']"},{"machine":"BBa_K1401008","videoId":"BBa_K1401008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8F - [ Regulatory ] ['Tandem Promoter pBad pTet...This tandem promoter is a combination of pBAD pTetR and was created using the...MoClo assembly method. This is a Level 0 MoClo part with flanking sites A on... CGCT G TGCC H ACTA. This tandem promoter is in pSB1C3....']"},{"machine":"BBa_K783024","videoId":"BBa_K783024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8H - [ Regulatory ] ['regulated pLuxR promoter. It has two MoClo fusion sites flanking it....']"},{"machine":"BBa_K783028","videoId":"BBa_K783028","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8J - [ Regulatory ] ['flanking this part....']"},{"machine":"BBa_K783031","videoId":"BBa_K783031","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8L - [ Regulatory ] []"},{"machine":"BBa_K783032","videoId":"BBa_K783032","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 8N - [ Regulatory ] []"},{"machine":"BBa_K1467101","videoId":"BBa_K1467101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15L - [ Regulatory,chassis, eukaryote, nbenthamiana, promoter, regulation, constitutive ] ['GoldenGate compatible 35s Promoter...35S is a plant specific promoter obtained from the Cauliflower Mosaic Virus....The part is intended for use as a constitutive promoter for gene expression...experiments in plants. This part is compatible with GoldenGate MoClo Assembly...']"},{"machine":"BBa_S0105","videoId":"BBa_S0105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9A - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K1033906","videoId":"BBa_K1033906","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9B - [ Coding,cds, reporter, chromoprotein, Kit plates, chromoprotein, uppsala, function, reporter, pigment ] ['This part is useful as a reporter....the high copy plasmid pSB1C3 from the promoters J23116 and J23110....After purification the protein is seen as a band at a size of approximately...can conclude that tsPurple s molecular weight is around 25.5 kDa this result...']"},{"machine":"BBa_P0151","videoId":"BBa_P0151","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9C - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K1033917","videoId":"BBa_K1033917","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9D - [ Reporter ] ['the color development is slower. The color is readily observed in both LB or...The iGEM team of Rotterdam 2019 characterized this part more as part of the...addition to the characterization tests is to see whether there will be a... Instability index The instability index II is computed to be 39.71....']"},{"machine":"BBa_P0152","videoId":"BBa_P0152","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9E - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K1033926","videoId":"BBa_K1033926","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9F - [ Reporter ] ['naked eye. The strong color is readily observed in both LB or on agar plates...The iGEM team of Rotterdam 2019 characterized this part more as part of the...addition to the characterization tests is to see whether there will be a...This part is useful as a reporter....']"},{"machine":"BBa_P0153","videoId":"BBa_P0153","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9G - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K1033928","videoId":"BBa_K1033928","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9H - [ Reporter,function, reporter ] ['aeBlue is a blue chromoprotein extracted from the basal disk of a beadlet...the name aeCP597. This version is codon optimized for E coli by Bioneer...Below to the left is the expressed aeBlue in E coli . To the right comparison...']"},{"machine":"BBa_P0440","videoId":"BBa_P0440","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9I - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_K1033929","videoId":"BBa_K1033929","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9J - [ Reporter,Kit plates, chromoprotein, uppsala, function, reporter, color ] ['aeBlue is a blue chromoprotein extracted from the basal disk of a beadlet...the name aeCP597. This version is codon optimized for E coli by Bioneer...Below to the left is the expressed aeBlue in E coli . To the right comparison...This part is useful as a reporter for biology....']"},{"machine":"BBa_R0077","videoId":"BBa_R0077","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9K - [ Regulatory,classic, regulatory, uncategorized ] ['Promoter cinR and HSL regulated RBS ...this promoter and activates transcription....This promoter contains the RBS TGGAGG...This promoter is the intergenic region from the CinRI locus....separate transcriptional elements. There is a short 200bp intergenic region...']"},{"machine":"BBa_K1033930","videoId":"BBa_K1033930","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9L - [ Reporter,Kit plates, chromoprotein, uppsala, function, reporter, color ] ['requiring no instruments to observe. The strong color is readily observed in...This part is useful as a reporter....']"},{"machine":"BBa_R0074","videoId":"BBa_R0074","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9M - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, negative, classic, regulatory, uncategorized ] ['Promoter PenI regulated ... Expression Level of the Mnt and PenI Regulated Promoters... The PenI regulated promoter exhibits a stronger expression than the Mnt ...regulated promoter. ...Applicability of two different promoters was studied for the expression of...']"},{"machine":"BBa_K1033931","videoId":"BBa_K1033931","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9N - [ Reporter,Kit plates, chromoprotein, uppsala, function, reporter, function, reporter, color, function, reporter, fluorescence ] ['exhibits strong yellow color when expressed. The color is readily visible to...This part is useful as a reporter....']"},{"machine":"BBa_S03119","videoId":"BBa_S03119","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9O - [ Intermediate,classic, intermediate, uncategorized ] []"},{"machine":"BBa_K1159001","videoId":"BBa_K1159001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 9P - [ Coding,cds, reporter, chassis, eukaryote, ppatens, function, reporter, light ] ['NanoLuc Luciferase is engineered ATP independent luciferase from a deep sea...NanoLuc luciferase is twice smaller compared to other luciferase only 19...The Nano Luciferase NanoLuc which was introduced in 2013 by Promega is a new...advantages compared to the other family members. The NanoLuc is very small 19...']"},{"machine":"BBa_K1467102","videoId":"BBa_K1467102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10B - [ Regulatory,chassis, eukaryote, nbenthamiana, promoter, regulation ] ['GoldenGate compatible BS3 promoter 5...BS3 is a plant specific promoter which is induced by the TALE AvrBS3. The...promoter is a useful tool in testing a system in which protein expression is...This part is compatible with the GoldenGate MoClo Assembly Standard as it is...']"},{"machine":"BBa_K1467103","videoId":"BBa_K1467103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10D - [ Regulatory,chassis, eukaryote, nbenthamiana, promoter, regulation ] ['PDF 1.2 is a plant specific promoter which is induced by the compound Methyl...PDF1.2 promoter is useful for testing a system in which protein expression is...This part is compatible with the GoldenGate MoClo Assembly Standard as it is...This promoter was used by iGEM14 NRP UEA Norwich to induce expression of...']"},{"machine":"BBa_K1467104","videoId":"BBa_K1467104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15N - [ Regulatory,chassis, eukaryote, nbenthamiana, promoter, regulation, constitutive ] ['GoldenGate compatible MAS promoter...MAS Mannopine synthase is a plant specific promoter which is constitutively...expressed. This part is compatible with the GoldenGate MoClo Assembly Standard...as it is free from internal BsaI and BpiI recognition sequences....']"},{"machine":"BBa_E0030","videoId":"BBa_E0030","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10J - [ Coding,function, reporter, function, reporter, fluorescence ] ['more likely the biobrick is allergenic cross reactive. In the full length...biobrick has a Precaution Status meaning there is a potential risk with using...means that the biobrick part is NOT of potential allergen status. In 80 amino...for this biobrick. This also means that there is NOT of potential allergen...']"},{"machine":"BBa_J97004","videoId":"BBa_J97004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10L - [ Coding ] []"},{"machine":"BBa_J97005","videoId":"BBa_J97005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10N - [ Coding ] []"},{"machine":"BBa_J97006","videoId":"BBa_J97006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 10P - [ Coding ] []"},{"machine":"BBa_R0079","videoId":"BBa_R0079","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11A - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, function, cellsignalling, LasR, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter LasR PAI regulated ...Abstract from above The enzyme elastase is an important virulence factor of...the lasB promoter region to learn more about lasB activation by LasR and PAI....We report that the lasB transcriptional start is located 141 nucleotides...']"},{"machine":"BBa_K1159101","videoId":"BBa_K1159101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11B - [ Coding ] ['TEV Protease is not wanted. The necessary C terminal half can be found under...']"},{"machine":"BBa_R0071","videoId":"BBa_R0071","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11C - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, RhlR ] ['Promoter RhlR C4 HSL regulated ...Promoter activated by RhlR in concert with C4 HSL. C4 HSL is produced by RhlI ...This is the natural sequence taken from Pseudomonas aeruginosa....Crosstalk this promoter is also activated at a low level by LasR with its...']"},{"machine":"BBa_K1159102","videoId":"BBa_K1159102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11D - [ Coding ] ['TEV Protease is not wanted. The necessary N terminal half can be found under...']"},{"machine":"BBa_R0080","videoId":"BBa_R0080","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11E - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter AraC regulated ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...expression level under 30 . And the optimum concentration under 30 is 0.1 of...']"},{"machine":"BBa_K1172201","videoId":"BBa_K1172201","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11F - [ Coding,cds, biosynthesis, cds, enzyme ] ['Cells. The main goal when improving MFCs is to enhance the kinetics of the...Increasing the mediator concentration in the MFC is an efficient way to...NAD and glycerol which is the main carbon source in our medium. We were able...overexpression of the glycerol dehydrogenase in Escherichia coli is a great...']"},{"machine":"BBa_F2622","videoId":"BBa_F2622","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11G - [ Signalling,classic, signalling, receiver, function, cellsignalling ] []"},{"machine":"BBa_K1172303","videoId":"BBa_K1172303","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11H - [ Coding,cds, biosynthesis ] [' Function Catalyzes the deamination of 2 5 diamino 6 ribosylamino 4 3H pyrimidinone 5 phosphate which is an intermediate step in the biosynthesis of riboflavin....Riboflavin or Vitamin B2 is a redox active substance that plays an essential...']"},{"machine":"BBa_I13602","videoId":"BBa_I13602","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11I - [ Reporter,classic, reporter, pret ] ['This part can be used to test the classical Tet repression system with a CFP...reporter. The Ptet promoter used is a medium strength promoter.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...']"},{"machine":"BBa_K1150000","videoId":"BBa_K1150000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11J - [ Coding,function, crispr, function, crispr, cas9 ] ['dCas9 is a codon optimized and standardized RFC...Cas9 is the main protein of the CRISPR Cas system II of Streptococcus...recognizing and cleaving of invading phage DNA. This recognition is based on...This dCas9 is codon optimized for human cell lines and standardized RFC...']"},{"machine":"BBa_I13401","videoId":"BBa_I13401","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11K - [ Reporter,function, reporter ] ['This part will be suffixed to a promoter.RBS library. The purpose of the...experiment is to make a first pass at a library based construction step to...']"},{"machine":"BBa_K1150017","videoId":"BBa_K1150017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11L - [ Device,function, crispr, function, crispr, cas9 ] ['dCas9 with CMV promoter...Cas9 is a protein that binds DNA via an protein RNA DNA interaction. This...that it allows DNA binding without cutting. The sequence is human codon...optimized. The protein is part of team Freiburg s 2013 the uniCAS...The dCas9 protein is able to target several loci at once as it interacts with...']"},{"machine":"BBa_E0240","videoId":"BBa_E0240","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11M - [ Reporter,classic, reporter, ret, plasmid, measurement ] []"},{"machine":"BBa_K950000","videoId":"BBa_K950000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11N - [ Regulatory,chassis, eukaryote, yeast, promoter, regulation, negative ] ['The FET3 protein is an essential element of Saccharomyces cerevisiae s iron...metabolism. FET3 is a multicopper oxidase that is responsible for high ...promoter of the FET3 gene Pfet3 of Saccharomyces cerevisiae is...Interestingly Pfet3 is also repressed by active membrane progesterone...']"},{"machine":"BBa_E0840","videoId":"BBa_E0840","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11O - [ Reporter,classic, reporter, ret, s ] ['contain any promoter thus it can only be used if cloned downstream of one. It...is also for this reason that this part...fluorescence with promoters of different strengths which can be used by...added either of the constitutive promoters...five different constitutive promoters at the excitation wavelength of 488 nm....']"},{"machine":"BBa_K1073022","videoId":"BBa_K1073022","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 11P - [ Reporter ] ['This device is an enhanced construct of 2012 Uppsala s...consists of a strong promoter...During cultivation the chromoprotein eforRed is expressed and stored... Absorbance spectrum Below is an absorbance spectrum for eforRed between...400nm and 850nm. Peak maxima is seen around 580nm....']"},{"machine":"BBa_J97007","videoId":"BBa_J97007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12B - [ Coding ] []"},{"machine":"BBa_E1012","videoId":"BBa_E1012","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12D - [ Coding ] []"},{"machine":"BBa_B0015","videoId":"BBa_B0015","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12F - [ Terminator,direction, forward, terminator, double ] [' This is the most commonly used terminator. It seems to be reliable. ... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1484103","videoId":"BBa_K1484103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12H - [ Coding ] ['form p hydroxybenzalacetone. This is an important step in the biosynthesis of...']"},{"machine":"BBa_K1742002","videoId":"BBa_K1742002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12J - [ Coding,cds, reporter, gfp, chassis, eukaryote, nbenthamiana, function, reporter, fluorescence ] ['fluorescence is switched on upon illumination with violet light 400 nm and...protein is contemplated as a visualization tool and it has recently been...substitution a homotetrameric complex is formed that monomerizes upon...binding domain DBD that binds its operator site nearby the promoter region...']"},{"machine":"BBa_K1742004","videoId":"BBa_K1742004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12L - [ Coding,chassis, eukaryote, nbenthamiana ] ['PhiC31 is a site specific serine recombinase derived from a Streptomyces...close to the promoter....strong promoter from the Cauliflower Mosaic Virus P35S and its terminator...subsequently assembled in a multipartite reaction with the P35S promoter with...']"},{"machine":"BBa_J04452","videoId":"BBa_J04452","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 12P - [ Reporter ] []"},{"machine":"BBa_I0466","videoId":"BBa_I0466","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13A - [ Signalling,function, cellsignalling ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K1073024","videoId":"BBa_K1073024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13B - [ Reporter ] ['This device is an enhanced construct of 2012 Uppsala s...consists of a strong promoter...During cultivation the chromoprotein amilGFP is expressed and stored...containing 5 ml LB which is called 0h. We culture bacterial cells at 37 C ...microplate reader. Total fluorescence is divided by OD600 to obtain...']"},{"machine":"BBa_C0261","videoId":"BBa_C0261","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13C - [ Translational_Unit,function, biosynthesis, ahl, function, cellsignalling ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1073026","videoId":"BBa_K1073026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13D - [ Reporter ] ['This device is an enhanced construct of 2012 Uppsala s...consists of a strong promoter...During cultivation the chromoprotein cjBlue is expressed and stored...']"},{"machine":"BBa_S03154","videoId":"BBa_S03154","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13E - [ Intermediate,classic, intermediate, uncategorized ] [' At Davidson College we sequenced this part from the 2007 registry and... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1073002","videoId":"BBa_K1073002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13F - [ Regulatory ] ['Inducible promoter of the lux quorum sensing system with RBS...This construct is derived from...the inducible promoter of the lux quorum sensing system of Vibrio fischeri ...inducible promoter see...']"},{"machine":"BBa_E0044","videoId":"BBa_E0044","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13G - [ Reporter,function, reporter, function, reporter, fluorescence ] []"},{"machine":"BBa_K1152006","videoId":"BBa_K1152006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13H - [ Composite ] ['band at 242kDa is clearly visible after induction with IPTG see figure 2 . To...prove that the Val Ind NRPS is in fact functional we purified the synthesized...fusion peptide is significantly slower compared the one of Indigoidine. The...']"},{"machine":"BBa_E0036","videoId":"BBa_E0036","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13I - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1152008","videoId":"BBa_K1152008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13J - [ Coding,cds, biosynthesis ] ['indigoidine. Indigoidine consists of two cyclic glutamines. IndC is a single...under the control of an lac inducible promoter. This indC expression cassette...endogenous PPTase entD which is responsible for the transfer of the...to activating domains of the enterobactin pathway but is able to activate the...']"},{"machine":"BBa_E0040","videoId":"BBa_E0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13K - [ Coding,cds, reporter, gfp, chassis, prokaryote, bsubtilis, chassis, prokaryote, ecoli, function, reporter, fluorescence ] ['GFP mut3b note that this part does not have a barcode ...promoters. ...the fluorescence intensity. This device consists of the promoter the GFP ...the transformation is successful. ...gene in Starmerella bombocola is completed. Finally we can link different...']"},{"machine":"BBa_K1027001","videoId":"BBa_K1027001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13L - [ Coding ] ['This enzyme is obtained fro the gene Stearoly Co A Desaturase SCD . The gene...is obtained from Synechocystis sp. a cyanobacterium.It is involved in the...']"},{"machine":"BBa_E0024","videoId":"BBa_E0024","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13M - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1132020","videoId":"BBa_K1132020","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13N - [ Composite ] ['This composite part can be used for a blue light sensitive system. It is built...Rbs YF1 rbs FixJ is a regulatory protein working with the promotor FixK2. In...darkness YF1 is phosphorylated and gives its phosphate group to FixJ. Once...phosphorylated FixJ can bind to FixK2 promoter and actives it. In light ...']"},{"machine":"BBa_E0026","videoId":"BBa_E0026","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13O - [ Reporter,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_K1093002","videoId":"BBa_K1093002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 13P - [ Coding,cds, reporter, cfp, function, reporter, fluorescence ] ['Superfolder Cyan Fluorescent Protein is a derivative of superfolder Green...plasmid with J23100 promoter and B0034 RBS in living cells in RF....']"},{"machine":"BBa_J04455","videoId":"BBa_J04455","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 14H - [ Reporter ] []"},{"machine":"BBa_E0034","videoId":"BBa_E0034","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15A - [ Reporter,function, reporter, function, reporter, fluorescence ] ['the same promoter and terminator connected GFP. Culture the E. coli in 5 mL...1 . We successfully connected the gene fragment between the promoter and...fluorescence but the fluorescence is very weak....in the same vector with the same promoter and terminator. The fluorescent...']"},{"machine":"BBa_K1033282","videoId":"BBa_K1033282","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15B - [ Reporter ] ['amilCP blue chromoprotein with strong promoter...We tested the functionality of K1033222 as a constitutive promoter and...']"},{"machine":"BBa_C0160","videoId":"BBa_C0160","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15C - [ Coding,cds, cds, enzyme, function, cellsignalling, function, degradation, ahl ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...they are frequently used to decide whether the enzyme is good or not...']"},{"machine":"BBa_K1390001","videoId":"BBa_K1390001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15D - [ Protein_Domain ] ['mmoB is one subunit of the mmo from Methylococcus capsulatus bath...']"},{"machine":"BBa_R0084","videoId":"BBa_R0084","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15E - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized ] ['Promoter OmpR positive ...Positively regulated OmpR controlled promoter. This promoter is taken from...In nature this promoter is upstream of the ompF porin gene and is both...activating and repressing. The regulation of ompF is determined by the EnvZ ...']"},{"machine":"BBa_K1390002","videoId":"BBa_K1390002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15F - [ Protein_Domain ] ['This part is an improvement of...To detect whether the BioBrick is synthesized in soluble form or in inclusion...']"},{"machine":"BBa_R0078","videoId":"BBa_R0078","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15G - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized, function, cellsignalling, CinR ] ['Promoter cinR and HSL regulated ...This promoter is the intergenic region from the CinRI locus. In Rhizobium...transcriptional elements. There is a short 200bp intergenic region between...cinR and cinI. The cinR intergenic cinI structure is conserved for the cinRI...']"},{"machine":"BBa_K1390003","videoId":"BBa_K1390003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15H - [ Protein_Domain ] ['mmoD is one subunit of the mmo from Methylococcus capsulatus bath...']"},{"machine":"BBa_I13601","videoId":"BBa_I13601","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15I - [ Reporter,classic, reporter, pret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1390004","videoId":"BBa_K1390004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15J - [ Protein_Domain ] ['This part is an improvement of...To detect whether the BioBrick is synthesized in soluble form or in inclusion...']"},{"machine":"BBa_R0082","videoId":"BBa_R0082","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15K - [ Regulatory,chassis, prokaryote, ecoli, classic, regulatory, uncategorized, Kit plates, probiotics, control, direction, forward, function, coliroid, promoter, regulation, positive, rnap, prokaryote, ecoli, sigma70 ] ['Promoter OmpR positive ...Positively regulated OmpR controlled promoter. This promoter is taken from...In nature this promoter is upstream of the ompC porin gene. The regulation of...ompC is determined by the EnvZ OmpR osmosensing machinery. EnvZ phosphorylates...']"},{"machine":"BBa_R0083","videoId":"BBa_R0083","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15M - [ Regulatory,rnap, prokaryote, ecoli, sigma70, direction, forward, chassis, prokaryote, ecoli, promoter, regulation, positive, classic, regulatory, uncategorized ] ['Promoter OmpR positive ...Positively regulated OmpR controlled promoter. This promoter is derived from...This promoter contains upstream regions of the ompC porin gene. The regulation...of ompC is determined by the EnvZ OmpR osmosensing machinery. EnvZ...']"},{"machine":"BBa_J23070","videoId":"BBa_J23070","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15O - [ RNA ] []"},{"machine":"BBa_K1433005","videoId":"BBa_K1433005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 15P - [ Composite ] ['This part is constructed to improve...enzyme sites of EcoRI and PstI. To improve the compatibility of this part and...Lambda red is a Lambda phage derived recombination system which contains three... Exo Exo is a 5 3 double strand DNA specific exonuclease and is only required for dsDNA recombination. It can degrade one of the whole strand of dsDNA to allow a single strand annealing recombination...']"},{"machine":"BBa_J23119","videoId":"BBa_J23119","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17A - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1424004","videoId":"BBa_K1424004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17B - [ Coding ] []"},{"machine":"BBa_J23100","videoId":"BBa_J23100","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17C - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member . Template Berk2006iGEM JCA TCPromoters... Template Berk2006iGEM JCA TCPromoters For video explanation on this...promoter family and its use see... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...']"},{"machine":"BBa_K1356003","videoId":"BBa_K1356003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17D - [ Coding,cds, biosynthesis ] [' NO2 into nitric oxide NO . This conversion is the first step in the...']"},{"machine":"BBa_J23101","videoId":"BBa_J23101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17E - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, plasmid, measurement, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member ...For video explanation on this promoter family and its use visit... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ...']"},{"machine":"BBa_K1356005","videoId":"BBa_K1356005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17F - [ Coding,cds, biosynthesis ] [' NO into nitrous oxide N2O . This conversion is the second step in the...']"},{"machine":"BBa_J23102","videoId":"BBa_J23102","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17G - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1385000","videoId":"BBa_K1385000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17H - [ Inverter ] ['CPCG2 promoter TetR...This part incorporates the CpcG2 promoter from Jeff Tabor s 2010 paper...an inverter. This light regulated promoter expresses TetR in the presence of...light. This part should be used in conjunction with...PcpcG2 is a promoter from the genome of Synechocystis sp. PCC6803. The...']"},{"machine":"BBa_J23103","videoId":"BBa_J23103","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17I - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1418040","videoId":"BBa_K1418040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17J - [ Coding,cds, reporter, cfp, function, reporter, fluorescence ] []"},{"machine":"BBa_J23104","videoId":"BBa_J23104","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17K - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1321334","videoId":"BBa_K1321334","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17L - [ Translational_Unit ] ['This part contains the coding sequence previously codon optimised for... Gluconacetobacter xylinus the Acs cellulose synthesis operon is a...and secretion to the extracellular space. Cellulose synthase is one of such...subunits. It is made up of two main domains a catalytic domain AcsA and a...']"},{"machine":"BBa_J23105","videoId":"BBa_J23105","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17M - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1321335","videoId":"BBa_K1321335","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17N - [ Translational_Unit ] ['This part contains the coding sequence previously codon optimised for...of AcsC and AcsD are still not very well understood and very little is known...these proteins are required for optimal production yields. AcsC is believed to...copy number plasmid pSB3K3 containing the inducible pLAC promoter. The...']"},{"machine":"BBa_J23106","videoId":"BBa_J23106","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17O - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1216008","videoId":"BBa_K1216008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 17P - [ Regulatory ] ['Variant of the wild type pLuxR promoter with lower sensitivity...mutant promoters. This approach ultimately lead to a library of promoters...bound PLuxL enables transcription of luxR whereas PLuxR is shut off except...inside the cell PLuxL is shut down and PLuxR induced yielding high...']"},{"machine":"BBa_K145001","videoId":"BBa_K145001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18B - [ Coding ] ['This RNA polymerase will start transcription from a T7 promoter such as... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K118000","videoId":"BBa_K118000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18D - [ Coding,function, biosynthesis, isoprenoid ] ['This is the coding sequence of dxs from Escherichia coli JM109. It encodes... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K118005","videoId":"BBa_K118005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18F - [ Translational_Unit,classic, generator, rc, function, biosynthesis, isoprenoid ] ['This is the coding sequence of crtI from Pantoea ananatis formerly...']"},{"machine":"BBa_I742111","videoId":"BBa_I742111","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18H - [ Translational_Unit,classic, generator, RC, function, biosynthesis, function, odor ] ['diphosphate an intermediate in the mevalonate pathway . Limonene is a... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_J45199","videoId":"BBa_J45199","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18J - [ Generator,classic, generator, rct, function, odor, s ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_I746101","videoId":"BBa_I746101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18L - [ Signalling ] ['This part is simply the AIP sensor infrastructure...In the natural system the signalling oligopeptide termed AIP is made from...AgrD by the membrane located enzyme AgrB. It is then detected by the membrane ...and upregulates transcription of the promoters termed P2 and P3 in the agr...']"},{"machine":"BBa_P0312","videoId":"BBa_P0312","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18N - [ Generator,classic, generator, rct, function, regulation, transcriptional ] []"},{"machine":"BBa_I746200","videoId":"BBa_I746200","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 18P - [ Coding,cds, membrane, channel ] ['FepA is an outer membrane receptor protein for Escherichia coli involved in...the uptake of the ferric enterobactin siderophore. This part is a deletion... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...']"},{"machine":"BBa_J23107","videoId":"BBa_J23107","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19A - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1982006","videoId":"BBa_K1982006","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19B - [ Device,function, crispr, function, crispr, cas9 ] ['The CRY2 CIBN interaction is entirely genetically encoded. The binding...by placing samples in the dark. This fusion protein is for use in LACE light ...To regulate DNA transcription by blue light the system is based on CRY2 CIBN...fusion proteins to the promoter region results in robust transcription...']"},{"machine":"BBa_J23110","videoId":"BBa_J23110","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19C - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1026002","videoId":"BBa_K1026002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19D - [ Composite,function, crispr ] ['This Constitutively Expressed gRNA targeting mRFP is a no BioBrick scars...result is shown as follows ...there is a significant knock down effect of mRFP....This result is in consistent with our expectation....']"},{"machine":"BBa_J23112","videoId":"BBa_J23112","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19E - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K311004","videoId":"BBa_K311004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19F - [ Composite ] ['upstream by a mutated Lac promoter which is constitutively active. The Eut...tag the GFP is believed to be localized within the microcompartment. These...']"},{"machine":"BBa_J23113","videoId":"BBa_J23113","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19G - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K325101","videoId":"BBa_K325101","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19H - [ Translational_Unit ] ['This part is a translational unit for a mutant of the luciferase from the...EPIC stands for Enhanced Photon Initiating Complex . It is described in...The part is codon optimised for expression in E.coli ....']"},{"machine":"BBa_J23114","videoId":"BBa_J23114","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19I - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1680009","videoId":"BBa_K1680009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19J - [ Coding,cds, cds, reporter, chassis, eukaryote, yeast, function, reporter, light ] ['This part contains the protein coding region for the NanoLuc tm luciferase ...which is originally designed by Promega Corporation http bit.ly 1Vgmab3 ...free for research use . Nanoluciferase is a small and monomeric enzyme... 19.1kDa and is about 150 times brighter than other luciferases. The new...']"},{"machine":"BBa_J23115","videoId":"BBa_J23115","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19K - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1847008","videoId":"BBa_K1847008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19L - [ Regulatory,awards, part_Kit plate, 2015 ] ['Kit plate of promoters regulated by LldR....K822000 consists of two operators O1 and O2 and a promoter which is... lldPRD operon and it is involved in L lactate metabolism. This promoter is...allow the RNA polymerase to bind to the promoter. LldR can also have a...']"},{"machine":"BBa_J23116","videoId":"BBa_J23116","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19M - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1650037","videoId":"BBa_K1650037","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19N - [ Coding,awards, part_Kit plate, 2015 ] []"},{"machine":"BBa_J23117","videoId":"BBa_J23117","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19O - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_K1614000","videoId":"BBa_K1614000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 19P - [ Regulatory,chassis, bacteriophage, T7, chassis, prokaryote, ecoli, direction, forward, plasmid, expression, t7, promoter, regulation, constitutive, rnap, bacteriophage, T7 ] ['T7 promoter for expression of functional RNA...Minimal promoter derived from T7 phage promoter....This T7 promoter derivate is especially useful for the use in in vitro...applications. The G which is the startpoint for transcription is included in...']"},{"machine":"BBa_K115001","videoId":"BBa_K115001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 20B - [ RNA ] ['which is based on a RNA thermometer from Bradyrhizobium japonicum that...blue region is the Shine Dalgarno sequence which is the ribosome binding site.... The following information is the contribution of SVCE Chennai 2016 ... Secondary Structure when RNA thermometer is not ligated to any protein ...']"},{"machine":"BBa_K115002","videoId":"BBa_K115002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 20D - [ RNA ] ['which is based on a RNA thermometer from Salmonella Enterica Tyhpy that...blue region is the Shine Dalgarno sequence which is the ribosome binding site....Often regulation of environmentally controlled genes is realized at the...RNA thermometer FourU works as expected. This is the adaptor...']"},{"machine":"BBa_K115003","videoId":"BBa_K115003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 20F - [ RNA ] ['which is based on a RNA thermometer from Listeria Monocytogenes that...blue region is the Shine Dalgarno sequence which is the ribosome binding site....']"},{"machine":"BBa_K115017","videoId":"BBa_K115017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 20H - [ RNA ] ['and which is designed to initiate translation around 32 C....blue region is the Shine Dalgarno sequence which is the ribosome binding site....']"},{"machine":"BBa_J23118","videoId":"BBa_J23118","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21A - [ Regulatory,chassis, prokaryote, ecoli, direction, forward, promoter, anderson, regulation, constitutive, rnap, prokaryote, ecoli, sigma70 ] ['constitutive promoter family member... BerkiGEM2006 PromotersEppendorfs.jpg wiki images thumb 3 37 BerkiGEM2006 PromotersEppendorfs.jpg 300px ...BerkiGEM2006 PromotersEppendorfs.jpg File BerkiGEM2006 PromotersEppendorfs.jpg ... BerkiGEM2006 Promoters.jpg wiki images thumb 0 05 BerkiGEM2006 Promoters.jpg 300px ...']"},{"machine":"BBa_J364000","videoId":"BBa_J364000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23B - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 1 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...the GFP is used as the reporter gene. So other teams who have the need of...']"},{"machine":"BBa_I13452","videoId":"BBa_I13452","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21C - [ DNA,dna, cloningsite ] []"},{"machine":"BBa_K1321333","videoId":"BBa_K1321333","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21D - [ Regulatory,regulation ] ['This regulatory part is made up of the Arabinose Inducible promoter pBAD and...the AraC and pBAD promoter sequences and producing a DNA loop that prevents...Arabinose is supplied this binds to the AraC dimer and releases it from the...operator site found in the pBAD promoter at the same time it enhances...']"},{"machine":"BBa_I13500","videoId":"BBa_I13500","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21E - [ Composite,classic, composite, uncategorized ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1357009","videoId":"BBa_K1357009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21F - [ Composite ] ['This part consists of an RBS the blue chromogenic protein amilCP and a...double terminator. This part is intended to serve as a useful reporter to...determine what level of expression the system in which it is incorporated into...desired conditions a chromogenic change can be observed using this part....']"},{"machine":"BBa_I13502","videoId":"BBa_I13502","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21G - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1357010","videoId":"BBa_K1357010","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21H - [ Composite ] ['This part consists of an RBS the red chromogenic fluorescent protein mRFP ...and a double terminator. This part is intended to serve as a useful reporter...to determine what level of expression the system in which it is incorporated...desired conditions a chromogenic change can be observed using this part....']"},{"machine":"BBa_I13504","videoId":"BBa_I13504","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21I - [ Reporter,classic, reporter, ret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1333005","videoId":"BBa_K1333005","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21J - [ Coding,cds ] ['G8P plays an important role in phage enveloping and release. G8P is one of the...introduction of M13 life cycle is necessary. The general stages of M13 life...enters the cell is converted to a supercoiled double stranded replicative...Rephelicase. The displaced positive strand is recircularized by G2P and...']"},{"machine":"BBa_I15016","videoId":"BBa_I15016","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21K - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] ['This part accepts POPS to produce ECFP under the medium RBS B0032...']"},{"machine":"BBa_K1319002","videoId":"BBa_K1319002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21L - [ Coding ] ['This part is a RFC 25 dark quencher that is based upon K1319000 the RFC 25 ...This protein is designed to be a dark quencher for GFP...Transfer System system. GFPs emission energy is thereby taken up by REACh2...protease is expressed and the linker is cut. The cutting separates GFP and...']"},{"machine":"BBa_I15017","videoId":"BBa_I15017","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21M - [ Translational_Unit,function, reporter, function, reporter, fluorescence ] ['This part accepts POPS to generate EYFP under the medium strength RBS B0032.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_K1319004","videoId":"BBa_K1319004","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21N - [ Coding,cds, enzyme, protease ] ['This part is a TEV protease in RFC25 that was optimized for expression in E....endopeptidase is a highly sequence specific cysteine protease from the...Tobacco Edge Virus TEV . The protease is highly sequence specific. The...consensus sequence for the cut is ENLYFQ S with denoting the cleaved peptide...']"},{"machine":"BBa_I13507","videoId":"BBa_I13507","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 21O - [ Composite,classic, composite, uncategorized ] []"},{"machine":"BBa_J04454","videoId":"BBa_J04454","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 22H - [ Reporter ] []"},{"machine":"BBa_C0056","videoId":"BBa_C0056","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23A - [ Coding,cds, cds, transcriptionalregulator, repressor, function, regulation, transcriptional ] ['which use temperature as a screening condition. CI434ts is a heat inducible...ON transcription factor which is a thermo sensitive mutation type of CI434...temperatures. As shown in Figure 3 when the temperature is high CI434ts will...function and repress its promoter to inhibit the process of under stream genes...']"},{"machine":"BBa_B0040","videoId":"BBa_B0040","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23C - [ DNA,classic, other, uncategorized, DNA, spacer ] ['BioBrick part containing the promoter of the new gene. Please use the AlignX...It is not clear if spacers are needed or not in the final assembly. A spacer...transcriptional machinery at the promoter of the next module in the assembly...the transcription of the previous module is taking place. However there is no...']"},{"machine":"BBa_J364001","videoId":"BBa_J364001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23D - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 2 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...aim is to convert relative fluorescent values to absolute units using the...']"},{"machine":"BBa_I13600","videoId":"BBa_I13600","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23E - [ Reporter,classic, reporter, pret ] ['absence of the tetR protein CFP expression is constitutive. tetR represses... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...on growth . Therefore users can depend on this part to remain stable for many...']"},{"machine":"BBa_J364002","videoId":"BBa_J364002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23F - [ Measurement,cds, reporter, gfp, classic, plasmid, measurement ] ['This is a GFP expressing constitutive device for the 2017 iGEM InterLab study....It is called Test Device 3 for the study for easy reference....This device is stored in pSB1C3 for the InterLab and is fully BioBrick...']"},{"machine":"BBa_I13001","videoId":"BBa_I13001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23G - [ Reporter,classic, reporter, ret ] ['This part was found to express well when excited with fluorescence in the...We expressed this part in E.coli using pbad promoter and J23116 promoter.... Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...']"},{"machine":"BBa_J364007","videoId":"BBa_J364007","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23H - [ Measurement ] ['Test Device 4 expresses GFP under the control of a constitutive promoter from...in synthetic biology. Lysogeny broth LB is the most commonly used media in...biology research. It is easy to make and compatible with most microorganisms....least for GFP. If more functional protein is the goal LB may be the better...']"},{"machine":"BBa_I13002","videoId":"BBa_I13002","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23I - [ Reporter,classic, reporter, ret ] [' Burden Imposed by this Part ...Burden is the percent reduction in the growth rate of E. coli cells...confidence limits . This part exhibited a significant burden. Users should be...']"},{"machine":"BBa_J364008","videoId":"BBa_J364008","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23J - [ Measurement ] ['Test Device 5 expresses GFP under the control of a constitutive promoter from...']"},{"machine":"BBa_I13003","videoId":"BBa_I13003","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23K - [ Reporter,classic, reporter, ret ] []"},{"machine":"BBa_J364009","videoId":"BBa_J364009","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23L - [ Measurement ] ['Test Device 6 expresses GFP under the control of a constitutive promoter from...']"},{"machine":"BBa_J61000","videoId":"BBa_J61000","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23M - [ Generator,plasmidbackbone, component, selectionmarker, antibioticresistance, direction, reverse ] ['Chloramphenicol resistance gene including its native promoter and ribosome... This part belongs to a family useful for the construction of transposons and... FRT The FRT sequence is the recombination substrate for Flp... Transposition mutagenesis is usually carried out by mating a donor strain...']"},{"machine":"BBa_J61001","videoId":"BBa_J61001","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23O - [ DNA,plasmid, component, origin ] ['the absence of a second origin. In most E. coli strains this is a silent... This part belongs to a family useful for the construction of transposons and... FRT The FRT sequence is the recombination substrate for Flp... Transposition mutagenesis is usually carried out by mating a donor strain...']"},{"machine":"BBa_I20270","videoId":"BBa_I20270","timestamp":{"minutes": 28, "seconds": 20}, "line":"Kit plate 6, 23P - [ Measurement ] ['Promoter MeasKit J23151 ...J23151 inserted in the Promoter MeasKit...I20270 serves as the positive control for the iGEM InterLab study. It is in...']"}]