The synthesized gene fragment of the peptide with his-tag annealed at the C-terminus was inserted to pET-30a vector through double digestion (NdeI-HindIII).
(2)6x Histidine-Tag at N-terminus
The synthesized fragment of the peptide with his-tag annealed at the N-terminus was inserted to pET-30a vector through double digestion (NdeI-HindIII).
(3)Flag-Tag
The synthesized fragment of the peptide with flag-tag annealed at the N-terminus was inserted to pET-30a vector through double digestion (NdeI-XhoI). (4)No Tag
The synthesized fragment of the peptide was inserted to pET-30a vector through double digestion (NdeI-HindIII). (5)Triple Tandem with SUMO Tag
The synthesized fragment contains (1) his-tag at the beginning for future purification, (2) sumo-tag for masking the toxicity to the host and providing cleavage site to remove the tags attached to the peptide, (3) triple peptide tandem. The fragment was then inserted to pET-30a vector through double digestion (NdeI-HindIII).
Peptide Expression
To knock out degP gene from the bacteria host, a two plasmid CRISPR system was applied. The function of the first plasmid, pCAS, is constitutive expression of cas9 and inducible expression of lambda RED and sgR. The function of the first plasmid, pCAS, is constitutive expression of cas9 and inducible expression of lambda RED and sgR. The function of the second plasmid, pTagetF, is to express sgRNA that guides cas9 protein to make cleavage on the host genome.
To build pTagetF-degP that can express sgRNA targeting degP, we performed PCR of the pTagetF plasmid with the following two primer pair.
>sgF1 TCCTAGGTATAATACTAGTGTGGTCAGCATTAACGTAGAGTTTTAGAGCTAGAAATAGC
>sgR1 ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG
>sgF2 TCCTAGGTATAATACTAGTGTGGTCAGCATTAACGTAGAGTTTTAGAGCTAGAAATAGC
>sgR1 ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG
Jiang et al., (2015) https://journals.asm.org/doi/10.1128/AEM.04023-14#F3
© Copyright DKU iGEM. All Rights Reserved