Team:Bulgaria/Results
Results:
1. Introduction of novel ingredients in the cultivation media for improved monitoring of the bacterial growth on solid media. We tested two different compounds (titanium dioxide and activated charcoal) that lead to white and black agar respectively. Next, we assembled different expression constructs, with chromoproteins, to see if they show improved visibility compared to normal LB medium. You can see some representative results, on the following pictures.
The overall conclusion is that red chromoproteins are best observed on white media, while the yellow ones show optimal visibility on the black agar.
2. Building of a novel system for continuous kinetic measurement of cell growth on a petri dish. We measured the difference in growth kinetics between E. coli cells on the novel agars we mention above and bacterial growth on normal LB agar. We also noted the contrast difference of the different types of genetically modified cells with different colored light sources.
Images from the camera
3.Sequencing the genome of a clinical carbapenem resistant strain Klebsiella pneumoniae.
We received 1 Gb sequencing information that consisted of 2x150 bp paired end reads from BGI genomics. The resulting raw read pairs were uploaded to the Galaxy online platform. The read pairs were inspected with FastQC and then trimmed for adapter sequences and poor-quality bases by Trimmomatic. Initial de novo assembly of the processed reads was carried out using the SPAdes assembler with default settings. SPAdes generated a 5.52 Mb assembly comprising of 82 contigs larger than 1000 bp with an N50 value of 198,180 bp and an average GC content of 57.2% (evaluated by QUAST). Next we investigated the resistome of this strain, using the tool ABRicate. All localized antibiotic resistance determinants are shown in the following table:
We successfully identified the reason for carbapenem resistance, the blaKPC-2 gene that encodes for carbapenem-hydrolyzing class A beta-lactamase KPC-2 enzyme.
4. We designed primers that can amplify the variable gene cassettes of Class I integrons:
| Name | Sequence |
|---|---|
| Int_class1_1F | ACACCGTGGAAACGGATGAA |
| Int_class1_2F | GATGAAGGCACGAACCCAGT |
| Int_class1_3F | GGAAACGGATGAAGGCACGA |
| T7_Int_class1_2F | TAATACGACTCACTATAGGATGAAGGCACGAACCCAGT |
| Int_class1_1R | TCTAAGAGCGGCGCAATACG |
| Int_class1_2R | CGGTTGGAAGCTGTCGATTG |
| Int_class1_3R | CCTCGAAGAACCGCACAATC |
We successfully applied these primers to a control strain P. aeruginosa that contains a known Class I integron that contains VIM-2 metallo-beta-lactamase (“Characterization of a Bulgarian VIM-2 metallo-β-lactamase-producing Pseudomonas aeruginosa clinical isolate belonging to the high-risk sequence type 111” doi.org/10.1080/23744235.2021.1934531).
5. We developed a novel T-cloning vector that allows efficient TA cloning of integron gene cassettes. The TA cloning module utilizes two restriction sites for the AhdI enzyme that generate single T-overhangs upon digestion. Its sequence was submitted to the Part registry, under number BBa_K3764000 (Aleks link). On the following picture, you can see the results, of a controlled TA cloning, that uses the mRFP1 expression cassette as a test insert.
6. We optimized the design of the cloning vector with removing the LacZα fragment and putting the mRFP1 coding sequence in its place. This novel module was submitted to the Parts registry under the number BBa_K3764001
7. We successfully transferred the blaVIM-2 containing gene cassette in E. coli, after cloning it in our T-vector based on module BBa_K3764000
8. We designed three primer pairs that can amplify the QRDR region of the gyrA gene in E. coli
| Name | Sequence |
|---|---|
| Primer F1 | GAGCGACCTTGCGAGAGAA |
| Primer F2 | ATGAGCGACCTTGCGAGAG |
| Primer F3 | AGCGACCTTGCGAGAGAAAT |
| Primer R1 | CGTTAATGATTGCCGCCGTC |
| Primer R2 | GCTTCTTCAATACCGCGACG |
| Primer R3 | GACCGTTAATGATTGCCGCC |
9. We developed a reporter vector that contains the remaining part of the gyrA coding sequence in combination with XbaI and HintIII restriction sites, that allow in frame cloning of QRDR region PCR primers. Upon test with fragments that contain known mutations which confers quinolone resistance we did not observe colonies on petri dishes with levofloxacin. This was due to the dominant phenotype carried by the chromosomal gyrA gene copy.
10. We created a novel cloning-based system that can be used for monitoring the formation of unproductive chimera and artifacts between highly similar DNA sequences in PCR amplifications. We needed this tool because we wanted to see if the PCR amplification step of the QRDR regions found in complex samples can lead to chimera formation, that has the potential to bias our results. This system consists of two parts, that were submitted to the registry - BBa_K3764002 and BBa_K3764003 (aleks link?). They both consist of mRFP1 coding sequence but two tyrosine codons in them were mutated to amber (TAG) stop codons. We mixed both these parts and amplified the mixture before cloning it into a vector with constitutive promotor and RBS, results are presented on the following picture.
The presence of red colonies indicates chimera formation that can have influence on our findings. To limit this, we plan to use emulsion PCR that limits such events by physically separating the DNA matrix molecules.
11. We made a model for antibiotic resistance occurrence, using laboratory E. coli strain and sublethal concentrations of the antibiotic rifampicin. We used normal cultivation with fixed antibiotic concentrations as well as a continues growth with increasing rifampicin amounts. In both cases, we quickly observed the occurrence of resistant clones, as indicated by the antibiograms presented on the following photos:
Unmodified KRX antibiogram is on the left and the resultant resistant strain on the right.